miRNA Card

miRNA General Information
miRNA ID hsa-miR-3674
Description Homo sapiens miR-3674 stem-loop
Comment None
Experiment Illumina [1]
Sequence AUUGUAGAACCUAAGAUUGGCC
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr9:120601430|120601617 hsa-miR-3674 0 1 0
chr19:1586623|1586754 hsa-miR-3674 0 1 0
chr17:47952210|47952329 hsa-miR-3674 0 1 0
chr3:5218615|5218764 hsa-miR-3674 0 1 0
chr2:112216117|112216228 hsa-miR-3674 0 1 0
chr9:120601528|120601649 hsa-miR-3674 0 1 0
chr17:7390041|7390150 hsa-miR-3674 0 1 0
chr11:111560114|111560236 hsa-miR-3674 0 1 0
chr2:27443107|27443465 hsa-miR-3674 0 1 0
chr22:36370558|36370634 hsa-miR-3674 1 0 0
chr3:47918719|47918841 hsa-miR-3674 1 0 0
chr2:112216117|112216245 hsa-miR-3674 0 1 0
chrX:3324257|3324417 hsa-miR-3674 0 1 0
chr4:158170735|158170862 hsa-miR-3674 0 1 0
chr1:171587008|171587162 hsa-miR-3674 0 1 0
chr11:102397435|102397584 hsa-miR-3674 0 1 0
chr2:112216108|112216247 hsa-miR-3674 0 1 0
chr1:113976479|113976659 hsa-miR-3674 0 1 0
chr19:11324031|11324181 hsa-miR-3674 0 1 0
chr17:7390041|7390152 hsa-miR-3674 0 1 0
chr19:49669887|49670044 hsa-miR-3674 0 1 0
chr8:70110437|70110619 hsa-miR-3674 0 1 0
chr8:61515591|61515713 hsa-miR-3674 0 1 0
chr1:172608747|172608802 hsa-miR-3674 0 1 0
chr1:235109865|235109967 hsa-miR-3674 0 1 0
chr12:6923280|6923456 hsa-miR-3674 0 1 0
chr1:171587019|171587162 hsa-miR-3674 0 1 0
chr12:6923287|6923456 hsa-miR-3674 0 1 0
chr5:71658172|71658305 hsa-miR-3674 0 1 0
chr14:73983132~73986963 hsa-miR-3674 0 1 0
chr5:82275342|82275476 hsa-miR-3674 0 1 0
chr11:102397435~102397584 hsa-miR-3674 0 1 0
chr17:7390041~7390150 hsa-miR-3674 0 1 0
chr11:111560114~111560236 hsa-miR-3674 0 1 0
chr19:11324016~11324144 hsa-miR-3674 0 1 0
chr14:34460242~34460345 hsa-miR-3674 0 1 0
chr2:27443107~27443449 hsa-miR-3674 0 1 0
chr5:82275329~82275490 hsa-miR-3674 0 1 0
chr16:30187948~30188241 hsa-miR-3674 0 1 0
chr9:120601528~120601649 hsa-miR-3674 0 1 0
chr1:170726665~170726952 hsa-miR-3674 0 1 0
chr19:11324031~11324137 hsa-miR-3674 0 1 0
chr5:38918695~38918973 hsa-miR-3674 0 1 0
chr17:28620509|28620630 hsa-miR-3674 0 1 0
chr19:11324016~11324130 hsa-miR-3674 0 1 0
chr14:102743478|102743710 hsa-miR-3674 1 0 0
chr8:9580159|9580383 hsa-miR-3674 0 1 0
chr8:116726016|116726111 hsa-miR-3674 0 1 0
chr12:48700775|48700880 hsa-miR-3674 0 1 0
chr1:169376854|169376947 hsa-miR-3674 0 1 0
chr17:64326614|64326764 hsa-miR-3674 0 1 0
chr12:98513878|98513978 hsa-miR-3674 0 1 0
chr3:122888342|122888496 hsa-miR-3674 0 1 0
chr22:24099536|24099667 hsa-miR-3674 0 1 0
chr3:16332495|16332714 hsa-miR-3674 0 1 0
chr1:64845966|64846174 hsa-miR-3674 0 1 0
chr13:46170387|46170511 hsa-miR-3674 0 1 0
chr1:54238215|54238401 hsa-miR-3674 0 1 0
chr3:122888359|122888496 hsa-miR-3674 0 1 0
chr16:27363872|27364048 hsa-miR-3674 1 0 0
chr21:32747641|32747733 hsa-miR-3674 1 0 0
chr3:47918719|47921878 hsa-miR-3674 1 0 0
chr1:113976542|113976733 hsa-miR-3674 0 1 0
chr1:179095710|179095938 hsa-miR-3674 0 1 0
chr5:38918840|38918973 hsa-miR-3674 0 1 0
chr17:48135621|48135748 hsa-miR-3674 0 1 0
chr17:7390021|7390152 hsa-miR-3674 0 1 0
chr2:112216108|112216245 hsa-miR-3674 0 1 0
chr20:36777942|36778206 hsa-miR-3674 0 1 0
chr5:71658253|71658404 hsa-miR-3674 0 1 0
chr17:47682529|47682669 hsa-miR-3674 0 1 0
chr10:5748827|5748978 hsa-miR-3674 0 1 0
chr9:33886881|33900271 hsa-miR-3674 0 1 0
chr5:95755396|95763620 hsa-miR-3674 0 1 0
chr10:97436417|97437750 hsa-miR-3674 0 1 0
chr11:102397435|102397548 hsa-miR-3674 0 1 0
chr6:32180982|32181177 hsa-miR-3674 0 1 0
chr11:102397360|102397550 hsa-miR-3674 0 1 0
chr17:7390041|7390184 hsa-miR-3674 0 1 0
chr2:27443107|27443449 hsa-miR-3674 0 1 0
chr20:58651629|58651723 hsa-miR-3674 0 1 0
chr22:41696210|41696327 hsa-miR-3674 0 1 0
chr19:11324031|11324167 hsa-miR-3674 0 1 0
chr10:103870359|103870633 hsa-miR-3674 0 1 0
chr11:102397435|102397581 hsa-miR-3674 0 1 0
chr18:31071663|31071771 hsa-miR-3674 0 1 0
chr1:46572602|46572802 hsa-miR-3674 -5 1 0
chr11:102397370|102397584 hsa-miR-3674 -12 1 0
chr7:149544217|149544529 hsa-miR-3674 -10 1 0
chr12:96011442|96011520 hsa-miR-3674 -10 1 0
chr7:26196422|26196857 hsa-miR-3674 1 0 0
chr1:86734653|86735139 hsa-miR-3674 0 1 0
chr2:48372616|48372856 hsa-miR-3674 0 1 0
chr11:102397360|102397584 hsa-miR-3674 0 1 0
chr2:112216108|112216242 hsa-miR-3674 0 1 0
chr17:47952206|47952432 hsa-miR-3674 0 1 0
chr5:71658207|71658301 hsa-miR-3674 0 1 0
chr11:102397435|102397542 hsa-miR-3674 0 1 0
chr12:6941747|6941971 hsa-miR-3674 0 1 0
chr2:74153431|74153526 hsa-miR-3674 0 1 0
chr7:157268821|157269029 hsa-miR-3674 0 1 0
chr6:157909723|157909951 hsa-miR-3674 0 1 0
chr19:11324031|11324144 hsa-miR-3674 0 1 0
chr16:31123790|31123950 hsa-miR-3674 0 1 0
chr17:47952305|47952434 hsa-miR-3674 0 1 0
chr2:171320947|171321096 hsa-miR-3674 1 0 0
chr6:53003620|53003856 hsa-miR-3674 1 0 0
chr16:27363917|27364048 hsa-miR-3674 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-3674 GMNC geminin coiled-coil domain containing HGNC:40049 details
hsa-miR-3674 MTMR9 myotubularin related protein 9 HGNC:14596 details
hsa-miR-3674 RBM14 RNA binding motif protein 14 HGNC:14219 details
hsa-miR-3674 KNL1 kinetochore scaffold 1 HGNC:24054 details
hsa-miR-3674 NSD2 nuclear receptor binding SET domain protein 2 HGNC:12766 details
hsa-miR-3674 POGK pogo transposable element derived with KRAB domain HGNC:18800 details
hsa-miR-3674 details
hsa-miR-3674 CD4 CD4 molecule HGNC:1678 details
hsa-miR-3674 SCAMP1 secretory carrier membrane protein 1 HGNC:10563 details
hsa-miR-3674 HSP90AA1 heat shock protein 90 alpha family class A member 1 HGNC:5253 details
hsa-miR-3674 ARNTL aryl hydrocarbon receptor nuclear translocator like HGNC:701 details
hsa-miR-3674 IFITM3 interferon induced transmembrane protein 3 HGNC:5414 details
hsa-miR-3674 HSPA1B heat shock protein family A (Hsp70) member 1B HGNC:5233 details
hsa-miR-3674 NBPF11 NBPF member 11 HGNC:31993 details
hsa-miR-3674 NFATC2IP nuclear factor of activated T cells 2 interacting protein HGNC:25906 details
hsa-miR-3674 TBK1 TANK binding kinase 1 HGNC:11584 details
hsa-miR-3674 CCNT2 cyclin T2 HGNC:1600 details
hsa-miR-3674 ZNF138 zinc finger protein 138 HGNC:12922 details
hsa-miR-3674 RPL18 ribosomal protein L18 HGNC:10310 details
hsa-miR-3674 BUB3 BUB3 mitotic checkpoint protein HGNC:1151 details
hsa-miR-3674 ZNF732 zinc finger protein 732 HGNC:37138 details
hsa-miR-3674 KRTAP5-6 keratin associated protein 5-6 HGNC:23600 details
hsa-miR-3674 OARD1 O-acyl-ADP-ribose deacylase 1 HGNC:21257 details
hsa-miR-3674 OTUD6A OTU deubiquitinase 6A HGNC:32312 details
hsa-miR-3674 SPCS1 signal peptidase complex subunit 1 HGNC:23401 details
hsa-miR-3674 ZNF512B zinc finger protein 512B HGNC:29212 details
hsa-miR-3674 PARP15 poly(ADP-ribose) polymerase family member 15 HGNC:26876 details
hsa-miR-3674 C4orf36 chromosome 4 open reading frame 36 HGNC:28386 details
hsa-miR-3674 DCAF16 DDB1 and CUL4 associated factor 16 HGNC:25987 details
hsa-miR-3674 TOGARAM2 TOG array regulator of axonemal microtubules 2 HGNC:33715 details
hsa-miR-3674 CD1D CD1d molecule HGNC:1637 details
hsa-miR-3674 SULT1B1 sulfotransferase family 1B member 1 HGNC:17845 details
hsa-miR-3674 ZNF117 zinc finger protein 117 HGNC:12897 details
hsa-miR-3674 SPC25 SPC25 component of NDC80 kinetochore complex HGNC:24031 details
hsa-miR-3674 ILDR1 immunoglobulin like domain containing receptor 1 HGNC:28741 details
hsa-miR-3674 SEC14L5 SEC14 like lipid binding 5 HGNC:29032 details
hsa-miR-3674 RBM28 RNA binding motif protein 28 HGNC:21863 details
hsa-miR-3674 TOR1AIP1 torsin 1A interacting protein 1 HGNC:29456 details
hsa-miR-3674 SLAIN2 SLAIN motif family member 2 HGNC:29282 details
hsa-miR-3674 QSER1 glutamine and serine rich 1 HGNC:26154 details
hsa-miR-3674 GPR137C G protein-coupled receptor 137C HGNC:25445 details
hsa-miR-3674 FCHO2 FCH and mu domain containing endocytic adaptor 2 HGNC:25180 details
hsa-miR-3674 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 HGNC:14886 details
hsa-miR-3674 ANGPTL3 angiopoietin like 3 HGNC:491 details
hsa-miR-3674 SLC30A5 solute carrier family 30 member 5 HGNC:19089 details
hsa-miR-3674 KIAA1549 KIAA1549 HGNC:22219 details
hsa-miR-3674 RNF20 ring finger protein 20 HGNC:10062 details
hsa-miR-3674 C8orf33 chromosome 8 open reading frame 33 HGNC:26104 details
hsa-miR-3674 SNRPA1 small nuclear ribonucleoprotein polypeptide A' HGNC:11152 details
hsa-miR-3674 PLAG1 PLAG1 zinc finger HGNC:9045 details
hsa-miR-3674 NCL nucleolin HGNC:7667 details
hsa-miR-3674 C2orf69 chromosome 2 open reading frame 69 HGNC:26799 details
hsa-miR-3674 RNF157 ring finger protein 157 HGNC:29402 details
hsa-miR-3674 ZFP36L2 ZFP36 ring finger protein like 2 HGNC:1108 details
hsa-miR-3674 TVP23C trans-golgi network vesicle protein 23 homolog C HGNC:30453 details
hsa-miR-3674 PUM2 pumilio RNA binding family member 2 HGNC:14958 details
hsa-miR-3674 NUBP1 nucleotide binding protein 1 HGNC:8041 details
hsa-miR-3674 HOXD11 homeobox D11 HGNC:5134 details
hsa-miR-3674 BAG4 BAG cochaperone 4 HGNC:940 details
hsa-miR-3674 SINHCAF SIN3-HDAC complex associated factor HGNC:30702 details
hsa-miR-3674 RAB3IP RAB3A interacting protein HGNC:16508 details
hsa-miR-3674 ZCCHC14 zinc finger CCHC-type containing 14 HGNC:24134 details
hsa-miR-3674 ZNF99 zinc finger protein 99 HGNC:13175 details
hsa-miR-3674 PARK7 Parkinsonism associated deglycase HGNC:16369 details
hsa-miR-3674 NOLC1 nucleolar and coiled-body phosphoprotein 1 HGNC:15608 details
hsa-miR-3674 ZNF107 zinc finger protein 107 HGNC:12887 details
hsa-miR-3674 POTEM POTE ankyrin domain family member M HGNC:37096 details
hsa-miR-3674 POTEG POTE ankyrin domain family member G HGNC:33896 details
hsa-miR-3674 KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-3674 ALKBH5 alkB homolog 5, RNA demethylase HGNC:25996 details
hsa-miR-3674 EIF4A1 eukaryotic translation initiation factor 4A1 HGNC:3282 details
hsa-miR-3674 FAM241A family with sequence similarity 241 member A HGNC:26813 details
hsa-miR-3674 MTX3 metaxin 3 HGNC:24812 details
hsa-miR-3674 MNT MAX network transcriptional repressor HGNC:7188 details
hsa-miR-3674 NTPCR nucleoside-triphosphatase, cancer-related HGNC:28204 details
hsa-miR-3674 BTBD3 BTB domain containing 3 HGNC:15854 details
hsa-miR-3674 EFCAB14 EF-hand calcium binding domain 14 HGNC:29051 details
hsa-miR-3674 PDHB pyruvate dehydrogenase E1 subunit beta HGNC:8808 details
hsa-miR-3674 YIPF4 Yip1 domain family member 4 HGNC:28145 details
hsa-miR-3674 COX19 cytochrome c oxidase assembly factor COX19 HGNC:28074 details
hsa-miR-3674 TRUB2 TruB pseudouridine synthase family member 2 HGNC:17170 details
hsa-miR-3674 SLC16A10 solute carrier family 16 member 10 HGNC:17027 details
hsa-miR-3674 RBMS3 RNA binding motif single stranded interacting protein 3 HGNC:13427 details
hsa-miR-3674 PLCG2 phospholipase C gamma 2 HGNC:9066 details
hsa-miR-3674 STXBP2 syntaxin binding protein 2 HGNC:11445 details
hsa-miR-3674 DIAPH1 diaphanous related formin 1 HGNC:2876 details
hsa-miR-3674 IP6K1 inositol hexakisphosphate kinase 1 HGNC:18360 details
hsa-miR-3674 SFT2D3 SFT2 domain containing 3 HGNC:28767 details
hsa-miR-3674 ZNF208 zinc finger protein 208 HGNC:12999 details
hsa-miR-3674 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1 like 2 HGNC:27067 details
hsa-miR-3674 TRPV2 transient receptor potential cation channel subfamily V member 2 HGNC:18082 details
hsa-miR-3674 SPPL2A signal peptide peptidase like 2A HGNC:30227 details
hsa-miR-3674 RNF115 ring finger protein 115 HGNC:18154 details
hsa-miR-3674 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 HGNC:5031 details
hsa-miR-3674 LAYN layilin HGNC:29471 details
hsa-miR-3674 NCBP2 nuclear cap binding protein subunit 2 HGNC:7659 details
hsa-miR-3674 ZNF264 zinc finger protein 264 HGNC:13057 details
hsa-miR-3674 KLHL24 kelch like family member 24 HGNC:25947 details
hsa-miR-3674 ZNF724 zinc finger protein 724 HGNC:32460 details
hsa-miR-3674 ATP6V0E1 ATPase H+ transporting V0 subunit e1 HGNC:863 details
hsa-miR-3674 C3orf52 chromosome 3 open reading frame 52 HGNC:26255 details
hsa-miR-3674 APOBEC3C apolipoprotein B mRNA editing enzyme catalytic subunit 3C HGNC:17353 details
hsa-miR-3674 FEM1A fem-1 homolog A HGNC:16934 details
hsa-miR-3674 MAP2K2 mitogen-activated protein kinase kinase 2 HGNC:6842 details
hsa-miR-3674 MLXIP MLX interacting protein HGNC:17055 details
hsa-miR-3674 SP110 SP110 nuclear body protein HGNC:5401 details
hsa-miR-3674 TMEM245 transmembrane protein 245 HGNC:1363 details
hsa-miR-3674 SLC2A6 solute carrier family 2 member 6 HGNC:11011 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab