miRNA Card

miRNA General Information
miRNA ID hsa-miR-374c-5p
Description Homo sapiens miR-374c stem-loop
Comment None
Experiment Illumina [1]
Sequence AUAAUACAACCUGCUAAGUGCU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-374c-5p ESD esterase D HGNC:3465 details
hsa-miR-374c-5p ATAD2 ATPase family AAA domain containing 2 HGNC:30123 details
hsa-miR-374c-5p WEE1 WEE1 G2 checkpoint kinase HGNC:12761 details
hsa-miR-374c-5p TRPS1 transcriptional repressor GATA binding 1 HGNC:12340 details
hsa-miR-374c-5p TMEM64 transmembrane protein 64 HGNC:25441 details
hsa-miR-374c-5p SKI SKI proto-oncogene HGNC:10896 details
hsa-miR-374c-5p RREB1 ras responsive element binding protein 1 HGNC:10449 details
hsa-miR-374c-5p PTP4A1 protein tyrosine phosphatase 4A1 HGNC:9634 details
hsa-miR-374c-5p MID1 midline 1 HGNC:7095 details
hsa-miR-374c-5p DERL2 derlin 2 HGNC:17943 details
hsa-miR-374c-5p DENND5B DENN domain containing 5B HGNC:28338 details
hsa-miR-374c-5p CNBP CCHC-type zinc finger nucleic acid binding protein HGNC:13164 details
hsa-miR-374c-5p CAPRIN2 caprin family member 2 HGNC:21259 details
hsa-miR-374c-5p CALM2 calmodulin 2 HGNC:1445 details
hsa-miR-374c-5p PDK3 pyruvate dehydrogenase kinase 3 HGNC:8811 details
hsa-miR-374c-5p details
hsa-miR-374c-5p SLC35F5 solute carrier family 35 member F5 HGNC:23617 details
hsa-miR-374c-5p ANKRD33B ankyrin repeat domain 33B HGNC:35240 details
hsa-miR-374c-5p EXOC7 exocyst complex component 7 HGNC:23214 details
hsa-miR-374c-5p CYP1A1 cytochrome P450 family 1 subfamily A member 1 HGNC:2595 details
hsa-miR-374c-5p GPR26 G protein-coupled receptor 26 HGNC:4481 details
hsa-miR-374c-5p TRIM67 tripartite motif containing 67 HGNC:31859 details
hsa-miR-374c-5p CANX calnexin HGNC:1473 details
hsa-miR-374c-5p CASP2 caspase 2 HGNC:1503 details
hsa-miR-374c-5p JUN Jun proto-oncogene, AP-1 transcription factor subunit HGNC:6204 details
hsa-miR-374c-5p FZD6 frizzled class receptor 6 HGNC:4044 details
hsa-miR-374c-5p E2F7 E2F transcription factor 7 HGNC:23820 details
hsa-miR-374c-5p PEX13 peroxisomal biogenesis factor 13 HGNC:8855 details
hsa-miR-374c-5p ZNF850 zinc finger protein 850 HGNC:27994 details
hsa-miR-374c-5p GPATCH8 G-patch domain containing 8 HGNC:29066 details
hsa-miR-374c-5p ABHD18 abhydrolase domain containing 18 HGNC:26111 details
hsa-miR-374c-5p CLEC4E C-type lectin domain family 4 member E HGNC:14555 details
hsa-miR-374c-5p KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 HGNC:6285 details
hsa-miR-374c-5p TRIM2 tripartite motif containing 2 HGNC:15974 details
hsa-miR-374c-5p SCAF4 SR-related CTD associated factor 4 HGNC:19304 details
hsa-miR-374c-5p KPNA6 karyopherin subunit alpha 6 HGNC:6399 details
hsa-miR-374c-5p DDIT4 DNA damage inducible transcript 4 HGNC:24944 details
hsa-miR-374c-5p ZNF695 zinc finger protein 695 HGNC:30954 details
hsa-miR-374c-5p MTPN myotrophin HGNC:15667 details
hsa-miR-374c-5p TRIM56 tripartite motif containing 56 HGNC:19028 details
hsa-miR-374c-5p TMTC1 transmembrane O-mannosyltransferase targeting cadherins 1 HGNC:24099 details
hsa-miR-374c-5p TBC1D15 TBC1 domain family member 15 HGNC:25694 details
hsa-miR-374c-5p PDZD8 PDZ domain containing 8 HGNC:26974 details
hsa-miR-374c-5p NHLRC2 NHL repeat containing 2 HGNC:24731 details
hsa-miR-374c-5p MRPL58 mitochondrial ribosomal protein L58 HGNC:5359 details
hsa-miR-374c-5p TFAP2C transcription factor AP-2 gamma HGNC:11744 details
hsa-miR-374c-5p CAMSAP2 calmodulin regulated spectrin associated protein family member 2 HGNC:29188 details
hsa-miR-374c-5p DSN1 DSN1 component of MIS12 kinetochore complex HGNC:16165 details
hsa-miR-374c-5p GNL3 G protein nucleolar 3 HGNC:29931 details
hsa-miR-374c-5p ZNF681 zinc finger protein 681 HGNC:26457 details
hsa-miR-374c-5p MYZAP myocardial zonula adherens protein HGNC:43444 details
hsa-miR-374c-5p DDX52 DExD-box helicase 52 HGNC:20038 details
hsa-miR-374c-5p ZNF107 zinc finger protein 107 HGNC:12887 details
hsa-miR-374c-5p SPIRE1 spire type actin nucleation factor 1 HGNC:30622 details
hsa-miR-374c-5p SGO1 shugoshin 1 HGNC:25088 details
hsa-miR-374c-5p SATB1 SATB homeobox 1 HGNC:10541 details
hsa-miR-374c-5p RAC1 Rac family small GTPase 1 HGNC:9801 details
hsa-miR-374c-5p MAP3K21 mitogen-activated protein kinase kinase kinase 21 HGNC:29798 details
hsa-miR-374c-5p IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 HGNC:28868 details
hsa-miR-374c-5p MIGA1 mitoguardin 1 HGNC:24741 details
hsa-miR-374c-5p RPS17 ribosomal protein S17 HGNC:10397 details
hsa-miR-374c-5p YOD1 YOD1 deubiquitinase HGNC:25035 details
hsa-miR-374c-5p YTHDF1 YTH N6-methyladenosine RNA binding protein 1 HGNC:15867 details
hsa-miR-374c-5p SESN3 sestrin 3 HGNC:23060 details
hsa-miR-374c-5p ADM adrenomedullin HGNC:259 details
hsa-miR-374c-5p ARPC3 actin related protein 2/3 complex subunit 3 HGNC:706 details
hsa-miR-374c-5p details
hsa-miR-374c-5p PSD3 pleckstrin and Sec7 domain containing 3 HGNC:19093 details
hsa-miR-374c-5p PSEN1 presenilin 1 HGNC:9508 details
hsa-miR-374c-5p ABT1 activator of basal transcription 1 HGNC:17369 details
hsa-miR-374c-5p SLC23A3 solute carrier family 23 member 3 HGNC:20601 details
hsa-miR-374c-5p PRSS23 serine protease 23 HGNC:14370 details
hsa-miR-374c-5p PPP4R2 protein phosphatase 4 regulatory subunit 2 HGNC:18296 details
hsa-miR-374c-5p ZNF610 zinc finger protein 610 HGNC:26687 details
hsa-miR-374c-5p ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 HGNC:689 details
hsa-miR-374c-5p ARHGAP6 Rho GTPase activating protein 6 HGNC:676 details
hsa-miR-374c-5p ZDHHC20 zinc finger DHHC-type palmitoyltransferase 20 HGNC:20749 details
hsa-miR-374c-5p ELK4 ETS transcription factor ELK4 HGNC:3326 details
hsa-miR-374c-5p AIFM2 apoptosis inducing factor mitochondria associated 2 HGNC:21411 details
hsa-miR-374c-5p KIF5B kinesin family member 5B HGNC:6324 details
hsa-miR-374c-5p HIPK3 homeodomain interacting protein kinase 3 HGNC:4915 details
hsa-miR-374c-5p GPR50 G protein-coupled receptor 50 HGNC:4506 details
hsa-miR-374c-5p CREBRF CREB3 regulatory factor HGNC:24050 details
hsa-miR-374c-5p PHACTR2 phosphatase and actin regulator 2 HGNC:20956 details
hsa-miR-374c-5p VTA1 vesicle trafficking 1 HGNC:20954 details
hsa-miR-374c-5p UTP15 UTP15 small subunit processome component HGNC:25758 details
hsa-miR-374c-5p C17orf75 chromosome 17 open reading frame 75 HGNC:30173 details
hsa-miR-374c-5p TIMM8A translocase of inner mitochondrial membrane 8A HGNC:11817 details
hsa-miR-374c-5p MAVS mitochondrial antiviral signaling protein HGNC:29233 details
hsa-miR-374c-5p BCL2L11 BCL2 like 11 HGNC:994 details
hsa-miR-374c-5p DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 HGNC:6968 details
hsa-miR-374c-5p C21orf91 chromosome 21 open reading frame 91 HGNC:16459 details
hsa-miR-374c-5p ETFDH electron transfer flavoprotein dehydrogenase HGNC:3483 details
hsa-miR-374c-5p NRP2 neuropilin 2 HGNC:8005 details
hsa-miR-374c-5p BTBD9 BTB domain containing 9 HGNC:21228 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab