miRNA Card

miRNA General Information
miRNA ID hsa-miR-3910
Description Homo sapiens miR-3910-1 stem-loop
Comment None
Experiment Illumina [1]
Sequence AAAGGCAUAAAACCAAGACA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr9:2044026|2044147 hsa-miR-3910 0 1 0
chr1:116403886|116404434 hsa-miR-3910 0 1 0
chr9:134771472|134771672 hsa-miR-3910 0 1 0
chr15:88469251|88469439 hsa-miR-3910 0 1 0
chr4:676131|676209 hsa-miR-3910 0 1 0
chr1:116403886~116404434 hsa-miR-3910 0 1 0
chrX:79174448~79174573 hsa-miR-3910 0 1 0
chr22:37805890~37806030 hsa-miR-3910 0 1 0
chr4:174977699~174977927 hsa-miR-3910 0 1 0
chr9:137204463~137204587 hsa-miR-3910 0 1 0
chr22:37805893~37806045 hsa-miR-3910 0 1 0
chr8:94980728|94980973 hsa-miR-3910 0 1 0
chr6:77326728|77326879 hsa-miR-3910 0 1 0
chr19:56554966|56555090 hsa-miR-3910 0 1 0
chr2:215375341|215375686 hsa-miR-3910 0 1 0
chr2:87584742|87584869 hsa-miR-3910 0 1 0
chr22:45928874|45929018 hsa-miR-3910 0 1 0
chr15:85748665|85748822 hsa-miR-3910 0 1 0
chr22:37805890|37806030 hsa-miR-3910 0 1 0
chr5:132483469|132483699 hsa-miR-3910 0 1 0
chr22:37805838|37806030 hsa-miR-3910 0 1 0
chr22:37805893|37806100 hsa-miR-3910 0 1 0
chr17:4798009|4798365 hsa-miR-3910 0 1 0
chr1:116403890|116404584 hsa-miR-3910 0 1 0
chr1:156722748|156723120 hsa-miR-3910 0 1 0
chr9:123101612|123101763 hsa-miR-3910 0 1 0
chr5:150133651|150133971 hsa-miR-3910 0 1 0
chr1:116403886|116404437 hsa-miR-3910 0 1 0
chr4:676081|678688 hsa-miR-3910 0 1 0
chr19:47353073|47353254 hsa-miR-3910 0 1 0
chr6:44104817|44105024 hsa-miR-3910 0 1 0
chr9:137204449|137204703 hsa-miR-3910 0 1 0
chr2:215375345|215375686 hsa-miR-3910 0 1 0
chr3:42224702|42224842 hsa-miR-3910 0 1 0
chr19:10684882|10685024 hsa-miR-3910 0 1 0
chr12:120697691|120697850 hsa-miR-3910 0 1 0
chr1:116403890|116404434 hsa-miR-3910 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-3910 RD3 RD3 regulator of GUCY2D HGNC:19689 details
hsa-miR-3910 ZNF514 zinc finger protein 514 HGNC:25894 details
hsa-miR-3910 NFAT5 nuclear factor of activated T cells 5 HGNC:7774 details
hsa-miR-3910 CAND1 cullin associated and neddylation dissociated 1 HGNC:30688 details
hsa-miR-3910 ZFP69B ZFP69 zinc finger protein B HGNC:28053 details
hsa-miR-3910 COMMD5 COMM domain containing 5 HGNC:17902 details
hsa-miR-3910 SRP9 signal recognition particle 9 HGNC:11304 details
hsa-miR-3910 ITPRIP inositol 1,4,5-trisphosphate receptor interacting protein HGNC:29370 details
hsa-miR-3910 TIPIN TIMELESS interacting protein HGNC:30750 details
hsa-miR-3910 METTL1 methyltransferase 1, tRNA methylguanosine HGNC:7030 details
hsa-miR-3910 TNPO2 transportin 2 HGNC:19998 details
hsa-miR-3910 RNF41 ring finger protein 41 HGNC:18401 details
hsa-miR-3910 PRR14L proline rich 14 like HGNC:28738 details
hsa-miR-3910 PLIN3 perilipin 3 HGNC:16893 details
hsa-miR-3910 PGM2L1 phosphoglucomutase 2 like 1 HGNC:20898 details
hsa-miR-3910 PANK2 pantothenate kinase 2 HGNC:15894 details
hsa-miR-3910 MTDH metadherin HGNC:29608 details
hsa-miR-3910 ICMT isoprenylcysteine carboxyl methyltransferase HGNC:5350 details
hsa-miR-3910 MFSD14B major facilitator superfamily domain containing 14B HGNC:23376 details
hsa-miR-3910 DDX52 DExD-box helicase 52 HGNC:20038 details
hsa-miR-3910 CARNMT1 carnosine N-methyltransferase 1 HGNC:23435 details
hsa-miR-3910 AKIRIN1 akirin 1 HGNC:25744 details
hsa-miR-3910 TMTC1 transmembrane O-mannosyltransferase targeting cadherins 1 HGNC:24099 details
hsa-miR-3910 ARHGAP1 Rho GTPase activating protein 1 HGNC:673 details
hsa-miR-3910 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 HGNC:20363 details
hsa-miR-3910 KCNJ6 potassium inwardly rectifying channel subfamily J member 6 HGNC:6267 details
hsa-miR-3910 CDK4 cyclin dependent kinase 4 HGNC:1773 details
hsa-miR-3910 SLC16A1 solute carrier family 16 member 1 HGNC:10922 details
hsa-miR-3910 PI4K2B phosphatidylinositol 4-kinase type 2 beta HGNC:18215 details
hsa-miR-3910 KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-3910 CEP104 centrosomal protein 104 HGNC:24866 details
hsa-miR-3910 ZNF772 zinc finger protein 772 HGNC:33106 details
hsa-miR-3910 MYLIP myosin regulatory light chain interacting protein HGNC:21155 details
hsa-miR-3910 ZNF582 zinc finger protein 582 HGNC:26421 details
hsa-miR-3910 details
hsa-miR-3910 HEPHL1 hephaestin like 1 HGNC:30477 details
hsa-miR-3910 ATXN7L1 ataxin 7 like 1 HGNC:22210 details
hsa-miR-3910 AMOTL1 angiomotin like 1 HGNC:17811 details
hsa-miR-3910 ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-3910 IFNAR2 interferon alpha and beta receptor subunit 2 HGNC:5433 details
hsa-miR-3910 ZNF507 zinc finger protein 507 HGNC:23783 details
hsa-miR-3910 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 HGNC:11109 details
hsa-miR-3910 FBXO28 F-box protein 28 HGNC:29046 details
hsa-miR-3910 EFCAB14 EF-hand calcium binding domain 14 HGNC:29051 details
hsa-miR-3910 DDAH1 dimethylarginine dimethylaminohydrolase 1 HGNC:2715 details
hsa-miR-3910 ZNF281 zinc finger protein 281 HGNC:13075 details
hsa-miR-3910 KLHL42 kelch like family member 42 HGNC:29252 details
hsa-miR-3910 ZWINT ZW10 interacting kinetochore protein HGNC:13195 details
hsa-miR-3910 GTF2E1 general transcription factor IIE subunit 1 HGNC:4650 details
hsa-miR-3910 MRPL49 mitochondrial ribosomal protein L49 HGNC:1176 details
hsa-miR-3910 ZNF207 zinc finger protein 207 HGNC:12998 details
hsa-miR-3910 ZFP36L1 ZFP36 ring finger protein like 1 HGNC:1107 details
hsa-miR-3910 VAMP3 vesicle associated membrane protein 3 HGNC:12644 details
hsa-miR-3910 details
hsa-miR-3910 TMEM41A transmembrane protein 41A HGNC:30544 details
hsa-miR-3910 SPRTN SprT-like N-terminal domain HGNC:25356 details
hsa-miR-3910 SNX18 sorting nexin 18 HGNC:19245 details
hsa-miR-3910 SFT2D3 SFT2 domain containing 3 HGNC:28767 details
hsa-miR-3910 SERTAD3 SERTA domain containing 3 HGNC:17931 details
hsa-miR-3910 SCAMP4 secretory carrier membrane protein 4 HGNC:30385 details
hsa-miR-3910 QKI QKI, KH domain containing RNA binding HGNC:21100 details
hsa-miR-3910 PTBP3 polypyrimidine tract binding protein 3 HGNC:10253 details
hsa-miR-3910 PTBP1 polypyrimidine tract binding protein 1 HGNC:9583 details
hsa-miR-3910 PPP2R2A protein phosphatase 2 regulatory subunit Balpha HGNC:9304 details
hsa-miR-3910 POC1B-GALNT4 POC1B-GALNT4 readthrough HGNC:42957 details
hsa-miR-3910 PCCB propionyl-CoA carboxylase subunit beta HGNC:8654 details
hsa-miR-3910 PARP16 poly(ADP-ribose) polymerase family member 16 HGNC:26040 details
hsa-miR-3910 OTUD1 OTU deubiquitinase 1 HGNC:27346 details
hsa-miR-3910 NFIX nuclear factor I X HGNC:7788 details
hsa-miR-3910 LYSMD3 LysM domain containing 3 HGNC:26969 details
hsa-miR-3910 LRRC1 leucine rich repeat containing 1 HGNC:14307 details
hsa-miR-3910 KLHL28 kelch like family member 28 HGNC:19741 details
hsa-miR-3910 ITGB1 integrin subunit beta 1 HGNC:6153 details
hsa-miR-3910 GXYLT1 glucoside xylosyltransferase 1 HGNC:27482 details
hsa-miR-3910 GALNT4 polypeptide N-acetylgalactosaminyltransferase 4 HGNC:4126 details
hsa-miR-3910 FANCF FA complementation group F HGNC:3587 details
hsa-miR-3910 EIF5 eukaryotic translation initiation factor 5 HGNC:3299 details
hsa-miR-3910 DDI2 DNA damage inducible 1 homolog 2 HGNC:24578 details
hsa-miR-3910 CREBRF CREB3 regulatory factor HGNC:24050 details
hsa-miR-3910 CHSY1 chondroitin sulfate synthase 1 HGNC:17198 details
hsa-miR-3910 CENPQ centromere protein Q HGNC:21347 details
hsa-miR-3910 ANP32E acidic nuclear phosphoprotein 32 family member E HGNC:16673 details
hsa-miR-3910 NCMAP non-compact myelin associated protein HGNC:29332 details
hsa-miR-3910 LPCAT3 lysophosphatidylcholine acyltransferase 3 HGNC:30244 details
hsa-miR-3910 ADRB3 adrenoceptor beta 3 HGNC:288 details
hsa-miR-3910 SOX9 SRY-box transcription factor 9 HGNC:11204 details
hsa-miR-3910 PDE11A phosphodiesterase 11A HGNC:8773 details
hsa-miR-3910 GJD2 gap junction protein delta 2 HGNC:19154 details
hsa-miR-3910 UBXN2B UBX domain protein 2B HGNC:27035 details
hsa-miR-3910 ZNF724 zinc finger protein 724 HGNC:32460 details
hsa-miR-3910 CD1D CD1d molecule HGNC:1637 details
hsa-miR-3910 MYO10 myosin X HGNC:7593 details
hsa-miR-3910 TMEM181 transmembrane protein 181 HGNC:20958 details
hsa-miR-3910 CDK1 cyclin dependent kinase 1 HGNC:1722 details
hsa-miR-3910 MAN2B2 mannosidase alpha class 2B member 2 HGNC:29623 details
hsa-miR-3910 PLLP plasmolipin HGNC:18553 details
hsa-miR-3910 RPL14 ribosomal protein L14 HGNC:10305 details
hsa-miR-3910 BAHD1 bromo adjacent homology domain containing 1 HGNC:29153 details
hsa-miR-3910 COL13A1 collagen type XIII alpha 1 chain HGNC:2190 details
hsa-miR-3910 MAPKAPK5 MAPK activated protein kinase 5 HGNC:6889 details
hsa-miR-3910 FSTL3 follistatin like 3 HGNC:3973 details
hsa-miR-3910 DLEU1 deleted in lymphocytic leukemia 1 HGNC:13747 details
hsa-miR-3910 B4GALNT3 beta-1,4-N-acetyl-galactosaminyltransferase 3 HGNC:24137 details
hsa-miR-3910 AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-3910 DCUN1D5 defective in cullin neddylation 1 domain containing 5 HGNC:28409 details
hsa-miR-3910 MLLT1 MLLT1 super elongation complex subunit HGNC:7134 details
hsa-miR-3910 NFIC nuclear factor I C HGNC:7786 details
hsa-miR-3910 PNPLA2 patatin like phospholipase domain containing 2 HGNC:30802 details
hsa-miR-3910 SART3 spliceosome associated factor 3, U4/U6 recycling protein HGNC:16860 details
hsa-miR-3910 STK35 serine/threonine kinase 35 HGNC:16254 details
hsa-miR-3910 STK4 serine/threonine kinase 4 HGNC:11408 details
hsa-miR-3910 TMEM41B transmembrane protein 41B HGNC:28948 details
hsa-miR-3910 WDR82 WD repeat domain 82 HGNC:28826 details
hsa-miR-3910 ATP6V1E1 ATPase H+ transporting V1 subunit E1 HGNC:857 details
hsa-miR-3910 CDKN1A cyclin dependent kinase inhibitor 1A HGNC:1784 details
hsa-miR-3910 GNL3L G protein nucleolar 3 like HGNC:25553 details
hsa-miR-3910 MAGEA12 MAGE family member A12 HGNC:6799 details
hsa-miR-3910 RMDN1 regulator of microtubule dynamics 1 HGNC:24285 details
hsa-miR-3910 SMU1 SMU1 DNA replication regulator and spliceosomal factor HGNC:18247 details
hsa-miR-3910 ZCCHC4 zinc finger CCHC-type containing 4 HGNC:22917 details
hsa-miR-3910 ARSD arylsulfatase D HGNC:717 details
hsa-miR-3910 LDB1 LIM domain binding 1 HGNC:6532 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab