miRNA Card

miRNA General Information
miRNA ID hsa-miR-3920
Description Homo sapiens miR-3920 stem-loop
Comment None
Experiment Illumina [1]
Sequence ACUGAUUAUCUUAACUCUCUGA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr2:47798626|47798850 hsa-miR-3920 1 0 0
chr2:216673179|216673310 hsa-miR-3920 1 0 0
chr17:8160219|8160610 hsa-miR-3920 0 1 0
chr10:113913079|113913200 hsa-miR-3920 1 0 0
chr2:47798726|47798850 hsa-miR-3920 1 0 0
chr7:134968554|134968666 hsa-miR-3920 0 1 0
chr12:120719253|120719391 hsa-miR-3920 0 1 0
chr1:119913992|119914087 hsa-miR-3920 0 1 0
chr1:155186200|155186447 hsa-miR-3920 0 1 0
chr20:44907813|44908036 hsa-miR-3920 0 1 0
chr9:19360263|19360429 hsa-miR-3920 0 1 0
chr3:171093939|171101633 hsa-miR-3920 0 1 0
chr2:65067712|65067857 hsa-miR-3920 0 1 0
chr10:113913079~113913200 hsa-miR-3920 0 1 0
chr4:133163006~133163134 hsa-miR-3920 0 1 0
chr1:155319665|155319928 hsa-miR-3920 0 1 0
chr3:52401867|52401989 hsa-miR-3920 0 1 0
chr2:100061348|100061457 hsa-miR-3920 0 1 0
chr4:73234393|73234528 hsa-miR-3920 0 1 0
chr1:10132602|10132746 hsa-miR-3920 0 1 0
chr15:64528561|64528696 hsa-miR-3920 0 1 0
chr5:132486162|132486258 hsa-miR-3920 0 1 0
chr10:102478491|102478585 hsa-miR-3920 0 1 0
chr1:32171079|32171221 hsa-miR-3920 0 1 0
chr4:25676225|25676380 hsa-miR-3920 1 0 0
chr2:47798678|47798850 hsa-miR-3920 1 0 0
chr9:128169024|128169141 hsa-miR-3920 1 0 0
chr4:25676225|25676335 hsa-miR-3920 1 0 0
chr4:25676225|25676353 hsa-miR-3920 1 0 0
chr10:79614832|79615197 hsa-miR-3920 0 1 0
chr1:155186200|155186304 hsa-miR-3920 0 1 0
chr17:78971828|78972089 hsa-miR-3920 0 1 0
chr8:22098092|22098310 hsa-miR-3920 0 1 0
chr1:165662710|165662824 hsa-miR-3920 0 1 0
chr10:79614908|79615131 hsa-miR-3920 0 1 0
chr1:165662710|165662858 hsa-miR-3920 0 1 0
chr10:79614945|79615150 hsa-miR-3920 0 1 0
chr10:79614945|79615131 hsa-miR-3920 0 1 0
chr7:55997917|55998052 hsa-miR-3920 0 1 0
chr17:82457712|82457803 hsa-miR-3920 0 1 0
chr5:180610629|180610754 hsa-miR-3920 0 1 0
chr17:77438455|77438689 hsa-miR-3920 0 1 0
chr16:50530975|50531090 hsa-miR-3920 0 1 0
chr10:133272442|133272572 hsa-miR-3920 0 1 0
chr1:32774373|32774568 hsa-miR-3920 0 1 0
chr1:22529611|22529847 hsa-miR-3920 0 1 0
chr11:83092887|83093020 hsa-miR-3920 0 1 0
chr18:54892806|54892893 hsa-miR-3920 0 1 0
chr6:32850944|32851056 hsa-miR-3920 0 1 0
chr16:30558246|30558384 hsa-miR-3920 -3 1 0
chr10:5035428|5035616 hsa-miR-3920 -1 1 0
chr1:156073243|156073350 hsa-miR-3920 -7 1 0
chr19:5694499|5694811 hsa-miR-3920 -11 1 0
chr1:119913992|119914168 hsa-miR-3920 -4 1 0
chr14:23310263|23310591 hsa-miR-3920 0 1 0
chr16:2281381|2281466 hsa-miR-3920 -13 1 0
chr16:4246775|4247005 hsa-miR-3920 1 0 0
chr2:216673213|216673314 hsa-miR-3920 1 0 0
chr12:49558310|49558438 hsa-miR-3920 0 1 0
chr3:48694483|48694689 hsa-miR-3920 0 1 0
chr19:39927879|39928059 hsa-miR-3920 0 1 0
chr12:119193712|119193865 hsa-miR-3920 0 1 0
chr17:28368872|28369309 hsa-miR-3920 0 1 0
chr6:127289901|127290205 hsa-miR-3920 0 1 0
chr5:178209836|178210074 hsa-miR-3920 0 1 0
chr20:44908005|44908059 hsa-miR-3920 0 1 0
chr1:165662710|165662800 hsa-miR-3920 0 1 0
chr1:32774454|32774607 hsa-miR-3920 0 1 0
chr11:65629520|65629671 hsa-miR-3920 0 1 0
chr9:121180268|121180487 hsa-miR-3920 0 1 0
chr2:216673125|216673310 hsa-miR-3920 1 0 0
chr17:42955925|42956245 hsa-miR-3920 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-3920 STK17A serine/threonine kinase 17a HGNC:11395 details
hsa-miR-3920 TMPRSS15 transmembrane serine protease 15 HGNC:9490 details
hsa-miR-3920 MAPK6 mitogen-activated protein kinase 6 HGNC:6879 details
hsa-miR-3920 SLC38A7 solute carrier family 38 member 7 HGNC:25582 details
hsa-miR-3920 SLC1A5 solute carrier family 1 member 5 HGNC:10943 details
hsa-miR-3920 ARL5B ADP ribosylation factor like GTPase 5B HGNC:23052 details
hsa-miR-3920 KIAA1191 KIAA1191 HGNC:29209 details
hsa-miR-3920 MON1B MON1 homolog B, secretory trafficking associated HGNC:25020 details
hsa-miR-3920 IKZF4 IKAROS family zinc finger 4 HGNC:13179 details
hsa-miR-3920 IYD iodotyrosine deiodinase HGNC:21071 details
hsa-miR-3920 USP46 ubiquitin specific peptidase 46 HGNC:20075 details
hsa-miR-3920 TMSB4X thymosin beta 4 X-linked HGNC:11881 details
hsa-miR-3920 HACD3 3-hydroxyacyl-CoA dehydratase 3 HGNC:24175 details
hsa-miR-3920 HOXA10 homeobox A10 HGNC:5100 details
hsa-miR-3920 RPF2 ribosome production factor 2 homolog HGNC:20870 details
hsa-miR-3920 PUM1 pumilio RNA binding family member 1 HGNC:14957 details
hsa-miR-3920 UBXN2B UBX domain protein 2B HGNC:27035 details
hsa-miR-3920 ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-3920 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 HGNC:10833 details
hsa-miR-3920 PPP3CB protein phosphatase 3 catalytic subunit beta HGNC:9315 details
hsa-miR-3920 DHX33 DEAH-box helicase 33 HGNC:16718 details
hsa-miR-3920 VAMP3 vesicle associated membrane protein 3 HGNC:12644 details
hsa-miR-3920 XKR4 XK related 4 HGNC:29394 details
hsa-miR-3920 AAK1 AP2 associated kinase 1 HGNC:19679 details
hsa-miR-3920 MRPL17 mitochondrial ribosomal protein L17 HGNC:14053 details
hsa-miR-3920 KCNN3 potassium calcium-activated channel subfamily N member 3 HGNC:6292 details
hsa-miR-3920 PAQR3 progestin and adipoQ receptor family member 3 HGNC:30130 details
hsa-miR-3920 FOXF2 forkhead box F2 HGNC:3810 details
hsa-miR-3920 RALGAPB Ral GTPase activating protein non-catalytic subunit beta HGNC:29221 details
hsa-miR-3920 LILRB2 leukocyte immunoglobulin like receptor B2 HGNC:6606 details
hsa-miR-3920 RAB30 RAB30, member RAS oncogene family HGNC:9770 details
hsa-miR-3920 ZNF730 zinc finger protein 730 HGNC:32470 details
hsa-miR-3920 DPF3 double PHD fingers 3 HGNC:17427 details
hsa-miR-3920 ZCCHC24 zinc finger CCHC-type containing 24 HGNC:26911 details
hsa-miR-3920 HRH1 histamine receptor H1 HGNC:5182 details
hsa-miR-3920 HES2 hes family bHLH transcription factor 2 HGNC:16005 details
hsa-miR-3920 FOXN3 forkhead box N3 HGNC:1928 details
hsa-miR-3920 TECPR2 tectonin beta-propeller repeat containing 2 HGNC:19957 details
hsa-miR-3920 WNK3 WNK lysine deficient protein kinase 3 HGNC:14543 details
hsa-miR-3920 BMPR1A bone morphogenetic protein receptor type 1A HGNC:1076 details
hsa-miR-3920 NRIP1 nuclear receptor interacting protein 1 HGNC:8001 details
hsa-miR-3920 PLAC8 placenta associated 8 HGNC:19254 details
hsa-miR-3920 TMC5 transmembrane channel like 5 HGNC:22999 details
hsa-miR-3920 POLL DNA polymerase lambda HGNC:9184 details
hsa-miR-3920 GEM GTP binding protein overexpressed in skeletal muscle HGNC:4234 details
hsa-miR-3920 RNF40 ring finger protein 40 HGNC:16867 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab