CircNet

miRNA General Information

Basic
Network

miRNA ID	hsa-miR-3912-3p
Description	Homo sapiens miR-3912 stem-loop
Comment	None
Experiment	Illumina [1-2]
Sequence	UAACGCAUAAUAUGGACAUGU

miRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan
chr10:997208\|1007128	hsa-miR-3912-3p	1	1	1

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr17:17158682\|17158915	hsa-miR-3912-3p	0	1
chr17:77499637\|77499779	hsa-miR-3912-3p	0	1
chr19:35737868\|35738132	hsa-miR-3912-3p	0	1
chr22:19038482~19038599	hsa-miR-3912-3p	0	1
chr17:77499637~77499779	hsa-miR-3912-3p	0	1
chr17:77499637~77499712	hsa-miR-3912-3p	0	1
chr17:77499637~77499781	hsa-miR-3912-3p	0	1
chr10:38119812\|38120078	hsa-miR-3912-3p	0	1
chr10:100364590\|100364680	hsa-miR-3912-3p	0	1
chr14:91408659\|91408767	hsa-miR-3912-3p	0	1
chr16:3530600\|3532821	hsa-miR-3912-3p	0	1
chr22:19038482\|19038716	hsa-miR-3912-3p	0	1
chr8:100706732\|100706917	hsa-miR-3912-3p	0	1
chr17:77499637\|77499788	hsa-miR-3912-3p	0	1
chr17:63426587\|63426732	hsa-miR-3912-3p	0	1
chr17:77499637\|77499771	hsa-miR-3912-3p	0	1
chr17:77499637\|77499781	hsa-miR-3912-3p	0	1
chr5:84060316\|84060454	hsa-miR-3912-3p	1	0
chr2:241654553\|241654696	hsa-miR-3912-3p	0	1
chr1:28743052\|28743175	hsa-miR-3912-3p	0	1
chr1:58658133\|58658257	hsa-miR-3912-3p	0	1
chr17:17158720\|17158882	hsa-miR-3912-3p	0	1
chr4:24576424\|24576610	hsa-miR-3912-3p	0	1
chr2:241654571\|241655307	hsa-miR-3912-3p	0	1

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-miR-3912-3p	SRP68	signal recognition particle 68	HGNC:11302	details
hsa-miR-3912-3p	RPL13A	ribosomal protein L13a	HGNC:10304	details
hsa-miR-3912-3p	GRK2	G protein-coupled receptor kinase 2	HGNC:289	details
hsa-miR-3912-3p	TFAM	transcription factor A, mitochondrial	HGNC:11741	details
hsa-miR-3912-3p	ACTB	actin beta	HGNC:132	details
hsa-miR-3912-3p	HNRNPA0	heterogeneous nuclear ribonucleoprotein A0	HGNC:5030	details
hsa-miR-3912-3p	PLEKHF2	pleckstrin homology and FYVE domain containing 2	HGNC:20757	details
hsa-miR-3912-3p	AMER2	APC membrane recruitment protein 2	HGNC:26360	details
hsa-miR-3912-3p	RREB1	ras responsive element binding protein 1	HGNC:10449	details
hsa-miR-3912-3p	FPR3	formyl peptide receptor 3	HGNC:3828	details
hsa-miR-3912-3p	PXDN	peroxidasin	HGNC:14966	details
hsa-miR-3912-3p	NEDD9	neural precursor cell expressed, developmentally down-regulated 9	HGNC:7733	details
hsa-miR-3912-3p	CPSF6	cleavage and polyadenylation specific factor 6	HGNC:13871	details
hsa-miR-3912-3p	PARL	presenilin associated rhomboid like	HGNC:18253	details
hsa-miR-3912-3p	MTRNR2L1	MT-RNR2 like 1	HGNC:37155	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)