CircNet

miRNA General Information

Basic
Network

miRNA ID	hsa-miR-3941
Description	Homo sapiens miR-3941 stem-loop
Comment	None
Experiment	Illumina [1]
Sequence	UUACACACAACUGAGGAUCAUA

miRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr22:21622251\|21622383	hsa-miR-3941	1	1
chr1:92336375\|92336427	hsa-miR-3941	1	1
chr6:7204239\|7204472	hsa-miR-3941	1	1
chr17:18209677\|18209918	hsa-miR-3941	1	1
chr19:2101915\|2102123	hsa-miR-3941	1	1
chr20:37518675\|37518795	hsa-miR-3941	1	1
chr1:225846480\|225846626	hsa-miR-3941	1	1

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chrX:1386548\|1386703	hsa-miR-3941	1	0
chr2:138571979\|138572064	hsa-miR-3941	0	1
chr22:41907035\|41907238	hsa-miR-3941	0	1
chr2:190205885\|190206224	hsa-miR-3941	0	1
chr12:108645478\|108645672	hsa-miR-3941	0	1
chrX:120447841\|120448007	hsa-miR-3941	0	1
chr10:100362517\|100362713	hsa-miR-3941	0	1
chr7:99396228\|99396380	hsa-miR-3941	0	1
chr17:50472552\|50473806	hsa-miR-3941	0	1
chr19:53874935\|53875269	hsa-miR-3941	0	1
chr16:88859721\|88859979	hsa-miR-3941	0	1
chr9:124517420\|124517581	hsa-miR-3941	0	1
chr1:162380059\|162380187	hsa-miR-3941	0	1
chr10:100362517\|100362726	hsa-miR-3941	0	1
chr9:112438431\|112441770	hsa-miR-3941	0	1
chr15:24963057\|24963202	hsa-miR-3941	0	1
chr10:100362517\|100362674	hsa-miR-3941	0	1
chr2:99197404\|99197539	hsa-miR-3941	0	1
chr19:58549985\|58550210	hsa-miR-3941	0	1
chrX:153961845\|153962037	hsa-miR-3941	0	1
chr22:41907077\|41907172	hsa-miR-3941	0	1
chr5:135570978\|135571307	hsa-miR-3941	0	1
chr7:107917328\|107917462	hsa-miR-3941	0	1
chr5:177595825\|177595943	hsa-miR-3941	0	1
chr10:37324408\|37324587	hsa-miR-3941	0	1
chr10:100362559\|100362713	hsa-miR-3941	0	1
chr3:140566875\|140567248	hsa-miR-3941	1	0
chr6:35427240\|35427360	hsa-miR-3941	1	0
chr9:126880569\|126880699	hsa-miR-3941	0	1
chr12:6333422\|6333776	hsa-miR-3941	0	1
chr9:136440727\|136440978	hsa-miR-3941	0	1
chr12:11853427\|11853561	hsa-miR-3941	0	1
chr3:52075605\|52075751	hsa-miR-3941	0	1
chr8:143579755\|143580146	hsa-miR-3941	0	1
chr3:14820761\|14820888	hsa-miR-3941	0	1
chr2:238255657\|238255795	hsa-miR-3941	0	1
chr15:65577396\|65577519	hsa-miR-3941	0	1
chr1:150987898\|150988186	hsa-miR-3941	0	1
chr10:101846416\|101846568	hsa-miR-3941	0	1
chr17:40089734\|40089874	hsa-miR-3941	0	1
chr5:135571161\|135571283	hsa-miR-3941	0	1
chr19:45472807\|45472933	hsa-miR-3941	0	1
chr19:48600154\|48600263	hsa-miR-3941	0	1
chr10:100362494\|100362713	hsa-miR-3941	0	1
chr17:9910640\|9910752	hsa-miR-3941	0	1
chr4:57017064\|57017241	hsa-miR-3941	0	1
chr9:91722653\|91722723	hsa-miR-3941	0	1
chr3:38141226\|38141326	hsa-miR-3941	0	1
chr19:42199089\|42199155	hsa-miR-3941	0	1
chr17:31880617\|31880754	hsa-miR-3941	0	1
chr7:1569208\|1569353	hsa-miR-3941	0	1
chr7:5478564\|5478720	hsa-miR-3941	0	1
chr19:48600154\|48600267	hsa-miR-3941	0	1
chr17:4538690\|4538832	hsa-miR-3941	0	1
chr16:85710240\|85710365	hsa-miR-3941	0	1
chr21:32393426~32393721	hsa-miR-3941	0	1
chr8:144360917~144361161	hsa-miR-3941	0	1
chr10:100362469~100362726	hsa-miR-3941	0	1
chr3:172362726~172362845	hsa-miR-3941	0	1
chr10:100362517~100362713	hsa-miR-3941	0	1
chr12:6333422~6333776	hsa-miR-3941	0	1
chr15:65577346~65577519	hsa-miR-3941	0	1
chr1:150987898~150988186	hsa-miR-3941	0	1
chr18:70004052~70004133	hsa-miR-3941	0	1
chr11:57326232~57326352	hsa-miR-3941	0	1
chr11:65121546~65121789	hsa-miR-3941	0	1
chr17:45108230~45108367	hsa-miR-3941	0	1
chr10:102814908~102815044	hsa-miR-3941	0	1
chr2:188995753~188996458	hsa-miR-3941	0	1
chr6:7288927~7289195	hsa-miR-3941	0	1
chr11:57326218~57326338	hsa-miR-3941	0	1
chr15:75211038~75211202	hsa-miR-3941	0	1
chr11:840243~840385	hsa-miR-3941	0	1
chr20:41179961~41180167	hsa-miR-3941	0	1
chr9:35679885~35680136	hsa-miR-3941	0	1
chr10:791676\|791807	hsa-miR-3941	0	1
chr17:78712843\|78712938	hsa-miR-3941	0	1
chr2:230819759\|230819884	hsa-miR-3941	0	1
chr11:1915081\|1915478	hsa-miR-3941	0	1
chr5:88806232\|88806353	hsa-miR-3941	0	1
chr19:16090912\|16091048	hsa-miR-3941	0	1
chr3:185653680\|185653851	hsa-miR-3941	0	1
chr6:34587373\|34587484	hsa-miR-3941	0	1
chr20:46357829\|46358030	hsa-miR-3941	0	1
chr2:181537067\|181537232	hsa-miR-3941	0	1
chr17:39175653\|39175729	hsa-miR-3941	0	1
chr22:31270194\|31270392	hsa-miR-3941	0	1
chr17:8268552\|8268697	hsa-miR-3941	0	1
chr3:15082367\|15082521	hsa-miR-3941	0	1
chr3:49422993\|49423277	hsa-miR-3941	0	1
chr13:113980103\|113980221	hsa-miR-3941	0	1
chr17:72675339\|72675515	hsa-miR-3941	0	1
chr5:56891167\|56891302	hsa-miR-3941	0	1
chr11:62796132\|62796515	hsa-miR-3941	0	1
chr1:15939675\|15939906	hsa-miR-3941	0	1
chr12:57524029\|57524325	hsa-miR-3941	0	1
chr20:41566545\|41566775	hsa-miR-3941	0	1
chr19:12939262\|12939427	hsa-miR-3941	0	1
chr9:137612070\|137612253	hsa-miR-3941	0	1
chr16:4266758\|4266887	hsa-miR-3941	0	1
chr4:3387444\|3387564	hsa-miR-3941	0	1
chrX:131794154\|131794296	hsa-miR-3941	0	1
chrX:132072010\|132072206	hsa-miR-3941	0	1
chrX:57224859\|57224956	hsa-miR-3941	0	1
chr22:40327791\|40328008	hsa-miR-3941	0	1
chr7:11817794\|11817941	hsa-miR-3941	0	1
chr22:39529211\|39529426	hsa-miR-3941	0	1
chr1:205626982\|205627184	hsa-miR-3941	0	1
chr19:45472707\|45472925	hsa-miR-3941	0	1
chrX:149492986\|149493194	hsa-miR-3941	0	1
chr11:1914751\|1914948	hsa-miR-3941	0	1
chr12:49130991\|49131137	hsa-miR-3941	0	1
chr2:88857491\|88861902	hsa-miR-3941	1	0
chr18:76362073\|76362184	hsa-miR-3941	0	1
chr19:681926\|682164	hsa-miR-3941	0	1
chr7:91265988\|91266320	hsa-miR-3941	0	1
chr9:35679885\|35680136	hsa-miR-3941	0	1
chr14:77028769\|77028920	hsa-miR-3941	0	1
chr11:73409535\|73409661	hsa-miR-3941	0	1
chr14:24416637\|24416758	hsa-miR-3941	0	1
chr9:34087235\|34087375	hsa-miR-3941	0	1
chr7:30922564\|30923488	hsa-miR-3941	0	1
chr1:20652621\|20652727	hsa-miR-3941	0	1
chr2:230819757\|230819884	hsa-miR-3941	0	1
chr1:33324101\|33324305	hsa-miR-3941	0	1
chr21:45513621\|45513722	hsa-miR-3941	0	1
chr2:201136848\|201137010	hsa-miR-3941	0	1
chr19:53874935\|53875267	hsa-miR-3941	0	1
chr22:19435861\|19435932	hsa-miR-3941	0	1
chr10:72013205\|72013323	hsa-miR-3941	0	1
chr6:7288927\|7289195	hsa-miR-3941	0	1
chr15:75211048\|75211208	hsa-miR-3941	0	1
chr21:45484308\|45484441	hsa-miR-3941	0	1
chr4:40809434\|40809598	hsa-miR-3941	0	1
chr16:75235534\|75235744	hsa-miR-3941	0	1
chr12:123752283\|123752394	hsa-miR-3941	0	1
chr2:10456046\|10456203	hsa-miR-3941	0	1
chr17:7512894\|7513201	hsa-miR-3941	0	1
chr9:128719657\|128719828	hsa-miR-3941	0	1
chr21:45513621\|45513744	hsa-miR-3941	0	1
chr13:113980040\|113980201	hsa-miR-3941	0	1
chr1:12208343\|12208525	hsa-miR-3941	0	1
chr6:32948724\|32949627	hsa-miR-3941	0	1
chr6:27757717\|27757945	hsa-miR-3941	0	1
chr2:85667748\|85667940	hsa-miR-3941	0	1
chr19:12939172\|12939472	hsa-miR-3941	0	1
chr21:46610093\|46610184	hsa-miR-3941	0	1
chr9:133254567\|133254726	hsa-miR-3941	0	1
chr21:44895132\|44895248	hsa-miR-3941	0	1
chr5:179709873\|179720560	hsa-miR-3941	0	1
chr16:72060759\|72077070	hsa-miR-3941	0	1
chr16:72060771\|72060879	hsa-miR-3941	0	1
chr6:150402297\|150402455	hsa-miR-3941	0	1
chr3:172362726\|172362845	hsa-miR-3941	0	1
chr5:141825471\|141825584	hsa-miR-3941	0	1
chr6:32948724\|32948852	hsa-miR-3941	0	1
chr2:62000701\|62000982	hsa-miR-3941	0	1
chr11:840243\|840351	hsa-miR-3941	0	1
chr8:144106436\|144106898	hsa-miR-3941	0	1
chr16:57428964\|57429150	hsa-miR-3941	0	1
chr22:19435638\|19435932	hsa-miR-3941	0	1
chr2:188996150\|188996471	hsa-miR-3941	0	1
chr9:92210600\|92210730	hsa-miR-3941	0	1
chr8:27544597\|27544799	hsa-miR-3941	0	1
chr8:144106555\|144106898	hsa-miR-3941	0	1
chr20:44199879\|44200005	hsa-miR-3941	0	1
chr17:78171957\|78172108	hsa-miR-3941	0	1
chr16:28595415\|28595671	hsa-miR-3941	0	1
chr17:78171969\|78172108	hsa-miR-3941	0	1
chr1:51909126\|51909311	hsa-miR-3941	0	1
chr16:1700604\|1700819	hsa-miR-3941	0	1
chr12:132950473\|132950677	hsa-miR-3941	0	1
chr19:39399679\|39399933	hsa-miR-3941	0	1
chr15:30930438\|30930593	hsa-miR-3941	0	1
chr2:46384950\|46385146	hsa-miR-3941	0	1
chr1:206455438\|206455590	hsa-miR-3941	0	1
chr4:73740585\|73740710	hsa-miR-3941	0	1
chr11:57326232\|57326338	hsa-miR-3941	0	1
chr11:6610488\|6610757	hsa-miR-3941	0	1
chr2:208243580\|208245419	hsa-miR-3941	0	1
chr1:115679708\|115679892	hsa-miR-3941	0	1
chr19:2715885\|2716019	hsa-miR-3941	0	1
chr22:41906912\|41907228	hsa-miR-3941	0	1
chr12:56471493\|56471824	hsa-miR-3941	0	1
chr1:46676265\|46676410	hsa-miR-3941	0	1
chr17:45108264\|45108472	hsa-miR-3941	0	1
chr22:29298941\|29299171	hsa-miR-3941	0	1
chr17:17846347\|17846561	hsa-miR-3941	0	1
chr20:430975\|431190	hsa-miR-3941	-2	1
chr16:70565236\|70565434	hsa-miR-3941	-5	1
chr9:35403167\|35403498	hsa-miR-3941	-8	1
chr9:34087235\|34087430	hsa-miR-3941	-5	1
chr10:70879334\|70879481	hsa-miR-3941	-8	1
chr2:65022457\|65022692	hsa-miR-3941	-9	1
chr4:107952010\|107952176	hsa-miR-3941	-9	1
chr16:2281381\|2281466	hsa-miR-3941	-9	1
chr14:34774396\|34774484	hsa-miR-3941	1	0
chrX:1386503\|1386600	hsa-miR-3941	1	0
chr19:2101915\|2102131	hsa-miR-3941	0	1
chr11:95068391\|95068623	hsa-miR-3941	0	1
chr11:6610496\|6610687	hsa-miR-3941	0	1
chr3:47008161\|47008364	hsa-miR-3941	0	1
chr19:18279891\|18280089	hsa-miR-3941	0	1
chr22:19435861\|19436015	hsa-miR-3941	0	1
chr22:19435724\|19435932	hsa-miR-3941	0	1
chr6:56508529\|56508714	hsa-miR-3941	0	1
chr15:75211038\|75211202	hsa-miR-3941	0	1
chr2:207763755\|207763959	hsa-miR-3941	0	1
chr20:25297408\|25297514	hsa-miR-3941	0	1
chrX:19084976\|19085154	hsa-miR-3941	0	1
chr12:125030849\|125030997	hsa-miR-3941	0	1
chr6:159778675\|159778769	hsa-miR-3941	0	1
chr3:119824935\|119825098	hsa-miR-3941	0	1
chrX:106928154\|106928525	hsa-miR-3941	0	1
chr2:46384950\|46385114	hsa-miR-3941	0	1
chr17:50381329\|50381516	hsa-miR-3941	0	1
chr1:225412466\|225412568	hsa-miR-3941	0	1
chr8:144106592\|144106898	hsa-miR-3941	0	1
chr12:7649408\|7649612	hsa-miR-3941	0	1
chr2:240620801\|240620983	hsa-miR-3941	0	1
chr1:23333535\|23333593	hsa-miR-3941	0	1
chr14:22926524\|22926781	hsa-miR-3941	0	1
chr5:176507742\|176507958	hsa-miR-3941	0	1
chr1:156067224\|156067361	hsa-miR-3941	0	1
chr2:113182598\|113182854	hsa-miR-3941	0	1
chr10:128106679\|128106886	hsa-miR-3941	0	1
chr14:100277583\|100277747	hsa-miR-3941	0	1
chr1:15939803\|15939978	hsa-miR-3941	0	1
chr1:225412459\|225412574	hsa-miR-3941	0	1
chr5:72219708\|72219948	hsa-miR-3941	0	1
chr9:121179456\|121179581	hsa-miR-3941	0	1
chrX:68841321\|68841514	hsa-miR-3941	0	1
chr19:7117026\|7117143	hsa-miR-3941	0	1
chr2:230819759\|230819873	hsa-miR-3941	0	1
chr17:7560935\|7561101	hsa-miR-3941	0	1
chr20:62124671\|62124780	hsa-miR-3941	0	1
chr19:56423594\|56423756	hsa-miR-3941	0	1
chrX:106930659\|106930788	hsa-miR-3941	0	1
chr16:72060756\|72060886	hsa-miR-3941	0	1
chr8:144106592\|144106963	hsa-miR-3941	0	1
chr6:159778675\|159778791	hsa-miR-3941	0	1
chr1:20652621\|20652896	hsa-miR-3941	0	1
chr19:42288972\|42289090	hsa-miR-3941	0	1
chr2:64386673\|64386816	hsa-miR-3941	0	1
chr14:24416681\|24416849	hsa-miR-3941	0	1
chr1:116989086\|116989314	hsa-miR-3941	0	1
chr9:92210633\|92210826	hsa-miR-3941	0	1
chr17:45108230\|45108367	hsa-miR-3941	0	1
chr11:77124190\|77124374	hsa-miR-3941	0	1
chr10:58397686\|58397792	hsa-miR-3941	0	1
chr9:92210622\|92210761	hsa-miR-3941	0	1
chr7:44708652\|44708752	hsa-miR-3941	0	1
chr22:36930184\|36930347	hsa-miR-3941	0	1
chr2:47070255\|47070420	hsa-miR-3941	0	1
chr16:1700641\|1700819	hsa-miR-3941	0	1
chr10:70879270\|70879481	hsa-miR-3941	0	1
chr1:15939769\|15939978	hsa-miR-3941	0	1
chr17:42521286\|42521434	hsa-miR-3941	0	1
chr17:4164749\|4164891	hsa-miR-3941	0	1
chr8:144106634\|144106963	hsa-miR-3941	0	1
chr2:218596097\|218596354	hsa-miR-3941	1	0
chr14:24118441\|24118804	hsa-miR-3941	1	0
chr1:225846462\|225846642	hsa-miR-3941	1	0
chr2:241745876\|241746037	hsa-miR-3941	1	0
chr5:134965843\|134966003	hsa-miR-3941	1	0

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-miR-3941	ANTXR2	ANTXR cell adhesion molecule 2	HGNC:21732	details
hsa-miR-3941	SERINC1	serine incorporator 1	HGNC:13464	details
hsa-miR-3941	SRSF1	serine and arginine rich splicing factor 1	HGNC:10780	details
hsa-miR-3941	PPP2R5E	protein phosphatase 2 regulatory subunit B'epsilon	HGNC:9313	details
hsa-miR-3941	PCBP1	poly(rC) binding protein 1	HGNC:8647	details
hsa-miR-3941	NR3C1	nuclear receptor subfamily 3 group C member 1	HGNC:7978	details
hsa-miR-3941	NAP1L1	nucleosome assembly protein 1 like 1	HGNC:7637	details
hsa-miR-3941	FAM177A1	family with sequence similarity 177 member A1	HGNC:19829	details
hsa-miR-3941	PNRC1	proline rich nuclear receptor coactivator 1	HGNC:17278	details
hsa-miR-3941	PPTC7	protein phosphatase targeting COQ7	HGNC:30695	details
hsa-miR-3941	ZNF780A	zinc finger protein 780A	HGNC:27603	details
hsa-miR-3941	TBPL1	TATA-box binding protein like 1	HGNC:11589	details
hsa-miR-3941	CLIC4	chloride intracellular channel 4	HGNC:13518	details
hsa-miR-3941	TSPAN2	tetraspanin 2	HGNC:20659	details
hsa-miR-3941	KCNK1	potassium two pore domain channel subfamily K member 1	HGNC:6272	details
hsa-miR-3941	CASD1	CAS1 domain containing 1	HGNC:16014	details
hsa-miR-3941	HHIP	hedgehog interacting protein	HGNC:14866	details
hsa-miR-3941	STARD8	StAR related lipid transfer domain containing 8	HGNC:19161	details
hsa-miR-3941	ZDHHC5	zinc finger DHHC-type palmitoyltransferase 5	HGNC:18472	details
hsa-miR-3941	KPNA4	karyopherin subunit alpha 4	HGNC:6397	details
hsa-miR-3941	KLHL23	kelch like family member 23	HGNC:27506	details
hsa-miR-3941	HMGB2	high mobility group box 2	HGNC:5000	details
hsa-miR-3941	CRK	CRK proto-oncogene, adaptor protein	HGNC:2362	details
hsa-miR-3941	ASB6	ankyrin repeat and SOCS box containing 6	HGNC:17181	details
hsa-miR-3941	RHOQ	ras homolog family member Q	HGNC:17736	details
hsa-miR-3941	LRRC63	leucine rich repeat containing 63	HGNC:34296	details
hsa-miR-3941	SLC35E3	solute carrier family 35 member E3	HGNC:20864	details
hsa-miR-3941	WDR72	WD repeat domain 72	HGNC:26790	details
hsa-miR-3941	CCT4	chaperonin containing TCP1 subunit 4	HGNC:1617	details
hsa-miR-3941	WDR17	WD repeat domain 17	HGNC:16661	details
hsa-miR-3941	TECRL	trans-2,3-enoyl-CoA reductase like	HGNC:27365	details
hsa-miR-3941	AJAP1	adherens junctions associated protein 1	HGNC:30801	details
hsa-miR-3941	DBT	dihydrolipoamide branched chain transacylase E2	HGNC:2698	details
hsa-miR-3941	PIK3CG	phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma	HGNC:8978	details
hsa-miR-3941	ZC3H6	zinc finger CCCH-type containing 6	HGNC:24762	details
hsa-miR-3941	VENTX	VENT homeobox	HGNC:13639	details
hsa-miR-3941	SCIN	scinderin	HGNC:21695	details
hsa-miR-3941	AGPS	alkylglycerone phosphate synthase	HGNC:327	details
hsa-miR-3941	CD180	CD180 molecule	HGNC:6726	details
hsa-miR-3941	ZMYM2	zinc finger MYM-type containing 2	HGNC:12989	details
hsa-miR-3941	ZBTB20	zinc finger and BTB domain containing 20	HGNC:13503	details
hsa-miR-3941	UCHL3	ubiquitin C-terminal hydrolase L3	HGNC:12515	details
hsa-miR-3941	PLRG1	pleiotropic regulator 1	HGNC:9089	details
hsa-miR-3941	PLAG1	PLAG1 zinc finger	HGNC:9045	details
hsa-miR-3941	PIK3R1	phosphoinositide-3-kinase regulatory subunit 1	HGNC:8979	details
hsa-miR-3941	PIAS1	protein inhibitor of activated STAT 1	HGNC:2752	details
hsa-miR-3941	PHAX	phosphorylated adaptor for RNA export	HGNC:10241	details
hsa-miR-3941	PDCD10	programmed cell death 10	HGNC:8761	details
hsa-miR-3941	NR2C2	nuclear receptor subfamily 2 group C member 2	HGNC:7972	details
hsa-miR-3941	MON1B	MON1 homolog B, secretory trafficking associated	HGNC:25020	details
hsa-miR-3941	LONRF3	LON peptidase N-terminal domain and ring finger 3	HGNC:21152	details
hsa-miR-3941	NEXMIF	neurite extension and migration factor	HGNC:29433	details
hsa-miR-3941	INTU	inturned planar cell polarity protein	HGNC:29239	details
hsa-miR-3941	IL6ST	interleukin 6 cytokine family signal transducer	HGNC:6021	details
hsa-miR-3941	FBXO9	F-box protein 9	HGNC:13588	details
hsa-miR-3941	EIF5	eukaryotic translation initiation factor 5	HGNC:3299	details
hsa-miR-3941	CFL2	cofilin 2	HGNC:1875	details
hsa-miR-3941	BRMS1L	BRMS1 like transcriptional repressor	HGNC:20512	details
hsa-miR-3941	BRIX1	biogenesis of ribosomes BRX1	HGNC:24170	details
hsa-miR-3941	BRI3BP	BRI3 binding protein	HGNC:14251	details
hsa-miR-3941	BACH1	BTB domain and CNC homolog 1	HGNC:935	details
hsa-miR-3941	ANKRD44	ankyrin repeat domain 44	HGNC:25259	details
hsa-miR-3941	CCDC169	coiled-coil domain containing 169	HGNC:34361	details
hsa-miR-3941	IL5RA	interleukin 5 receptor subunit alpha	HGNC:6017	details
hsa-miR-3941	HAT1	histone acetyltransferase 1	HGNC:4821	details
hsa-miR-3941	IGBP1	immunoglobulin binding protein 1	HGNC:5461	details
hsa-miR-3941	ART4	ADP-ribosyltransferase 4 (inactive) (Dombrock blood group)	HGNC:726	details
hsa-miR-3941	WAPL	WAPL cohesin release factor	HGNC:23293	details
hsa-miR-3941	VANGL1	VANGL planar cell polarity protein 1	HGNC:15512	details
hsa-miR-3941	TRPC5	transient receptor potential cation channel subfamily C member 5	HGNC:12337	details
hsa-miR-3941	TATDN2	TatD DNase domain containing 2	HGNC:28988	details
hsa-miR-3941	ESYT2	extended synaptotagmin 2	HGNC:22211	details
hsa-miR-3941	DYRK2	dual specificity tyrosine phosphorylation regulated kinase 2	HGNC:3093	details
hsa-miR-3941				details
hsa-miR-3941	BMP2K	BMP2 inducible kinase	HGNC:18041	details
hsa-miR-3941	CD19	CD19 molecule	HGNC:1633	details
hsa-miR-3941	DNTTIP2	deoxynucleotidyltransferase terminal interacting protein 2	HGNC:24013	details
hsa-miR-3941	LILRB2	leukocyte immunoglobulin like receptor B2	HGNC:6606	details
hsa-miR-3941	ABHD18	abhydrolase domain containing 18	HGNC:26111	details
hsa-miR-3941	OCLN	occludin	HGNC:8104	details
hsa-miR-3941	NLRP8	NLR family pyrin domain containing 8	HGNC:22940	details
hsa-miR-3941	TBRG4	transforming growth factor beta regulator 4	HGNC:17443	details
hsa-miR-3941	STRBP	spermatid perinuclear RNA binding protein	HGNC:16462	details
hsa-miR-3941	MYADM	myeloid associated differentiation marker	HGNC:7544	details
hsa-miR-3941	ARF3	ADP ribosylation factor 3	HGNC:654	details
hsa-miR-3941	PELP1	proline, glutamate and leucine rich protein 1	HGNC:30134	details
hsa-miR-3941				details
hsa-miR-3941	DMXL1	Dmx like 1	HGNC:2937	details
hsa-miR-3941	IRS1	insulin receptor substrate 1	HGNC:6125	details
hsa-miR-3941	VAC14	VAC14 component of PIKFYVE complex	HGNC:25507	details
hsa-miR-3941	TFCP2	transcription factor CP2	HGNC:11748	details
hsa-miR-3941	SLC6A6	solute carrier family 6 member 6	HGNC:11052	details
hsa-miR-3941	CYLD	CYLD lysine 63 deubiquitinase	HGNC:2584	details
hsa-miR-3941	LAMTOR3	late endosomal/lysosomal adaptor, MAPK and MTOR activator 3	HGNC:15606	details
hsa-miR-3941	UGT2B4	UDP glucuronosyltransferase family 2 member B4	HGNC:12553	details
hsa-miR-3941	ZNF551	zinc finger protein 551	HGNC:25108	details
hsa-miR-3941	SLC12A2	solute carrier family 12 member 2	HGNC:10911	details
hsa-miR-3941	NDUFS1	NADH:ubiquinone oxidoreductase core subunit S1	HGNC:7707	details
hsa-miR-3941	SPTLC2	serine palmitoyltransferase long chain base subunit 2	HGNC:11278	details
hsa-miR-3941	WDR26	WD repeat domain 26	HGNC:21208	details
hsa-miR-3941	TAOK1	TAO kinase 1	HGNC:29259	details
hsa-miR-3941	CCND1	cyclin D1	HGNC:1582	details
hsa-miR-3941	ASH1L	ASH1 like histone lysine methyltransferase	HGNC:19088	details
hsa-miR-3941	NUP37	nucleoporin 37	HGNC:29929	details
hsa-miR-3941	RHCG	Rh family C glycoprotein	HGNC:18140	details
hsa-miR-3941	CLEC12A	C-type lectin domain family 12 member A	HGNC:31713	details
hsa-miR-3941	PLCXD1	phosphatidylinositol specific phospholipase C X domain containing 1	HGNC:23148	details
hsa-miR-3941	OPN5	opsin 5	HGNC:19992	details
hsa-miR-3941	POT1	protection of telomeres 1	HGNC:17284	details
hsa-miR-3941	ZNF678	zinc finger protein 678	HGNC:28652	details
hsa-miR-3941	UBTF	upstream binding transcription factor	HGNC:12511	details
hsa-miR-3941	RASSF6	Ras association domain family member 6	HGNC:20796	details
hsa-miR-3941	MESD	mesoderm development LRP chaperone	HGNC:13520	details
hsa-miR-3941	ZNF562	zinc finger protein 562	HGNC:25950	details
hsa-miR-3941	ZIC5	Zic family member 5	HGNC:20322	details
hsa-miR-3941	YY1	YY1 transcription factor	HGNC:12856	details
hsa-miR-3941	VEGFA	vascular endothelial growth factor A	HGNC:12680	details
hsa-miR-3941	TRAF5	TNF receptor associated factor 5	HGNC:12035	details
hsa-miR-3941	TNRC6B	trinucleotide repeat containing adaptor 6B	HGNC:29190	details
hsa-miR-3941	TIMM10	translocase of inner mitochondrial membrane 10	HGNC:11814	details
hsa-miR-3941	SV2B	synaptic vesicle glycoprotein 2B	HGNC:16874	details
hsa-miR-3941	SFXN5	sideroflexin 5	HGNC:16073	details
hsa-miR-3941	PHF13	PHD finger protein 13	HGNC:22983	details
hsa-miR-3941				details
hsa-miR-3941	KCNJ3	potassium inwardly rectifying channel subfamily J member 3	HGNC:6264	details
hsa-miR-3941	FKBP14	FKBP prolyl isomerase 14	HGNC:18625	details
hsa-miR-3941	DIDO1	death inducer-obliterator 1	HGNC:2680	details
hsa-miR-3941	BLOC1S4	biogenesis of lysosomal organelles complex 1 subunit 4	HGNC:24206	details
hsa-miR-3941	BAG4	BAG cochaperone 4	HGNC:940	details
hsa-miR-3941	ARF6	ADP ribosylation factor 6	HGNC:659	details
hsa-miR-3941	AMMECR1	AMMECR nuclear protein 1	HGNC:467	details
hsa-miR-3941	RAB1A	RAB1A, member RAS oncogene family	HGNC:9758	details
hsa-miR-3941	ANKRD40	ankyrin repeat domain 40	HGNC:28233	details
hsa-miR-3941	KCNC4	potassium voltage-gated channel subfamily C member 4	HGNC:6236	details
hsa-miR-3941	GRPEL2	GrpE like 2, mitochondrial	HGNC:21060	details
hsa-miR-3941	EIF1AX	eukaryotic translation initiation factor 1A X-linked	HGNC:3250	details
hsa-miR-3941	C9orf78	chromosome 9 open reading frame 78	HGNC:24932	details
hsa-miR-3941	CPSF6	cleavage and polyadenylation specific factor 6	HGNC:13871	details
hsa-miR-3941	PHKA1	phosphorylase kinase regulatory subunit alpha 1	HGNC:8925	details
hsa-miR-3941				details
hsa-miR-3941	IL1RAPL1	interleukin 1 receptor accessory protein like 1	HGNC:5996	details
hsa-miR-3941	MCTS1	MCTS1 re-initiation and release factor	HGNC:23357	details
hsa-miR-3941	CACUL1	CDK2 associated cullin domain 1	HGNC:23727	details
hsa-miR-3941	SYT2	synaptotagmin 2	HGNC:11510	details
hsa-miR-3941	ZXDA	zinc finger X-linked duplicated A	HGNC:13198	details
hsa-miR-3941	UNC5B	unc-5 netrin receptor B	HGNC:12568	details
hsa-miR-3941	NFAT5	nuclear factor of activated T cells 5	HGNC:7774	details
hsa-miR-3941	PTP4A2	protein tyrosine phosphatase 4A2	HGNC:9635	details
hsa-miR-3941	KIF5C	kinesin family member 5C	HGNC:6325	details
hsa-miR-3941				details
hsa-miR-3941	MUC15	mucin 15, cell surface associated	HGNC:14956	details
hsa-miR-3941	MED28	mediator complex subunit 28	HGNC:24628	details
hsa-miR-3941	PRKX	protein kinase X-linked	HGNC:9441	details
hsa-miR-3941	GLCCI1	glucocorticoid induced 1	HGNC:18713	details
hsa-miR-3941	BUB1	BUB1 mitotic checkpoint serine/threonine kinase	HGNC:1148	details
hsa-miR-3941				details
hsa-miR-3941	FIG4	FIG4 phosphoinositide 5-phosphatase	HGNC:16873	details
hsa-miR-3941	REEP3	receptor accessory protein 3	HGNC:23711	details
hsa-miR-3941	FAM216B	family with sequence similarity 216 member B	HGNC:26883	details
hsa-miR-3941	WNT9A	Wnt family member 9A	HGNC:12778	details
hsa-miR-3941				details
hsa-miR-3941	FAM126B	family with sequence similarity 126 member B	HGNC:28593	details
hsa-miR-3941	DONSON	DNA replication fork stabilization factor DONSON	HGNC:2993	details
hsa-miR-3941	ABCF3	ATP binding cassette subfamily F member 3	HGNC:72	details
hsa-miR-3941	NECAB1	N-terminal EF-hand calcium binding protein 1	HGNC:20983	details
hsa-miR-3941	TBX4	T-box transcription factor 4	HGNC:11603	details
hsa-miR-3941	KCNB1	potassium voltage-gated channel subfamily B member 1	HGNC:6231	details
hsa-miR-3941	CLEC14A	C-type lectin domain containing 14A	HGNC:19832	details
hsa-miR-3941	ZMAT4	zinc finger matrin-type 4	HGNC:25844	details
hsa-miR-3941	NSUN3	NOP2/Sun RNA methyltransferase 3	HGNC:26208	details
hsa-miR-3941	LNPEP	leucyl and cystinyl aminopeptidase	HGNC:6656	details
hsa-miR-3941	ITGBL1	integrin subunit beta like 1	HGNC:6164	details
hsa-miR-3941	FGF9	fibroblast growth factor 9	HGNC:3687	details
hsa-miR-3941	ZBTB42	zinc finger and BTB domain containing 42	HGNC:32550	details
hsa-miR-3941	UGT8	UDP glycosyltransferase 8	HGNC:12555	details
hsa-miR-3941	EHD2	EH domain containing 2	HGNC:3243	details
hsa-miR-3941	BHLHE40	basic helix-loop-helix family member e40	HGNC:1046	details
hsa-miR-3941	VAPB	VAMP associated protein B and C	HGNC:12649	details
hsa-miR-3941	CD2AP	CD2 associated protein	HGNC:14258	details
hsa-miR-3941	ASAH2B	N-acylsphingosine amidohydrolase 2B	HGNC:23456	details
hsa-miR-3941	WNT7A	Wnt family member 7A	HGNC:12786	details
hsa-miR-3941	SMIM15	small integral membrane protein 15	HGNC:33861	details
hsa-miR-3941	NUDT3	nudix hydrolase 3	HGNC:8050	details
hsa-miR-3941	ZNF610	zinc finger protein 610	HGNC:26687	details
hsa-miR-3941	ZNF415	zinc finger protein 415	HGNC:20636	details
hsa-miR-3941	TAS2R30	taste 2 receptor member 30	HGNC:19112	details
hsa-miR-3941	SOD2	superoxide dismutase 2	HGNC:11180	details
hsa-miR-3941	PHEX	phosphate regulating endopeptidase homolog X-linked	HGNC:8918	details
hsa-miR-3941	CHEK1	checkpoint kinase 1	HGNC:1925	details
hsa-miR-3941	CCDC160	coiled-coil domain containing 160	HGNC:37286	details
hsa-miR-3941	ADAM9	ADAM metallopeptidase domain 9	HGNC:216	details
hsa-miR-3941	DNAJC19	DnaJ heat shock protein family (Hsp40) member C19	HGNC:30528	details
hsa-miR-3941	TIGIT	T cell immunoreceptor with Ig and ITIM domains	HGNC:26838	details
hsa-miR-3941				details
hsa-miR-3941	TSPAN14	tetraspanin 14	HGNC:23303	details
hsa-miR-3941	ZDHHC17	zinc finger DHHC-type palmitoyltransferase 17	HGNC:18412	details
hsa-miR-3941	MACC1	MET transcriptional regulator MACC1	HGNC:30215	details
hsa-miR-3941	SLC23A3	solute carrier family 23 member 3	HGNC:20601	details
hsa-miR-3941	LILRB1	leukocyte immunoglobulin like receptor B1	HGNC:6605	details
hsa-miR-3941	MED24	mediator complex subunit 24	HGNC:22963	details
hsa-miR-3941	RNF121	ring finger protein 121	HGNC:21070	details
hsa-miR-3941	KRTAP4-9	keratin associated protein 4-9	HGNC:18910	details
hsa-miR-3941	SPATA13	spermatogenesis associated 13	HGNC:23222	details
hsa-miR-3941	CD99	CD99 molecule (Xg blood group)	HGNC:7082	details
hsa-miR-3941	B3GALT5	beta-1,3-galactosyltransferase 5	HGNC:920	details
hsa-miR-3941				details
hsa-miR-3941	LANCL3	LanC like 3	HGNC:24767	details
hsa-miR-3941	SLC35B4	solute carrier family 35 member B4	HGNC:20584	details
hsa-miR-3941	GRIPAP1	GRIP1 associated protein 1	HGNC:18706	details
hsa-miR-3941				details
hsa-miR-3941	AKAP2	A-kinase anchoring protein 2	HGNC:372	details
hsa-miR-3941	CSMD2	CUB and Sushi multiple domains 2	HGNC:19290	details
hsa-miR-3941	FOXP4	forkhead box P4	HGNC:20842	details
hsa-miR-3941	ZNF670	zinc finger protein 670	HGNC:28167	details
hsa-miR-3941	GPX6	glutathione peroxidase 6	HGNC:4558	details
hsa-miR-3941	ARNT	aryl hydrocarbon receptor nuclear translocator	HGNC:700	details
hsa-miR-3941	CHST15	carbohydrate sulfotransferase 15	HGNC:18137	details
hsa-miR-3941	RDX	radixin	HGNC:9944	details
hsa-miR-3941	GNA14	G protein subunit alpha 14	HGNC:4382	details
hsa-miR-3941	FASLG	Fas ligand	HGNC:11936	details
hsa-miR-3941	PHF8	PHD finger protein 8	HGNC:20672	details
hsa-miR-3941	CA8	carbonic anhydrase 8	HGNC:1382	details
hsa-miR-3941	USF3	upstream transcription factor family member 3	HGNC:30494	details
hsa-miR-3941	ZNF431	zinc finger protein 431	HGNC:20809	details
hsa-miR-3941	LRP8	LDL receptor related protein 8	HGNC:6700	details
hsa-miR-3941	DDB1	damage specific DNA binding protein 1	HGNC:2717	details
hsa-miR-3941	ZNF428	zinc finger protein 428	HGNC:20804	details
hsa-miR-3941	CLEC4D	C-type lectin domain family 4 member D	HGNC:14554	details
hsa-miR-3941	PRSS23	serine protease 23	HGNC:14370	details
hsa-miR-3941	TBCK	TBC1 domain containing kinase	HGNC:28261	details
hsa-miR-3941	CACNG8	calcium voltage-gated channel auxiliary subunit gamma 8	HGNC:13628	details
hsa-miR-3941	ICAM1	intercellular adhesion molecule 1	HGNC:5344	details
hsa-miR-3941	SLC5A7	solute carrier family 5 member 7	HGNC:14025	details
hsa-miR-3941	MAPK6	mitogen-activated protein kinase 6	HGNC:6879	details
hsa-miR-3941	HEMGN	hemogen	HGNC:17509	details
hsa-miR-3941	NDRG4	NDRG family member 4	HGNC:14466	details
hsa-miR-3941	CEP135	centrosomal protein 135	HGNC:29086	details
hsa-miR-3941	TCF15	transcription factor 15	HGNC:11627	details
hsa-miR-3941	TMOD2	tropomodulin 2	HGNC:11872	details
hsa-miR-3941	TCTE1	t-complex-associated-testis-expressed 1	HGNC:11693	details
hsa-miR-3941	PPARGC1B	PPARG coactivator 1 beta	HGNC:30022	details
hsa-miR-3941	TSPAN1	tetraspanin 1	HGNC:20657	details
hsa-miR-3941	NCOA3	nuclear receptor coactivator 3	HGNC:7670	details
hsa-miR-3941	MLXIP	MLX interacting protein	HGNC:17055	details
hsa-miR-3941	KLHL42	kelch like family member 42	HGNC:29252	details
hsa-miR-3941	KLHL3	kelch like family member 3	HGNC:6354	details
hsa-miR-3941	KCNJ12	potassium inwardly rectifying channel subfamily J member 12	HGNC:6258	details
hsa-miR-3941	IGF1R	insulin like growth factor 1 receptor	HGNC:5465	details
hsa-miR-3941	GPRIN3	GPRIN family member 3	HGNC:27733	details
hsa-miR-3941	GCK	glucokinase	HGNC:4195	details
hsa-miR-3941	GID4	GID complex subunit 4 homolog	HGNC:28453	details
hsa-miR-3941	GEMIN6	gem nuclear organelle associated protein 6	HGNC:20044	details
hsa-miR-3941	SRCAP	Snf2 related CREBBP activator protein	HGNC:16974	details
hsa-miR-3941	CDK6	cyclin dependent kinase 6	HGNC:1777	details
hsa-miR-3941	BAMBI	BMP and activin membrane bound inhibitor	HGNC:30251	details
hsa-miR-3941	ARL6IP6	ADP ribosylation factor like GTPase 6 interacting protein 6	HGNC:24048	details
hsa-miR-3941	ADAMTS4	ADAM metallopeptidase with thrombospondin type 1 motif 4	HGNC:220	details
hsa-miR-3941	LYRM7	LYR motif containing 7	HGNC:28072	details
hsa-miR-3941	DUSP18	dual specificity phosphatase 18	HGNC:18484	details
hsa-miR-3941	IKBKG	inhibitor of nuclear factor kappa B kinase regulatory subunit gamma	HGNC:5961	details
hsa-miR-3941	MTPN	myotrophin	HGNC:15667	details
hsa-miR-3941	CBY3	chibby family member 3	HGNC:33278	details
hsa-miR-3941	TMEM51	transmembrane protein 51	HGNC:25488	details
hsa-miR-3941	CRB2	crumbs cell polarity complex component 2	HGNC:18688	details
hsa-miR-3941	PRRG3	proline rich and Gla domain 3	HGNC:30798	details
hsa-miR-3941	WSCD2	WSC domain containing 2	HGNC:29117	details
hsa-miR-3941	TMEM78	transmembrane protein 78	HGNC:32307	details
hsa-miR-3941	LARP4B	La ribonucleoprotein 4B	HGNC:28987	details
hsa-miR-3941	FGFBP3	fibroblast growth factor binding protein 3	HGNC:23428	details
hsa-miR-3941	STK36	serine/threonine kinase 36	HGNC:17209	details
hsa-miR-3941	C1orf216	chromosome 1 open reading frame 216	HGNC:26800	details
hsa-miR-3941	METTL16	methyltransferase 16, N6-methyladenosine	HGNC:28484	details
hsa-miR-3941	SLCO1B3	solute carrier organic anion transporter family member 1B3	HGNC:10961	details
hsa-miR-3941	HLF	HLF transcription factor, PAR bZIP family member	HGNC:4977	details
hsa-miR-3941				details
hsa-miR-3941	SLC22A4	solute carrier family 22 member 4	HGNC:10968	details
hsa-miR-3941	TWIST1	twist family bHLH transcription factor 1	HGNC:12428	details
hsa-miR-3941	SLC7A11	solute carrier family 7 member 11	HGNC:11059	details
hsa-miR-3941	SLC44A1	solute carrier family 44 member 1	HGNC:18798	details
hsa-miR-3941	SEMA4C	semaphorin 4C	HGNC:10731	details
hsa-miR-3941	RAPGEF1	Rap guanine nucleotide exchange factor 1	HGNC:4568	details
hsa-miR-3941	PARD3B	par-3 family cell polarity regulator beta	HGNC:14446	details
hsa-miR-3941	DCP2	decapping mRNA 2	HGNC:24452	details
hsa-miR-3941	B4GALT5	beta-1,4-galactosyltransferase 5	HGNC:928	details
hsa-miR-3941	ATXN3	ataxin 3	HGNC:7106	details
hsa-miR-3941	ASCC1	activating signal cointegrator 1 complex subunit 1	HGNC:24268	details
hsa-miR-3941	SMCHD1	structural maintenance of chromosomes flexible hinge domain containing 1	HGNC:29090	details
hsa-miR-3941	ABCC6	ATP binding cassette subfamily C member 6	HGNC:57	details
hsa-miR-3941	AGO3	argonaute RISC catalytic component 3	HGNC:18421	details
hsa-miR-3941	MEF2D	myocyte enhancer factor 2D	HGNC:6997	details
hsa-miR-3941	KYNU	kynureninase	HGNC:6469	details
hsa-miR-3941	ARPC1B	actin related protein 2/3 complex subunit 1B	HGNC:704	details
hsa-miR-3941	SYTL4	synaptotagmin like 4	HGNC:15588	details
hsa-miR-3941				details
hsa-miR-3941	AKAIN1	A-kinase anchor inhibitor 1	HGNC:28285	details
hsa-miR-3941	TANK	TRAF family member associated NFKB activator	HGNC:11562	details
hsa-miR-3941	LPAR3	lysophosphatidic acid receptor 3	HGNC:14298	details
hsa-miR-3941	LFNG	LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	HGNC:6560	details
hsa-miR-3941	ATP2A2	ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2	HGNC:812	details
hsa-miR-3941	CCDC174	coiled-coil domain containing 174	HGNC:28033	details
hsa-miR-3941	NMRK1	nicotinamide riboside kinase 1	HGNC:26057	details
hsa-miR-3941	QSOX2	quiescin sulfhydryl oxidase 2	HGNC:30249	details
hsa-miR-3941	NPBWR1	neuropeptides B and W receptor 1	HGNC:4522	details
hsa-miR-3941	ATG10	autophagy related 10	HGNC:20315	details
hsa-miR-3941	CLSTN3	calsyntenin 3	HGNC:18371	details
hsa-miR-3941	STX1B	syntaxin 1B	HGNC:18539	details
hsa-miR-3941	TIMM8A	translocase of inner mitochondrial membrane 8A	HGNC:11817	details
hsa-miR-3941	SS18	SS18 subunit of BAF chromatin remodeling complex	HGNC:11340	details
hsa-miR-3941	SPOPL	speckle type BTB/POZ protein like	HGNC:27934	details
hsa-miR-3941	SPOCK2	SPARC (osteonectin), cwcv and kazal like domains proteoglycan 2	HGNC:13564	details
hsa-miR-3941	SLITRK4	SLIT and NTRK like family member 4	HGNC:23502	details
hsa-miR-3941	SLC36A1	solute carrier family 36 member 1	HGNC:18761	details
hsa-miR-3941	SGIP1	SH3GL interacting endocytic adaptor 1	HGNC:25412	details
hsa-miR-3941	SCN4A	sodium voltage-gated channel alpha subunit 4	HGNC:10591	details
hsa-miR-3941	RAP2B	RAP2B, member of RAS oncogene family	HGNC:9862	details
hsa-miR-3941	PTPN3	protein tyrosine phosphatase non-receptor type 3	HGNC:9655	details
hsa-miR-3941	PAX3	paired box 3	HGNC:8617	details
hsa-miR-3941	PAG1	phosphoprotein membrane anchor with glycosphingolipid microdomains 1	HGNC:30043	details
hsa-miR-3941	NFATC2	nuclear factor of activated T cells 2	HGNC:7776	details
hsa-miR-3941	MATN1	matrilin 1	HGNC:6907	details
hsa-miR-3941	DDHD1	DDHD domain containing 1	HGNC:19714	details
hsa-miR-3941	CTTNBP2NL	CTTNBP2 N-terminal like	HGNC:25330	details
hsa-miR-3941	ATXN7L3B	ataxin 7 like 3B	HGNC:37931	details
hsa-miR-3941	MICA	MHC class I polypeptide-related sequence A	HGNC:7090	details
hsa-miR-3941	GNAI1	G protein subunit alpha i1	HGNC:4384	details
hsa-miR-3941	CEP162	centrosomal protein 162	HGNC:21107	details
hsa-miR-3941	CHRFAM7A	CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion	HGNC:15781	details
hsa-miR-3941	TUBD1	tubulin delta 1	HGNC:16811	details
hsa-miR-3941	SLC1A4	solute carrier family 1 member 4	HGNC:10942	details
hsa-miR-3941	EGR3	early growth response 3	HGNC:3240	details
hsa-miR-3941	KIF13A	kinesin family member 13A	HGNC:14566	details
hsa-miR-3941	WDR3	WD repeat domain 3	HGNC:12755	details
hsa-miR-3941	TOB2	transducer of ERBB2, 2	HGNC:11980	details
hsa-miR-3941	RTF1	RTF1 homolog, Paf1/RNA polymerase II complex component	HGNC:28996	details
hsa-miR-3941	LMX1A	LIM homeobox transcription factor 1 alpha	HGNC:6653	details
hsa-miR-3941	ELK1	ETS transcription factor ELK1	HGNC:3321	details
hsa-miR-3941	GDNF	glial cell derived neurotrophic factor	HGNC:4232	details
hsa-miR-3941	FOXL1	forkhead box L1	HGNC:3817	details
hsa-miR-3941	ZDHHC21	zinc finger DHHC-type palmitoyltransferase 21	HGNC:20750	details
hsa-miR-3941	SP1	Sp1 transcription factor	HGNC:11205	details
hsa-miR-3941	PLEKHA2	pleckstrin homology domain containing A2	HGNC:14336	details
hsa-miR-3941				details
hsa-miR-3941	BMP10	bone morphogenetic protein 10	HGNC:20869	details
hsa-miR-3941	NPTXR	neuronal pentraxin receptor	HGNC:7954	details
hsa-miR-3941	ADCYAP1R1	ADCYAP receptor type I	HGNC:242	details
hsa-miR-3941	FSIP2	fibrous sheath interacting protein 2	HGNC:21675	details
hsa-miR-3941	DOK6	docking protein 6	HGNC:28301	details
hsa-miR-3941	CSRNP3	cysteine and serine rich nuclear protein 3	HGNC:30729	details
hsa-miR-3941	CCDC149	coiled-coil domain containing 149	HGNC:25405	details
hsa-miR-3941	ZFP1	ZFP1 zinc finger protein	HGNC:23328	details
hsa-miR-3941	BEX4	brain expressed X-linked 4	HGNC:25475	details
hsa-miR-3941	TIPRL	TOR signaling pathway regulator	HGNC:30231	details
hsa-miR-3941	SLC22A1	solute carrier family 22 member 1	HGNC:10963	details
hsa-miR-3941	CBX3	chromobox 3	HGNC:1553	details
hsa-miR-3941	AGAP1	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	HGNC:16922	details
hsa-miR-3941	FHOD1	formin homology 2 domain containing 1	HGNC:17905	details
hsa-miR-3941	ZKSCAN4	zinc finger with KRAB and SCAN domains 4	HGNC:13854	details
hsa-miR-3941	UBE2H	ubiquitin conjugating enzyme E2 H	HGNC:12484	details
hsa-miR-3941	NACC1	nucleus accumbens associated 1	HGNC:20967	details
hsa-miR-3941	KCNA4	potassium voltage-gated channel subfamily A member 4	HGNC:6222	details
hsa-miR-3941	JPH2	junctophilin 2	HGNC:14202	details
hsa-miR-3941	GABPB1	GA binding protein transcription factor subunit beta 1	HGNC:4074	details
hsa-miR-3941	BSN	bassoon presynaptic cytomatrix protein	HGNC:1117	details
hsa-miR-3941	SYT17	synaptotagmin 17	HGNC:24119	details
hsa-miR-3941	WNK3	WNK lysine deficient protein kinase 3	HGNC:14543	details
hsa-miR-3941	RIMS3	regulating synaptic membrane exocytosis 3	HGNC:21292	details
hsa-miR-3941	PTBP3	polypyrimidine tract binding protein 3	HGNC:10253	details
hsa-miR-3941	PCNX1	pecanex 1	HGNC:19740	details
hsa-miR-3941	MVB12B	multivesicular body subunit 12B	HGNC:23368	details
hsa-miR-3941	TNFSF4	TNF superfamily member 4	HGNC:11934	details
hsa-miR-3941	CISD2	CDGSH iron sulfur domain 2	HGNC:24212	details
hsa-miR-3941	NDUFS2	NADH:ubiquinone oxidoreductase core subunit S2	HGNC:7708	details
hsa-miR-3941	TMEM79	transmembrane protein 79	HGNC:28196	details
hsa-miR-3941				details
hsa-miR-3941	DENND2C	DENN domain containing 2C	HGNC:24748	details
hsa-miR-3941	CACFD1	calcium channel flower domain containing 1	HGNC:1365	details
hsa-miR-3941	LSM14A	LSM14A mRNA processing body assembly factor	HGNC:24489	details
hsa-miR-3941	TMPPE	transmembrane protein with metallophosphoesterase domain	HGNC:33865	details
hsa-miR-3941	PCDH7	protocadherin 7	HGNC:8659	details
hsa-miR-3941	ELOF1	elongation factor 1	HGNC:28691	details
hsa-miR-3941	ASS1	argininosuccinate synthase 1	HGNC:758	details
hsa-miR-3941	RABGAP1	RAB GTPase activating protein 1	HGNC:17155	details
hsa-miR-3941	CRLS1	cardiolipin synthase 1	HGNC:16148	details
hsa-miR-3941	MC2R	melanocortin 2 receptor	HGNC:6930	details
hsa-miR-3941	F2RL1	F2R like trypsin receptor 1	HGNC:3538	details
hsa-miR-3941	PEAK1	pseudopodium enriched atypical kinase 1	HGNC:29431	details
hsa-miR-3941	MGAT5	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase	HGNC:7049	details
hsa-miR-3941	MOBP	myelin associated oligodendrocyte basic protein	HGNC:7189	details
hsa-miR-3941	COBLL1	cordon-bleu WH2 repeat protein like 1	HGNC:23571	details
hsa-miR-3941				details
hsa-miR-3941	ALDH1A3	aldehyde dehydrogenase 1 family member A3	HGNC:409	details
hsa-miR-3941	PAK6	p21 (RAC1) activated kinase 6	HGNC:16061	details
hsa-miR-3941	RNMT	RNA guanine-7 methyltransferase	HGNC:10075	details
hsa-miR-3941	GPR21	G protein-coupled receptor 21	HGNC:4476	details
hsa-miR-3941	STAM	signal transducing adaptor molecule	HGNC:11357	details
hsa-miR-3941	SIK3	SIK family kinase 3	HGNC:29165	details
hsa-miR-3941	NBPF10	NBPF member 10	HGNC:31992	details
hsa-miR-3941	CALHM5	calcium homeostasis modulator family member 5	HGNC:21568	details
hsa-miR-3941	WDTC1	WD and tetratricopeptide repeats 1	HGNC:29175	details
hsa-miR-3941	CHAF1B	chromatin assembly factor 1 subunit B	HGNC:1911	details
hsa-miR-3941	ADAMTS9	ADAM metallopeptidase with thrombospondin type 1 motif 9	HGNC:13202	details
hsa-miR-3941				details
hsa-miR-3941	FAM47E-STBD1	FAM47E-STBD1 readthrough	HGNC:44667	details
hsa-miR-3941	ZBED3	zinc finger BED-type containing 3	HGNC:20711	details
hsa-miR-3941	STYX	serine/threonine/tyrosine interacting protein	HGNC:11447	details
hsa-miR-3941	SRGAP2	SLIT-ROBO Rho GTPase activating protein 2	HGNC:19751	details
hsa-miR-3941	SNRK	SNF related kinase	HGNC:30598	details
hsa-miR-3941	PAPPA	pappalysin 1	HGNC:8602	details
hsa-miR-3941	MTF1	metal regulatory transcription factor 1	HGNC:7428	details
hsa-miR-3941	GREB1L	GREB1 like retinoic acid receptor coactivator	HGNC:31042	details
hsa-miR-3941				details
hsa-miR-3941	C18orf32	chromosome 18 open reading frame 32	HGNC:31690	details
hsa-miR-3941	B4GALT6	beta-1,4-galactosyltransferase 6	HGNC:929	details
hsa-miR-3941	RAD54L2	RAD54 like 2	HGNC:29123	details
hsa-miR-3941	SPCS2	signal peptidase complex subunit 2	HGNC:28962	details
hsa-miR-3941	PPP1CB	protein phosphatase 1 catalytic subunit beta	HGNC:9282	details
hsa-miR-3941	SORBS3	sorbin and SH3 domain containing 3	HGNC:30907	details
hsa-miR-3941	GRIN2A	glutamate ionotropic receptor NMDA type subunit 2A	HGNC:4585	details
hsa-miR-3941	RAPH1	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	HGNC:14436	details
hsa-miR-3941	RBM41	RNA binding motif protein 41	HGNC:25617	details
hsa-miR-3941	NUP205	nucleoporin 205	HGNC:18658	details
hsa-miR-3941	SYNRG	synergin gamma	HGNC:557	details
hsa-miR-3941	PPARGC1A	PPARG coactivator 1 alpha	HGNC:9237	details
hsa-miR-3941	LMNB2	lamin B2	HGNC:6638	details
hsa-miR-3941	SBF1	SET binding factor 1	HGNC:10542	details
hsa-miR-3941	SF1	splicing factor 1	HGNC:12950	details
hsa-miR-3941	TRMT112	tRNA methyltransferase activator subunit 11-2	HGNC:26940	details
hsa-miR-3941	EAF1	ELL associated factor 1	HGNC:20907	details
hsa-miR-3941	ETFDH	electron transfer flavoprotein dehydrogenase	HGNC:3483	details
hsa-miR-3941	FOXL2NB	FOXL2 neighbor	HGNC:34428	details
hsa-miR-3941	AKAP11	A-kinase anchoring protein 11	HGNC:369	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)