miRNA Card

miRNA General Information
miRNA ID hsa-miR-376a-3p
Description Homo sapiens miR-376a-1 stem-loop
Comment The mature miR-376a products have been shown to be modified by A to I edits [3].
Experiment cloned [1,4]
Sequence AUCAUAGAGGAAAAUCCACGU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr6:29630171|29630303 hsa-miR-376a-3p 1 0 0
chr17:67032823|67032957 hsa-miR-376a-3p 0 1 0
chr12:14914378|14914432 hsa-miR-376a-3p 0 1 0
chr13:51452454|51452575 hsa-miR-376a-3p 0 1 0
chr13:72755735|72755880 hsa-miR-376a-3p 0 1 0
chr18:26017603|26017792 hsa-miR-376a-3p 0 1 0
chr5:149632893|149633014 hsa-miR-376a-3p 0 1 0
chr17:59110098|59110284 hsa-miR-376a-3p 0 1 0
chrX:47226611|47226865 hsa-miR-376a-3p 0 1 0
chr3:50326068|50326407 hsa-miR-376a-3p 1 0 0
chrX:149360726|149360894 hsa-miR-376a-3p 0 1 0
chr20:50749703|50749844 hsa-miR-376a-3p 0 1 0
chr17:82082074|82082382 hsa-miR-376a-3p 0 1 0
chr3:120415923|120416013 hsa-miR-376a-3p 0 1 0
chr6:30723540|30723743 hsa-miR-376a-3p 0 1 0
chr6:30723659|30723743 hsa-miR-376a-3p 0 1 0
chr1:86742261|86742410 hsa-miR-376a-3p 0 1 0
chr3:49098201|49098445 hsa-miR-376a-3p 0 1 0
chr9:35707451|35707769 hsa-miR-376a-3p 0 1 0
chr4:77048287|77048385 hsa-miR-376a-3p 0 1 0
chr1:159035556|159035779 hsa-miR-376a-3p 0 1 0
chr14:39179091~39179462 hsa-miR-376a-3p 0 1 0
chr9:4864171~4864314 hsa-miR-376a-3p 0 1 0
chr9:35707404~35707769 hsa-miR-376a-3p 0 1 0
chrX:129994389~130005222 hsa-miR-376a-3p 0 1 0
chr17:82082074~82082154 hsa-miR-376a-3p 0 1 0
chr20:45367879~45368069 hsa-miR-376a-3p 0 1 0
chr18:26017603~26017792 hsa-miR-376a-3p 0 1 0
chr6:30723672~30723743 hsa-miR-376a-3p 0 1 0
chr3:50326068~50326407 hsa-miR-376a-3p 0 1 0
chr3:49098201~49098445 hsa-miR-376a-3p 0 1 0
chr22:41996351~41996550 hsa-miR-376a-3p 0 1 0
chr3:15439576~15439706 hsa-miR-376a-3p 0 1 0
chr1:47428080~47428256 hsa-miR-376a-3p 0 1 0
chr5:173318747~173318915 hsa-miR-376a-3p 0 1 0
chr6:30723560|30723724 hsa-miR-376a-3p 0 1 0
chr5:81245298|81245453 hsa-miR-376a-3p 0 1 0
chr22:19428347|19428482 hsa-miR-376a-3p 0 1 0
chr7:137875207|137875352 hsa-miR-376a-3p 0 1 0
chr15:84798803|84799154 hsa-miR-376a-3p 0 1 0
chr11:72693406|72693740 hsa-miR-376a-3p 0 1 0
chr6:7161209|7161369 hsa-miR-376a-3p 0 1 0
chr3:47412155|47412409 hsa-miR-376a-3p 0 1 0
chr10:102106911|102107134 hsa-miR-376a-3p 0 1 0
chr18:10779756|10780006 hsa-miR-376a-3p 0 1 0
chr14:102050172|102050559 hsa-miR-376a-3p 0 1 0
chr1:220780018|220780239 hsa-miR-376a-3p 0 1 0
chr1:155883609|155883757 hsa-miR-376a-3p 0 1 0
chr5:151021109|151021257 hsa-miR-376a-3p 0 1 0
chr10:102106964|102107129 hsa-miR-376a-3p 0 1 0
chr10:94331129|94331311 hsa-miR-376a-3p 0 1 0
chr16:31036914|31037023 hsa-miR-376a-3p 0 1 0
chr9:32498077|32498206 hsa-miR-376a-3p 0 1 0
chr5:37410592|37410777 hsa-miR-376a-3p 0 1 0
chr1:45607701|45607793 hsa-miR-376a-3p 0 1 0
chr1:180894229|180894375 hsa-miR-376a-3p 0 1 0
chr1:45607684|45607865 hsa-miR-376a-3p 0 1 0
chr14:24305885|24306062 hsa-miR-376a-3p 0 1 0
chr6:30723620|30723743 hsa-miR-376a-3p 0 1 0
chr5:137942875|137943216 hsa-miR-376a-3p 0 1 0
chr6:3076764|3077935 hsa-miR-376a-3p 0 1 0
chr6:20197377|20197540 hsa-miR-376a-3p 0 1 0
chr10:49857306|49861622 hsa-miR-376a-3p 0 1 0
chr20:35557002|35557209 hsa-miR-376a-3p 0 1 0
chr16:64011|64158 hsa-miR-376a-3p 0 1 0
chr7:137875259|137875473 hsa-miR-376a-3p 0 1 0
chr17:17703554|17703691 hsa-miR-376a-3p 0 1 0
chr1:45607684|45607793 hsa-miR-376a-3p 0 1 0
chr4:37611491|37611625 hsa-miR-376a-3p 0 1 0
chr6:30723596|30723743 hsa-miR-376a-3p 0 1 0
chr16:25269126|25269302 hsa-miR-376a-3p 0 1 0
chr2:232340924|232341115 hsa-miR-376a-3p 0 1 0
chr6:30723672|30723864 hsa-miR-376a-3p 0 1 0
chr14:39179091|39179462 hsa-miR-376a-3p 0 1 0
chr8:11847777|11848110 hsa-miR-376a-3p -6 1 0
chr1:45607669|45607839 hsa-miR-376a-3p -13 1 0
chr12:120198554|120198634 hsa-miR-376a-3p -7 1 0
chr3:39142348|39142462 hsa-miR-376a-3p -12 1 0
chr3:65364242|65364436 hsa-miR-376a-3p -6 1 0
chr6:30723672|30723868 hsa-miR-376a-3p -7 1 0
chr3:49098306|49098445 hsa-miR-376a-3p 0 1 0
chr3:53192351|53192452 hsa-miR-376a-3p 0 1 0
chr1:247316670|247316745 hsa-miR-376a-3p 0 1 0
chr2:112583506|112583594 hsa-miR-376a-3p 0 1 0
chr1:45607692|45607862 hsa-miR-376a-3p 0 1 0
chr20:18472893|18473458 hsa-miR-376a-3p 0 1 0
chr7:6163348|6163500 hsa-miR-376a-3p 0 1 0
chr12:120198554|120198631 hsa-miR-376a-3p 0 1 0
chr12:124008514|124008660 hsa-miR-376a-3p 0 1 0
chr19:41720123|41720980 hsa-miR-376a-3p 0 1 0
chr11:65661718|65661961 hsa-miR-376a-3p 0 1 0
chr12:56714362|56714639 hsa-miR-376a-3p 1 0 0
chr3:50326068|50326153 hsa-miR-376a-3p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-376a-3p ACVR1C activin A receptor type 1C HGNC:18123 details
hsa-miR-376a-3p PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 HGNC:8979 details
hsa-miR-376a-3p IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-376a-3p CDK2 cyclin dependent kinase 2 HGNC:1771 details
hsa-miR-376a-3p AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-376a-3p SLC16A1 solute carrier family 16 member 1 HGNC:10922 details
hsa-miR-376a-3p TTK TTK protein kinase HGNC:12401 details
hsa-miR-376a-3p SRSF11 serine and arginine rich splicing factor 11 HGNC:10782 details
hsa-miR-376a-3p TNKS2 tankyrase 2 HGNC:15677 details
hsa-miR-376a-3p SORT1 sortilin 1 HGNC:11186 details
hsa-miR-376a-3p SMAD7 SMAD family member 7 HGNC:6773 details
hsa-miR-376a-3p RNF216 ring finger protein 216 HGNC:21698 details
hsa-miR-376a-3p RANBP6 RAN binding protein 6 HGNC:9851 details
hsa-miR-376a-3p RAB21 RAB21, member RAS oncogene family HGNC:18263 details
hsa-miR-376a-3p RAB15 RAB15, member RAS oncogene family HGNC:20150 details
hsa-miR-376a-3p PRKCH protein kinase C eta HGNC:9403 details
hsa-miR-376a-3p PPP3R1 protein phosphatase 3 regulatory subunit B, alpha HGNC:9317 details
hsa-miR-376a-3p PIKFYVE phosphoinositide kinase, FYVE-type zinc finger containing HGNC:23785 details
hsa-miR-376a-3p PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 HGNC:8873 details
hsa-miR-376a-3p details
hsa-miR-376a-3p KIF5C kinesin family member 5C HGNC:6325 details
hsa-miR-376a-3p IQGAP1 IQ motif containing GTPase activating protein 1 HGNC:6110 details
hsa-miR-376a-3p INA internexin neuronal intermediate filament protein alpha HGNC:6057 details
hsa-miR-376a-3p IAPP islet amyloid polypeptide HGNC:5329 details
hsa-miR-376a-3p FOXO1 forkhead box O1 HGNC:3819 details
hsa-miR-376a-3p ERO1B endoplasmic reticulum oxidoreductase 1 beta HGNC:14355 details
hsa-miR-376a-3p C2CD4A C2 calcium dependent domain containing 4A HGNC:33627 details
hsa-miR-376a-3p details
hsa-miR-376a-3p ZNRF3 zinc and ring finger 3 HGNC:18126 details
hsa-miR-376a-3p IL7 interleukin 7 HGNC:6023 details
hsa-miR-376a-3p RPP14 ribonuclease P/MRP subunit p14 HGNC:30327 details
hsa-miR-376a-3p SAMD8 sterile alpha motif domain containing 8 HGNC:26320 details
hsa-miR-376a-3p ZNF426 zinc finger protein 426 HGNC:20725 details
hsa-miR-376a-3p ZNF281 zinc finger protein 281 HGNC:13075 details
hsa-miR-376a-3p SERINC3 serine incorporator 3 HGNC:11699 details
hsa-miR-376a-3p AMOTL2 angiomotin like 2 HGNC:17812 details
hsa-miR-376a-3p ITGB8 integrin subunit beta 8 HGNC:6163 details
hsa-miR-376a-3p COPA COPI coat complex subunit alpha HGNC:2230 details
hsa-miR-376a-3p ZNF169 zinc finger protein 169 HGNC:12957 details
hsa-miR-376a-3p ZNF736 zinc finger protein 736 HGNC:32467 details
hsa-miR-376a-3p MYRF myelin regulatory factor HGNC:1181 details
hsa-miR-376a-3p ZNF669 zinc finger protein 669 HGNC:25736 details
hsa-miR-376a-3p ZNF667 zinc finger protein 667 HGNC:28854 details
hsa-miR-376a-3p PARD6B par-6 family cell polarity regulator beta HGNC:16245 details
hsa-miR-376a-3p DCTN5 dynactin subunit 5 HGNC:24594 details
hsa-miR-376a-3p ZNF180 zinc finger protein 180 HGNC:12970 details
hsa-miR-376a-3p ZNF440 zinc finger protein 440 HGNC:20874 details
hsa-miR-376a-3p MRPL51 mitochondrial ribosomal protein L51 HGNC:14044 details
hsa-miR-376a-3p TMEM245 transmembrane protein 245 HGNC:1363 details
hsa-miR-376a-3p SNRPB small nuclear ribonucleoprotein polypeptides B and B1 HGNC:11153 details
hsa-miR-376a-3p ZFHX3 zinc finger homeobox 3 HGNC:777 details
hsa-miR-376a-3p UBE2A ubiquitin conjugating enzyme E2 A HGNC:12472 details
hsa-miR-376a-3p SRRT serrate, RNA effector molecule HGNC:24101 details
hsa-miR-376a-3p WDR17 WD repeat domain 17 HGNC:16661 details
hsa-miR-376a-3p ZFP69B ZFP69 zinc finger protein B HGNC:28053 details
hsa-miR-376a-3p YAF2 YY1 associated factor 2 HGNC:17363 details
hsa-miR-376a-3p SHC3 SHC adaptor protein 3 HGNC:18181 details
hsa-miR-376a-3p ZNF699 zinc finger protein 699 HGNC:24750 details
hsa-miR-376a-3p MAD2L1 mitotic arrest deficient 2 like 1 HGNC:6763 details
hsa-miR-376a-3p FGF2 fibroblast growth factor 2 HGNC:3676 details
hsa-miR-376a-3p CYP27C1 cytochrome P450 family 27 subfamily C member 1 HGNC:33480 details
hsa-miR-376a-3p GNAT1 G protein subunit alpha transducin 1 HGNC:4393 details
hsa-miR-376a-3p WIPI2 WD repeat domain, phosphoinositide interacting 2 HGNC:32225 details
hsa-miR-376a-3p ZNF844 zinc finger protein 844 HGNC:25932 details
hsa-miR-376a-3p ZNF780B zinc finger protein 780B HGNC:33109 details
hsa-miR-376a-3p ZNF266 zinc finger protein 266 HGNC:13059 details
hsa-miR-376a-3p ZNF439 zinc finger protein 439 HGNC:20873 details
hsa-miR-376a-3p ZNF781 zinc finger protein 781 HGNC:26745 details
hsa-miR-376a-3p HCFC2 host cell factor C2 HGNC:24972 details
hsa-miR-376a-3p SLC35G2 solute carrier family 35 member G2 HGNC:28480 details
hsa-miR-376a-3p ZNF487 zinc finger protein 487 HGNC:23488 details
hsa-miR-376a-3p UBE2D2 ubiquitin conjugating enzyme E2 D2 HGNC:12475 details
hsa-miR-376a-3p FOXG1 forkhead box G1 HGNC:3811 details
hsa-miR-376a-3p E2F3 E2F transcription factor 3 HGNC:3115 details
hsa-miR-376a-3p CD2AP CD2 associated protein HGNC:14258 details
hsa-miR-376a-3p BTF3L4 basic transcription factor 3 like 4 HGNC:30547 details
hsa-miR-376a-3p BEND4 BEN domain containing 4 HGNC:23815 details
hsa-miR-376a-3p ZNF567 zinc finger protein 567 HGNC:28696 details
hsa-miR-376a-3p ZNF791 zinc finger protein 791 HGNC:26895 details
hsa-miR-376a-3p LRRC58 leucine rich repeat containing 58 HGNC:26968 details
hsa-miR-376a-3p PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A HGNC:9275 details
hsa-miR-376a-3p FOXK1 forkhead box K1 HGNC:23480 details
hsa-miR-376a-3p HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 HGNC:5030 details
hsa-miR-376a-3p TGFBR3 transforming growth factor beta receptor 3 HGNC:11774 details
hsa-miR-376a-3p C4orf19 chromosome 4 open reading frame 19 HGNC:25618 details
hsa-miR-376a-3p PIGM phosphatidylinositol glycan anchor biosynthesis class M HGNC:18858 details
hsa-miR-376a-3p B3GALT5 beta-1,3-galactosyltransferase 5 HGNC:920 details
hsa-miR-376a-3p KCND3 potassium voltage-gated channel subfamily D member 3 HGNC:6239 details
hsa-miR-376a-3p CXCR6 C-X-C motif chemokine receptor 6 HGNC:16647 details
hsa-miR-376a-3p CNTROB centrobin, centriole duplication and spindle assembly protein HGNC:29616 details
hsa-miR-376a-3p STON2 stonin 2 HGNC:30652 details
hsa-miR-376a-3p RIMS2 regulating synaptic membrane exocytosis 2 HGNC:17283 details
hsa-miR-376a-3p MYSM1 Myb like, SWIRM and MPN domains 1 HGNC:29401 details
hsa-miR-376a-3p CASTOR2 cytosolic arginine sensor for mTORC1 subunit 2 HGNC:37073 details
hsa-miR-376a-3p DCAF17 DDB1 and CUL4 associated factor 17 HGNC:25784 details
hsa-miR-376a-3p RS1 retinoschisin 1 HGNC:10457 details
hsa-miR-376a-3p ZNF253 zinc finger protein 253 HGNC:13497 details
hsa-miR-376a-3p ZNF594 zinc finger protein 594 HGNC:29392 details
hsa-miR-376a-3p C1orf216 chromosome 1 open reading frame 216 HGNC:26800 details
hsa-miR-376a-3p NDUFS3 NADH:ubiquinone oxidoreductase core subunit S3 HGNC:7710 details
hsa-miR-376a-3p PDS5A PDS5 cohesin associated factor A HGNC:29088 details
hsa-miR-376a-3p LEPROT leptin receptor overlapping transcript HGNC:29477 details
hsa-miR-376a-3p GNAS GNAS complex locus HGNC:4392 details
hsa-miR-376a-3p CD164 CD164 molecule HGNC:1632 details
hsa-miR-376a-3p ATG4C autophagy related 4C cysteine peptidase HGNC:16040 details
hsa-miR-376a-3p MEPE matrix extracellular phosphoglycoprotein HGNC:13361 details
hsa-miR-376a-3p KLF15 Kruppel like factor 15 HGNC:14536 details
hsa-miR-376a-3p CASP8 caspase 8 HGNC:1509 details
hsa-miR-376a-3p ATG2A autophagy related 2A HGNC:29028 details
hsa-miR-376a-3p NIP7 nucleolar pre-rRNA processing protein NIP7 HGNC:24328 details
hsa-miR-376a-3p POTEG POTE ankyrin domain family member G HGNC:33896 details
hsa-miR-376a-3p POTEM POTE ankyrin domain family member M HGNC:37096 details
hsa-miR-376a-3p KIAA1671 KIAA1671 HGNC:29345 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab