miRNA Card

miRNA General Information
miRNA ID hsa-miR-3686
Description Homo sapiens miR-3686 stem-loop
Comment None
Experiment Illumina [1]
Sequence AUCUGUAAGAGAAAGUAAAUGA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr22:49923234|49924455 hsa-miR-3686 0 1 0
chr17:16031885|16032030 hsa-miR-3686 0 1 0
chr10:30016216|30016360 hsa-miR-3686 0 1 0
chr1:156700611|156700958 hsa-miR-3686 0 1 0
chr12:124011400|124011616 hsa-miR-3686 0 1 0
chr7:22946952|22947045 hsa-miR-3686 0 1 0
chr13:98002491|98002773 hsa-miR-3686 0 1 0
chr4:7055968|7056178 hsa-miR-3686 0 1 0
chr17:48927942|48928068 hsa-miR-3686 0 1 0
chr1:224374164|224374248 hsa-miR-3686 0 1 0
chr11:12263449|12263566 hsa-miR-3686 1 0 0
chr20:23370154|23370277 hsa-miR-3686 0 1 0
chr16:8795491|8795625 hsa-miR-3686 0 1 0
chr22:30939692|30940788 hsa-miR-3686 0 1 0
chr20:58910039|58910710 hsa-miR-3686 0 1 0
chr17:32480571|32480804 hsa-miR-3686 0 1 0
chr10:102365430|102365551 hsa-miR-3686 0 1 0
chr1:231000172|231000443 hsa-miR-3686 0 1 0
chr2:33585530|33585673 hsa-miR-3686 0 1 0
chr17:46941012|46941203 hsa-miR-3686 0 1 0
chr1:85582573|85582797 hsa-miR-3686 0 1 0
chr6:34288619|34288776 hsa-miR-3686 0 1 0
chr11:12263378|12263606 hsa-miR-3686 0 1 0
chr1:43426776~43427167 hsa-miR-3686 0 1 0
chr22:49923234~49924455 hsa-miR-3686 0 1 0
chr11:12263449~12263566 hsa-miR-3686 0 1 0
chr5:179085957~179086091 hsa-miR-3686 0 1 0
chr1:202133578~202133656 hsa-miR-3686 0 1 0
chr5:34837792~34837971 hsa-miR-3686 0 1 0
chr18:31468644~31468808 hsa-miR-3686 0 1 0
chr13:114266985|114267137 hsa-miR-3686 0 1 0
chr1:224124246|224124349 hsa-miR-3686 0 1 0
chr20:50556032|50556138 hsa-miR-3686 0 1 0
chr5:14505351|14505456 hsa-miR-3686 0 1 0
chr2:187542146|187542278 hsa-miR-3686 1 0 0
chr11:34086085|34086400 hsa-miR-3686 0 1 0
chr9:122280443|122291840 hsa-miR-3686 1 0 0
chr11:12263449|12263608 hsa-miR-3686 0 1 0
chr22:31433098|31433321 hsa-miR-3686 0 1 0
chr11:124636911|124637037 hsa-miR-3686 0 1 0
chr15:60347409|60347573 hsa-miR-3686 0 1 0
chr4:140621163|140621397 hsa-miR-3686 0 1 0
chr19:38730130|38730337 hsa-miR-3686 0 1 0
chr17:48927940|48928062 hsa-miR-3686 0 1 0
chr6:34288621|34288763 hsa-miR-3686 0 1 0
chr19:38730114|38730337 hsa-miR-3686 0 1 0
chr7:95374857|95375013 hsa-miR-3686 0 1 0
chr17:48927942|48928062 hsa-miR-3686 0 1 0
chr15:52548614|52548750 hsa-miR-3686 0 1 0
chr19:38710381|38710513 hsa-miR-3686 0 1 0
chr15:25405461|25411971 hsa-miR-3686 0 1 0
chr10:89418990|89419105 hsa-miR-3686 0 1 0
chr18:68897219|68897682 hsa-miR-3686 0 1 0
chr2:30349937|30350146 hsa-miR-3686 0 1 0
chrX:77826592|77826769 hsa-miR-3686 0 1 0
chr17:7225678|7225820 hsa-miR-3686 0 1 0
chr19:38730155|38730329 hsa-miR-3686 0 1 0
chr17:42024835|42025114 hsa-miR-3686 0 1 0
chr7:139083780|139083938 hsa-miR-3686 0 1 0
chr2:207755199|207755309 hsa-miR-3686 0 1 0
chr20:36855181|36855347 hsa-miR-3686 0 1 0
chr10:102365418|102365551 hsa-miR-3686 0 1 0
chr17:48927882|48928056 hsa-miR-3686 0 1 0
chr1:46594119|46594239 hsa-miR-3686 0 1 0
chr7:99361758|99361893 hsa-miR-3686 0 1 0
chr2:262852|262983 hsa-miR-3686 0 1 0
chr17:35264196|35264352 hsa-miR-3686 0 1 0
chr3:108377479|108377589 hsa-miR-3686 0 1 0
chr3:108377479|108377587 hsa-miR-3686 0 1 0
chr1:231000185|231000443 hsa-miR-3686 0 1 0
chr21:34793990|34794267 hsa-miR-3686 -8 1 0
chr15:60347381|60347559 hsa-miR-3686 -9 1 0
chr17:48927827|48928068 hsa-miR-3686 -11 1 0
chr11:12263449|12263617 hsa-miR-3686 0 1 0
chr10:122643595|122643694 hsa-miR-3686 0 1 0
chr14:24819174|24819288 hsa-miR-3686 0 1 0
chr15:52548614|52548747 hsa-miR-3686 0 1 0
chr19:38730121|38730337 hsa-miR-3686 0 1 0
chr19:36238071|36238230 hsa-miR-3686 0 1 0
chr19:38730149|38730337 hsa-miR-3686 0 1 0
chr7:39387351|39387491 hsa-miR-3686 0 1 0
chr19:38730121|38730329 hsa-miR-3686 0 1 0
chr17:48927942|48928221 hsa-miR-3686 0 1 0
chr13:27668350|27668566 hsa-miR-3686 0 1 0
chr19:38730114|38730329 hsa-miR-3686 0 1 0
chr19:38730130|38730329 hsa-miR-3686 0 1 0
chr7:88206410|88209385 hsa-miR-3686 0 1 0
chr11:12263499|12263695 hsa-miR-3686 0 1 0
chr1:231000229|231000443 hsa-miR-3686 0 1 0
chr3:108377294|108377587 hsa-miR-3686 0 1 0
chr13:85794428|85794765 hsa-miR-3686 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-3686 BACE2 beta-secretase 2 HGNC:934 details
hsa-miR-3686 RNF20 ring finger protein 20 HGNC:10062 details
hsa-miR-3686 ZNF418 zinc finger protein 418 HGNC:20647 details
hsa-miR-3686 NPTX2 neuronal pentraxin 2 HGNC:7953 details
hsa-miR-3686 MSH3 mutS homolog 3 HGNC:7326 details
hsa-miR-3686 P2RY10 P2Y receptor family member 10 HGNC:19906 details
hsa-miR-3686 MIER1 MIER1 transcriptional regulator HGNC:29657 details
hsa-miR-3686 SOCS5 suppressor of cytokine signaling 5 HGNC:16852 details
hsa-miR-3686 RAC1 Rac family small GTPase 1 HGNC:9801 details
hsa-miR-3686 MIDN midnolin HGNC:16298 details
hsa-miR-3686 ETF1 eukaryotic translation termination factor 1 HGNC:3477 details
hsa-miR-3686 BTF3L4 basic transcription factor 3 like 4 HGNC:30547 details
hsa-miR-3686 DUSP2 dual specificity phosphatase 2 HGNC:3068 details
hsa-miR-3686 GIGYF1 GRB10 interacting GYF protein 1 HGNC:9126 details
hsa-miR-3686 DNAJB6 DnaJ heat shock protein family (Hsp40) member B6 HGNC:14888 details
hsa-miR-3686 FOXK2 forkhead box K2 HGNC:6036 details
hsa-miR-3686 CREBRF CREB3 regulatory factor HGNC:24050 details
hsa-miR-3686 SRP9 signal recognition particle 9 HGNC:11304 details
hsa-miR-3686 NIPA1 NIPA magnesium transporter 1 HGNC:17043 details
hsa-miR-3686 KLHL36 kelch like family member 36 HGNC:17844 details
hsa-miR-3686 USP42 ubiquitin specific peptidase 42 HGNC:20068 details
hsa-miR-3686 GRAMD1B GRAM domain containing 1B HGNC:29214 details
hsa-miR-3686 AKAP11 A-kinase anchoring protein 11 HGNC:369 details
hsa-miR-3686 GYPA glycophorin A (MNS blood group) HGNC:4702 details
hsa-miR-3686 PLBD2 phospholipase B domain containing 2 HGNC:27283 details
hsa-miR-3686 TRIM71 tripartite motif containing 71 HGNC:32669 details
hsa-miR-3686 RPL28 ribosomal protein L28 HGNC:10330 details
hsa-miR-3686 QSER1 glutamine and serine rich 1 HGNC:26154 details
hsa-miR-3686 IRF2 interferon regulatory factor 2 HGNC:6117 details
hsa-miR-3686 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 HGNC:4125 details
hsa-miR-3686 DPP8 dipeptidyl peptidase 8 HGNC:16490 details
hsa-miR-3686 details
hsa-miR-3686 RBBP7 RB binding protein 7, chromatin remodeling factor HGNC:9890 details
hsa-miR-3686 PBRM1 polybromo 1 HGNC:30064 details
hsa-miR-3686 TMEM101 transmembrane protein 101 HGNC:28653 details
hsa-miR-3686 REL REL proto-oncogene, NF-kB subunit HGNC:9954 details
hsa-miR-3686 FAM217B family with sequence similarity 217 member B HGNC:16170 details
hsa-miR-3686 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 HGNC:3297 details
hsa-miR-3686 DDIT4 DNA damage inducible transcript 4 HGNC:24944 details
hsa-miR-3686 FGF2 fibroblast growth factor 2 HGNC:3676 details
hsa-miR-3686 AK4 adenylate kinase 4 HGNC:363 details
hsa-miR-3686 HGFAC HGF activator HGNC:4894 details
hsa-miR-3686 ZBTB46 zinc finger and BTB domain containing 46 HGNC:16094 details
hsa-miR-3686 N4BP1 NEDD4 binding protein 1 HGNC:29850 details
hsa-miR-3686 CLN8 CLN8 transmembrane ER and ERGIC protein HGNC:2079 details
hsa-miR-3686 ZNF383 zinc finger protein 383 HGNC:18609 details
hsa-miR-3686 details
hsa-miR-3686 TET1 tet methylcytosine dioxygenase 1 HGNC:29484 details
hsa-miR-3686 FOXN3 forkhead box N3 HGNC:1928 details
hsa-miR-3686 CLIC5 chloride intracellular channel 5 HGNC:13517 details
hsa-miR-3686 GRIK4 glutamate ionotropic receptor kainate type subunit 4 HGNC:4582 details
hsa-miR-3686 TNNC1 troponin C1, slow skeletal and cardiac type HGNC:11943 details
hsa-miR-3686 PAK6 p21 (RAC1) activated kinase 6 HGNC:16061 details
hsa-miR-3686 CYP20A1 cytochrome P450 family 20 subfamily A member 1 HGNC:20576 details
hsa-miR-3686 PDCL3 phosducin like 3 HGNC:28860 details
hsa-miR-3686 EDARADD EDAR associated death domain HGNC:14341 details
hsa-miR-3686 ST6GALNAC1 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 1 HGNC:23614 details
hsa-miR-3686 RASL11B RAS like family 11 member B HGNC:23804 details
hsa-miR-3686 PRR13 proline rich 13 HGNC:24528 details
hsa-miR-3686 EIF2B2 eukaryotic translation initiation factor 2B subunit beta HGNC:3258 details
hsa-miR-3686 BCL10 BCL10 immune signaling adaptor HGNC:989 details
hsa-miR-3686 AEBP2 AE binding protein 2 HGNC:24051 details
hsa-miR-3686 HMGN1 high mobility group nucleosome binding domain 1 HGNC:4984 details
hsa-miR-3686 LYRM7 LYR motif containing 7 HGNC:28072 details
hsa-miR-3686 TM4SF1 transmembrane 4 L six family member 1 HGNC:11853 details
hsa-miR-3686 TFDP2 transcription factor Dp-2 HGNC:11751 details
hsa-miR-3686 CHD9 chromodomain helicase DNA binding protein 9 HGNC:25701 details
hsa-miR-3686 CCDC71L coiled-coil domain containing 71 like HGNC:26685 details
hsa-miR-3686 XRCC2 X-ray repair cross complementing 2 HGNC:12829 details
hsa-miR-3686 PODXL podocalyxin like HGNC:9171 details
hsa-miR-3686 NIPAL2 NIPA like domain containing 2 HGNC:25854 details
hsa-miR-3686 MOGAT1 monoacylglycerol O-acyltransferase 1 HGNC:18210 details
hsa-miR-3686 ZNF449 zinc finger protein 449 HGNC:21039 details
hsa-miR-3686 CALML4 calmodulin like 4 HGNC:18445 details
hsa-miR-3686 SELE selectin E HGNC:10718 details
hsa-miR-3686 VKORC1L1 vitamin K epoxide reductase complex subunit 1 like 1 HGNC:21492 details
hsa-miR-3686 SMIM14 small integral membrane protein 14 HGNC:27321 details
hsa-miR-3686 MSX2 msh homeobox 2 HGNC:7392 details
hsa-miR-3686 PLK1 polo like kinase 1 HGNC:9077 details
hsa-miR-3686 KCTD5 potassium channel tetramerization domain containing 5 HGNC:21423 details
hsa-miR-3686 TNRC18 trinucleotide repeat containing 18 HGNC:11962 details
hsa-miR-3686 ZFP36L1 ZFP36 ring finger protein like 1 HGNC:1107 details
hsa-miR-3686 EPC1 enhancer of polycomb homolog 1 HGNC:19876 details
hsa-miR-3686 TNC tenascin C HGNC:5318 details
hsa-miR-3686 TRIM38 tripartite motif containing 38 HGNC:10059 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab