miRNA Card

miRNA General Information
miRNA ID hsa-miR-3924
Description Homo sapiens miR-3924 stem-loop
Comment None
Experiment Illumina [1]
Sequence AUAUGUAUAUGUGACUGCUACU
miRNA Expression in different cancers


circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr12:14882050|14882145 hsa-miR-3924 1 0 0
chr7:128770754|128770890 hsa-miR-3924 0 1 0
chr5:172768327|172768439 hsa-miR-3924 0 1 0
chr5:172768350|172768439 hsa-miR-3924 0 1 0
chr17:4734421|4734622 hsa-miR-3924 0 1 0
chr1:67412042|67412164 hsa-miR-3924 0 1 0
chr6:122725215|122725393 hsa-miR-3924 1 0 0
chr4:2512457|2512597 hsa-miR-3924 1 0 0
chr6:75119116|75119446 hsa-miR-3924 1 0 0
chr3:191393151|191393266 hsa-miR-3924 0 1 0
chr12:62645433|62645522 hsa-miR-3924 0 1 0
chr19:38729651|38729768 hsa-miR-3924 0 1 0
chr19:38729580|38729731 hsa-miR-3924 0 1 0
chr2:131588171|131588294 hsa-miR-3924 0 1 0
chr2:226732634|226732746 hsa-miR-3924 0 1 0
chr1:67412042~67412164 hsa-miR-3924 0 1 0
chr11:83186732~83186987 hsa-miR-3924 0 1 0
chr4:2512457~2512597 hsa-miR-3924 0 1 0
chr12:57532256~57532622 hsa-miR-3924 0 1 0
chr19:38729580~38729768 hsa-miR-3924 0 1 0
chr19:38729630~38729768 hsa-miR-3924 0 1 0
chr2:226732646~226732746 hsa-miR-3924 0 1 0
chr19:38729580~38729731 hsa-miR-3924 0 1 0
chr10:51679679~51679844 hsa-miR-3924 0 1 0
chr19:38729568~38729731 hsa-miR-3924 0 1 0
chr19:38729616~38729731 hsa-miR-3924 0 1 0
chr1:154351006~154351195 hsa-miR-3924 0 1 0
chr2:190689502~190689603 hsa-miR-3924 0 1 0
chr3:114315686|114315848 hsa-miR-3924 0 1 0
chr1:244440610|244440800 hsa-miR-3924 0 1 0
chr19:53559926|53560057 hsa-miR-3924 0 1 0
chr5:172768327|172768591 hsa-miR-3924 0 1 0
chr17:58329759|58329881 hsa-miR-3924 1 0 0
chr18:225920|226058 hsa-miR-3924 0 1 0
chr5:172768327|172768435 hsa-miR-3924 0 1 0
chr5:95925545|95925683 hsa-miR-3924 0 1 0
chr16:30669930|30670120 hsa-miR-3924 0 1 0
chr12:66145841|66153448 hsa-miR-3924 1 0 0
chr17:4734421|4734631 hsa-miR-3924 0 1 0
chr1:154351059|154351195 hsa-miR-3924 0 1 0
chr1:160214445|160214714 hsa-miR-3924 0 1 0
chr3:48918113|48918263 hsa-miR-3924 0 1 0
chr19:38729630|38729768 hsa-miR-3924 0 1 0
chr19:38729580|38729768 hsa-miR-3924 0 1 0
chr14:72970551|72970659 hsa-miR-3924 0 1 0
chr1:42179259|42179411 hsa-miR-3924 0 1 0
chr1:226144919|226145024 hsa-miR-3924 0 1 0
chr2:100275714|100276023 hsa-miR-3924 0 1 0
chr19:38729616|38729768 hsa-miR-3924 0 1 0
chr2:218405150|218405386 hsa-miR-3924 0 1 0
chr19:38729568|38729731 hsa-miR-3924 0 1 0
chr2:188996125|188996461 hsa-miR-3924 0 1 0
chr1:23083179|23083332 hsa-miR-3924 0 1 0
chr2:236127343|236127456 hsa-miR-3924 0 1 0
chr14:23298609|23298686 hsa-miR-3924 0 1 0
chr20:53567501|53567708 hsa-miR-3924 -10 1 0
chr11:61004192|61004245 hsa-miR-3924 1 0 0
chr6:122725247|122725393 hsa-miR-3924 1 0 0
chr15:63062246|63062645 hsa-miR-3924 0 1 0
chr2:188996125|188996463 hsa-miR-3924 0 1 0
chr16:23626236|23626387 hsa-miR-3924 0 1 0
chr19:38729613|38729731 hsa-miR-3924 0 1 0
chr19:38729613|38729768 hsa-miR-3924 0 1 0
chr9:120447990|120448126 hsa-miR-3924 0 1 0
chr19:38729630|38729731 hsa-miR-3924 0 1 0
chr19:38729568|38729768 hsa-miR-3924 0 1 0
chr3:48425733|48425860 hsa-miR-3924 0 1 0
chr2:240614773|240615027 hsa-miR-3924 0 1 0
chr11:61349605|61349759 hsa-miR-3924 0 1 0
chrX:139768260|139768362 hsa-miR-3924 0 1 0
chr3:129304790|129305130 hsa-miR-3924 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-3924 CCDC74B coiled-coil domain containing 74B HGNC:25267 details
hsa-miR-3924 CCDC74A coiled-coil domain containing 74A HGNC:25197 details
hsa-miR-3924 THUMPD3 THUMP domain containing 3 HGNC:24493 details
hsa-miR-3924 UBE2K ubiquitin conjugating enzyme E2 K HGNC:4914 details
hsa-miR-3924 HINT1 histidine triad nucleotide binding protein 1 HGNC:4912 details
hsa-miR-3924 GNA13 G protein subunit alpha 13 HGNC:4381 details
hsa-miR-3924 DDX4 DEAD-box helicase 4 HGNC:18700 details
hsa-miR-3924 TRPV2 transient receptor potential cation channel subfamily V member 2 HGNC:18082 details
hsa-miR-3924 MDM4 MDM4 regulator of p53 HGNC:6974 details
hsa-miR-3924 KPNA2 karyopherin subunit alpha 2 HGNC:6395 details
hsa-miR-3924 C5orf24 chromosome 5 open reading frame 24 HGNC:26746 details
hsa-miR-3924 ANKH ANKH inorganic pyrophosphate transport regulator HGNC:15492 details
hsa-miR-3924 BTBD3 BTB domain containing 3 HGNC:15854 details
hsa-miR-3924 IL6ST interleukin 6 cytokine family signal transducer HGNC:6021 details
hsa-miR-3924 PLEKHA8 pleckstrin homology domain containing A8 HGNC:30037 details
hsa-miR-3924 MFSD8 major facilitator superfamily domain containing 8 HGNC:28486 details
hsa-miR-3924 ZBTB34 zinc finger and BTB domain containing 34 HGNC:31446 details
hsa-miR-3924 SYPL1 synaptophysin like 1 HGNC:11507 details
hsa-miR-3924 SOX5 SRY-box transcription factor 5 HGNC:11201 details
hsa-miR-3924 TET2 tet methylcytosine dioxygenase 2 HGNC:25941 details
hsa-miR-3924 ASB11 ankyrin repeat and SOCS box containing 11 HGNC:17186 details
hsa-miR-3924 details
hsa-miR-3924 CTLA4 cytotoxic T-lymphocyte associated protein 4 HGNC:2505 details
hsa-miR-3924 NCAM2 neural cell adhesion molecule 2 HGNC:7657 details
hsa-miR-3924 CSMD1 CUB and Sushi multiple domains 1 HGNC:14026 details
hsa-miR-3924 PGBD4 piggyBac transposable element derived 4 HGNC:19401 details
hsa-miR-3924 ELF2 E74 like ETS transcription factor 2 HGNC:3317 details
hsa-miR-3924 LHFPL5 LHFPL tetraspan subfamily member 5 HGNC:21253 details
hsa-miR-3924 SLC24A2 solute carrier family 24 member 2 HGNC:10976 details
hsa-miR-3924 BVES blood vessel epicardial substance HGNC:1152 details
hsa-miR-3924 CYGB cytoglobin HGNC:16505 details
hsa-miR-3924 CLEC2D C-type lectin domain family 2 member D HGNC:14351 details
hsa-miR-3924 DOCK7 dedicator of cytokinesis 7 HGNC:19190 details
hsa-miR-3924 CA12 carbonic anhydrase 12 HGNC:1371 details
hsa-miR-3924 ZNF644 zinc finger protein 644 HGNC:29222 details
hsa-miR-3924 ZBED3 zinc finger BED-type containing 3 HGNC:20711 details
hsa-miR-3924 SENP1 SUMO specific peptidase 1 HGNC:17927 details
hsa-miR-3924 SEC23IP SEC23 interacting protein HGNC:17018 details
hsa-miR-3924 PPP4R2 protein phosphatase 4 regulatory subunit 2 HGNC:18296 details
hsa-miR-3924 PLEKHA3 pleckstrin homology domain containing A3 HGNC:14338 details
hsa-miR-3924 NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-3924 NRF1 nuclear respiratory factor 1 HGNC:7996 details
hsa-miR-3924 KCNJ3 potassium inwardly rectifying channel subfamily J member 3 HGNC:6264 details
hsa-miR-3924 HIC2 HIC ZBTB transcriptional repressor 2 HGNC:18595 details
hsa-miR-3924 E2F8 E2F transcription factor 8 HGNC:24727 details
hsa-miR-3924 CSRNP3 cysteine and serine rich nuclear protein 3 HGNC:30729 details
hsa-miR-3924 CD226 CD226 molecule HGNC:16961 details
hsa-miR-3924 CCDC38 coiled-coil domain containing 38 HGNC:26843 details
hsa-miR-3924 ZNF608 zinc finger protein 608 HGNC:29238 details
hsa-miR-3924 ENTHD1 ENTH domain containing 1 HGNC:26352 details
hsa-miR-3924 MLLT3 MLLT3 super elongation complex subunit HGNC:7136 details
hsa-miR-3924 DCLRE1C DNA cross-link repair 1C HGNC:17642 details
hsa-miR-3924 RABGAP1 RAB GTPase activating protein 1 HGNC:17155 details
hsa-miR-3924 TSC22D3 TSC22 domain family member 3 HGNC:3051 details
hsa-miR-3924 HS2ST1 heparan sulfate 2-O-sulfotransferase 1 HGNC:5193 details
hsa-miR-3924 TSPAN2 tetraspanin 2 HGNC:20659 details
hsa-miR-3924 OTX1 orthodenticle homeobox 1 HGNC:8521 details
hsa-miR-3924 KCNK1 potassium two pore domain channel subfamily K member 1 HGNC:6272 details
hsa-miR-3924 SRP72 signal recognition particle 72 HGNC:11303 details
hsa-miR-3924 LARP1 La ribonucleoprotein 1, translational regulator HGNC:29531 details
hsa-miR-3924 SPSB1 splA/ryanodine receptor domain and SOCS box containing 1 HGNC:30628 details
hsa-miR-3924 FOXL1 forkhead box L1 HGNC:3817 details
hsa-miR-3924 EFCAB11 EF-hand calcium binding domain 11 HGNC:20357 details
hsa-miR-3924 USF3 upstream transcription factor family member 3 HGNC:30494 details
hsa-miR-3924 SERTM1 serine rich and transmembrane domain containing 1 HGNC:33792 details
hsa-miR-3924 GTPBP2 GTP binding protein 2 HGNC:4670 details
hsa-miR-3924 TACR3 tachykinin receptor 3 HGNC:11528 details
hsa-miR-3924 TMEM132B transmembrane protein 132B HGNC:29397 details
hsa-miR-3924 HHIP hedgehog interacting protein HGNC:14866 details
hsa-miR-3924 ITGA1 integrin subunit alpha 1 HGNC:6134 details
hsa-miR-3924 KANSL1L KAT8 regulatory NSL complex subunit 1 like HGNC:26310 details
hsa-miR-3924 CRIM1 cysteine rich transmembrane BMP regulator 1 HGNC:2359 details
hsa-miR-3924 NAA25 N-alpha-acetyltransferase 25, NatB auxiliary subunit HGNC:25783 details
hsa-miR-3924 STARD8 StAR related lipid transfer domain containing 8 HGNC:19161 details
hsa-miR-3924 CYP4F11 cytochrome P450 family 4 subfamily F member 11 HGNC:13265 details
hsa-miR-3924 details
hsa-miR-3924 ZIC5 Zic family member 5 HGNC:20322 details
hsa-miR-3924 SV2B synaptic vesicle glycoprotein 2B HGNC:16874 details
hsa-miR-3924 SLC8A1 solute carrier family 8 member A1 HGNC:11068 details
hsa-miR-3924 RAB5B RAB5B, member RAS oncogene family HGNC:9784 details
hsa-miR-3924 PROX1 prospero homeobox 1 HGNC:9459 details
hsa-miR-3924 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 HGNC:8979 details
hsa-miR-3924 details
hsa-miR-3924 NFIB nuclear factor I B HGNC:7785 details
hsa-miR-3924 MBNL3 muscleblind like splicing regulator 3 HGNC:20564 details
hsa-miR-3924 MAP3K12 mitogen-activated protein kinase kinase kinase 12 HGNC:6851 details
hsa-miR-3924 details
hsa-miR-3924 KPNA4 karyopherin subunit alpha 4 HGNC:6397 details
hsa-miR-3924 KIAA1522 KIAA1522 HGNC:29301 details
hsa-miR-3924 IKZF4 IKAROS family zinc finger 4 HGNC:13179 details
hsa-miR-3924 HNRNPU heterogeneous nuclear ribonucleoprotein U HGNC:5048 details
hsa-miR-3924 HNRNPC heterogeneous nuclear ribonucleoprotein C HGNC:5035 details
hsa-miR-3924 HMGXB4 HMG-box containing 4 HGNC:5003 details
hsa-miR-3924 DUSP7 dual specificity phosphatase 7 HGNC:3073 details
hsa-miR-3924 CREBZF CREB/ATF bZIP transcription factor HGNC:24905 details
hsa-miR-3924 TSNARE1 t-SNARE domain containing 1 HGNC:26437 details
hsa-miR-3924 SLC35E3 solute carrier family 35 member E3 HGNC:20864 details
hsa-miR-3924 WDR72 WD repeat domain 72 HGNC:26790 details
hsa-miR-3924 PRKCD protein kinase C delta HGNC:9399 details
hsa-miR-3924 RIC8B RIC8 guanine nucleotide exchange factor B HGNC:25555 details
hsa-miR-3924 PLXDC2 plexin domain containing 2 HGNC:21013 details
hsa-miR-3924 CALHM5 calcium homeostasis modulator family member 5 HGNC:21568 details
hsa-miR-3924 RAI1 retinoic acid induced 1 HGNC:9834 details
hsa-miR-3924 ZNF85 zinc finger protein 85 HGNC:13160 details
hsa-miR-3924 VENTX VENT homeobox HGNC:13639 details
hsa-miR-3924 CHAF1B chromatin assembly factor 1 subunit B HGNC:1911 details
hsa-miR-3924 TRIM35 tripartite motif containing 35 HGNC:16285 details
hsa-miR-3924 ZNF333 zinc finger protein 333 HGNC:15624 details
hsa-miR-3924 ZNF551 zinc finger protein 551 HGNC:25108 details
hsa-miR-3924 GRID2 glutamate ionotropic receptor delta type subunit 2 HGNC:4576 details
hsa-miR-3924 RBM22 RNA binding motif protein 22 HGNC:25503 details
hsa-miR-3924 ZNF512B zinc finger protein 512B HGNC:29212 details
hsa-miR-3924 YAF2 YY1 associated factor 2 HGNC:17363 details
hsa-miR-3924 WNT5A Wnt family member 5A HGNC:12784 details
hsa-miR-3924 VEGFA vascular endothelial growth factor A HGNC:12680 details
hsa-miR-3924 TMEM106B transmembrane protein 106B HGNC:22407 details
hsa-miR-3924 TBCEL tubulin folding cofactor E like HGNC:28115 details
hsa-miR-3924 RC3H1 ring finger and CCCH-type domains 1 HGNC:29434 details
hsa-miR-3924 PAPSS2 3'-phosphoadenosine 5'-phosphosulfate synthase 2 HGNC:8604 details
hsa-miR-3924 NELL2 neural EGFL like 2 HGNC:7751 details
hsa-miR-3924 NFIC nuclear factor I C HGNC:7786 details
hsa-miR-3924 MYADM myeloid associated differentiation marker HGNC:7544 details
hsa-miR-3924 MSI2 musashi RNA binding protein 2 HGNC:18585 details
hsa-miR-3924 MON1B MON1 homolog B, secretory trafficking associated HGNC:25020 details
hsa-miR-3924 MMP16 matrix metallopeptidase 16 HGNC:7162 details
hsa-miR-3924 ITPRIPL2 ITPRIP like 2 HGNC:27257 details
hsa-miR-3924 GRIN2B glutamate ionotropic receptor NMDA type subunit 2B HGNC:4586 details
hsa-miR-3924 FZD5 frizzled class receptor 5 HGNC:4043 details
hsa-miR-3924 DOCK4 dedicator of cytokinesis 4 HGNC:19192 details
hsa-miR-3924 CREB1 cAMP responsive element binding protein 1 HGNC:2345 details
hsa-miR-3924 CALML4 calmodulin like 4 HGNC:18445 details
hsa-miR-3924 BMP2 bone morphogenetic protein 2 HGNC:1069 details
hsa-miR-3924 BACH1 BTB domain and CNC homolog 1 HGNC:935 details
hsa-miR-3924 AMMECR1 AMMECR nuclear protein 1 HGNC:467 details
hsa-miR-3924 ABCC4 ATP binding cassette subfamily C member 4 HGNC:55 details
hsa-miR-3924 PIGN phosphatidylinositol glycan anchor biosynthesis class N HGNC:8967 details
hsa-miR-3924 AMOTL1 angiomotin like 1 HGNC:17811 details
hsa-miR-3924 MGAT4C MGAT4 family member C HGNC:30871 details
hsa-miR-3924 ZBTB18 zinc finger and BTB domain containing 18 HGNC:13030 details
hsa-miR-3924 RORA RAR related orphan receptor A HGNC:10258 details
hsa-miR-3924 HMGB2 high mobility group box 2 HGNC:5000 details
hsa-miR-3924 DDX6 DEAD-box helicase 6 HGNC:2747 details
hsa-miR-3924 BCORL1 BCL6 corepressor like 1 HGNC:25657 details
hsa-miR-3924 PRR23A proline rich 23A HGNC:37172 details
hsa-miR-3924 EDA2R ectodysplasin A2 receptor HGNC:17756 details
hsa-miR-3924 GTF2B general transcription factor IIB HGNC:4648 details
hsa-miR-3924 SPPL3 signal peptide peptidase like 3 HGNC:30424 details
hsa-miR-3924 MKLN1 muskelin 1 HGNC:7109 details
hsa-miR-3924 C15orf40 chromosome 15 open reading frame 40 HGNC:28443 details
hsa-miR-3924 PLP1 proteolipid protein 1 HGNC:9086 details
hsa-miR-3924 IL7R interleukin 7 receptor HGNC:6024 details
hsa-miR-3924 GABRG1 gamma-aminobutyric acid type A receptor subunit gamma1 HGNC:4086 details
hsa-miR-3924 RSL24D1 ribosomal L24 domain containing 1 HGNC:18479 details
hsa-miR-3924 NEDD4L NEDD4 like E3 ubiquitin protein ligase HGNC:7728 details
hsa-miR-3924 RBBP7 RB binding protein 7, chromatin remodeling factor HGNC:9890 details
hsa-miR-3924 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 HGNC:9108 details
hsa-miR-3924 OSBPL9 oxysterol binding protein like 9 HGNC:16386 details
hsa-miR-3924 NFIA nuclear factor I A HGNC:7784 details
hsa-miR-3924 NETO2 neuropilin and tolloid like 2 HGNC:14644 details
hsa-miR-3924 MED4 mediator complex subunit 4 HGNC:17903 details
hsa-miR-3924 LHFPL2 LHFPL tetraspan subfamily member 2 HGNC:6588 details
hsa-miR-3924 HSPA13 heat shock protein family A (Hsp70) member 13 HGNC:11375 details
hsa-miR-3924 FBXO28 F-box protein 28 HGNC:29046 details
hsa-miR-3924 CERCAM cerebral endothelial cell adhesion molecule HGNC:23723 details
hsa-miR-3924 ABI2 abl interactor 2 HGNC:24011 details
hsa-miR-3924 RBM23 RNA binding motif protein 23 HGNC:20155 details
hsa-miR-3924 FAR2 fatty acyl-CoA reductase 2 HGNC:25531 details
hsa-miR-3924 TMEM106C transmembrane protein 106C HGNC:28775 details
hsa-miR-3924 AR androgen receptor HGNC:644 details
hsa-miR-3924 OPN5 opsin 5 HGNC:19992 details
hsa-miR-3924 ATP7A ATPase copper transporting alpha HGNC:869 details
hsa-miR-3924 OPCML opioid binding protein/cell adhesion molecule like HGNC:8143 details
hsa-miR-3924 LRRC31 leucine rich repeat containing 31 HGNC:26261 details
hsa-miR-3924 ADH1B alcohol dehydrogenase 1B (class I), beta polypeptide HGNC:250 details
hsa-miR-3924 details
hsa-miR-3924 EPHA1 EPH receptor A1 HGNC:3385 details
hsa-miR-3924 PCDH10 protocadherin 10 HGNC:13404 details
hsa-miR-3924 PPP1R1A protein phosphatase 1 regulatory inhibitor subunit 1A HGNC:9286 details
hsa-miR-3924 ZNF562 zinc finger protein 562 HGNC:25950 details
hsa-miR-3924 UBR3 ubiquitin protein ligase E3 component n-recognin 3 HGNC:30467 details
hsa-miR-3924 UBE2D2 ubiquitin conjugating enzyme E2 D2 HGNC:12475 details
hsa-miR-3924 TRAF5 TNF receptor associated factor 5 HGNC:12035 details
hsa-miR-3924 SMIM13 small integral membrane protein 13 HGNC:27356 details
hsa-miR-3924 RRAGC Ras related GTP binding C HGNC:19902 details
hsa-miR-3924 PTPRD protein tyrosine phosphatase receptor type D HGNC:9668 details
hsa-miR-3924 MBNL2 muscleblind like splicing regulator 2 HGNC:16746 details
hsa-miR-3924 GXYLT2 glucoside xylosyltransferase 2 HGNC:33383 details
hsa-miR-3924 FREM2 FRAS1 related extracellular matrix 2 HGNC:25396 details
hsa-miR-3924 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 (inactive) HGNC:3367 details
hsa-miR-3924 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 HGNC:3093 details
hsa-miR-3924 DGKH diacylglycerol kinase eta HGNC:2854 details
hsa-miR-3924 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 HGNC:103 details
hsa-miR-3924 CMIP c-Maf inducing protein HGNC:24319 details
hsa-miR-3924 CHORDC1 cysteine and histidine rich domain containing 1 HGNC:14525 details
hsa-miR-3924 CHMP2B charged multivesicular body protein 2B HGNC:24537 details
hsa-miR-3924 APP amyloid beta precursor protein HGNC:620 details
hsa-miR-3924 AMER1 APC membrane recruitment protein 1 HGNC:26837 details
hsa-miR-3924 CBX6 chromobox 6 HGNC:1556 details
hsa-miR-3924 ZNF468 zinc finger protein 468 HGNC:33105 details
hsa-miR-3924 KIAA0408 KIAA0408 HGNC:21636 details
hsa-miR-3924 RPS14 ribosomal protein S14 HGNC:10387 details
hsa-miR-3924 TRIM13 tripartite motif containing 13 HGNC:9976 details
hsa-miR-3924 APOOL apolipoprotein O like HGNC:24009 details
hsa-miR-3924 FAM229B family with sequence similarity 229 member B HGNC:33858 details
hsa-miR-3924 ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-3924 SEPHS1 selenophosphate synthetase 1 HGNC:19685 details
hsa-miR-3924 SCML2 Scm polycomb group protein like 2 HGNC:10581 details
hsa-miR-3924 PHIP pleckstrin homology domain interacting protein HGNC:15673 details
hsa-miR-3924 KCNC4 potassium voltage-gated channel subfamily C member 4 HGNC:6236 details
hsa-miR-3924 DEK DEK proto-oncogene HGNC:2768 details
hsa-miR-3924 DCAF8 DDB1 and CUL4 associated factor 8 HGNC:24891 details
hsa-miR-3924 FLVCR1 FLVCR heme transporter 1 HGNC:24682 details
hsa-miR-3924 RPS15A ribosomal protein S15a HGNC:10389 details
hsa-miR-3924 TLL1 tolloid like 1 HGNC:11843 details
hsa-miR-3924 BEX4 brain expressed X-linked 4 HGNC:25475 details
hsa-miR-3924 ZDHHC5 zinc finger DHHC-type palmitoyltransferase 5 HGNC:18472 details
hsa-miR-3924 CLEC14A C-type lectin domain containing 14A HGNC:19832 details
hsa-miR-3924 GCK glucokinase HGNC:4195 details
hsa-miR-3924 ZNF529 zinc finger protein 529 HGNC:29328 details
hsa-miR-3924 ZBTB41 zinc finger and BTB domain containing 41 HGNC:24819 details
hsa-miR-3924 FYN FYN proto-oncogene, Src family tyrosine kinase HGNC:4037 details
hsa-miR-3924 L1CAM L1 cell adhesion molecule HGNC:6470 details
hsa-miR-3924 DYNC1I2 dynein cytoplasmic 1 intermediate chain 2 HGNC:2964 details
hsa-miR-3924 ADM adrenomedullin HGNC:259 details
hsa-miR-3924 PRRC2C proline rich coiled-coil 2C HGNC:24903 details
hsa-miR-3924 AHCYL2 adenosylhomocysteinase like 2 HGNC:22204 details
hsa-miR-3924 SLITRK4 SLIT and NTRK like family member 4 HGNC:23502 details
hsa-miR-3924 ARHGEF11 Rho guanine nucleotide exchange factor 11 HGNC:14580 details
hsa-miR-3924 XKR6 XK related 6 HGNC:27806 details
hsa-miR-3924 ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif 9 HGNC:13202 details
hsa-miR-3924 TMEM178B transmembrane protein 178B HGNC:44112 details
hsa-miR-3924 TIGD5 tigger transposable element derived 5 HGNC:18336 details
hsa-miR-3924 SLC25A12 solute carrier family 25 member 12 HGNC:10982 details
hsa-miR-3924 MTF1 metal regulatory transcription factor 1 HGNC:7428 details
hsa-miR-3924 KLHL23 kelch like family member 23 HGNC:27506 details
hsa-miR-3924 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 HGNC:21033 details
hsa-miR-3924 RLN1 relaxin 1 HGNC:10026 details
hsa-miR-3924 ARPC4 actin related protein 2/3 complex subunit 4 HGNC:707 details
hsa-miR-3924 TK1 thymidine kinase 1 HGNC:11830 details
hsa-miR-3924 SESN1 sestrin 1 HGNC:21595 details
hsa-miR-3924 SGMS1 sphingomyelin synthase 1 HGNC:29799 details
hsa-miR-3924 TBCK TBC1 domain containing kinase HGNC:28261 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab