CircNet

miRNA General Information

Basic
Network

miRNA ID	hsa-miR-3973
Description	Homo sapiens miR-3973 stem-loop
Comment	None
Experiment	Illumina [1]
Sequence	ACAAAGUACAGCAUUAGCCUUAG

miRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan
chr16:2759569\|2759661	hsa-miR-3973	1	1	0

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr2:188974389\|188974544	hsa-miR-3973	1	0
chr2:188974389\|188974534	hsa-miR-3973	1	0
chr2:188974389\|188974531	hsa-miR-3973	1	0
chr2:216501859\|216501960	hsa-miR-3973	0	1
chr6:170535159\|170535297	hsa-miR-3973	0	1
chr19:10391616\|10391706	hsa-miR-3973	0	1
chr3:49100412\|49100636	hsa-miR-3973	0	1
chr11:130130146\|130135599	hsa-miR-3973	0	1
chr7:30757028\|30757199	hsa-miR-3973	0	1
chr6:168666983\|168667113	hsa-miR-3973	0	1
chr1:6592244\|6592469	hsa-miR-3973	0	1
chr2:232790857\|232791166	hsa-miR-3973	0	1
chr7:100433323\|100433521	hsa-miR-3973	0	1
chr1:154157104\|154157200	hsa-miR-3973	0	1
chr1:116395166\|116395274	hsa-miR-3973	0	1
chr1:6592244\|6592466	hsa-miR-3973	0	1
chr15:50574912\|50575009	hsa-miR-3973	0	1
chr16:4695655\|4695777	hsa-miR-3973	0	1
chr11:125612712\|125613100	hsa-miR-3973	0	1
chr17:48928058\|48928200	hsa-miR-3973	1	0
chr17:68531947\|68532191	hsa-miR-3973	0	1
chr6:43785314\|43785452	hsa-miR-3973	0	1
chr9:136477345\|136477520	hsa-miR-3973	0	1
chr19:51418995\|51419164	hsa-miR-3973	0	1
chr7:4767814\|4767983	hsa-miR-3973	0	1
chr17:78992856\|78992942	hsa-miR-3973	0	1
chr8:13083735\|13083921	hsa-miR-3973	0	1
chr9:136008069\|136008168	hsa-miR-3973	0	1
chr5:87355789\|87355900	hsa-miR-3973	0	1
chr14:77469102\|77469221	hsa-miR-3973	0	1
chrX:66032468\|66032618	hsa-miR-3973	0	1
chr6:3850872\|3850958	hsa-miR-3973	0	1
chr19:12192667\|12192760	hsa-miR-3973	0	1
chr11:18406504\|18406800	hsa-miR-3973	0	1
chr19:9563570\|9563655	hsa-miR-3973	0	1
chr10:102665195\|102665477	hsa-miR-3973	0	1
chr10:122270865\|122271084	hsa-miR-3973	0	1
chr11:130133661\|130135599	hsa-miR-3973	0	1
chr14:76176095\|76176214	hsa-miR-3973	0	1
chr8:27598197\|27598518	hsa-miR-3973	0	1
chr4:184765957\|184766699	hsa-miR-3973	0	1
chr14:77722933\|77723176	hsa-miR-3973	0	1
chr11:47422617\|47422940	hsa-miR-3973	0	1
chr11:65126639\|65126751	hsa-miR-3973	0	1
chr15:40036255~40036428	hsa-miR-3973	0	1
chr11:125612706~125613100	hsa-miR-3973	0	1
chr5:39382910~39383092	hsa-miR-3973	0	1
chr6:39905750~39905941	hsa-miR-3973	0	1
chr7:4767791~4767913	hsa-miR-3973	0	1
chrX:3322695~3322827	hsa-miR-3973	0	1
chr12:19274789~19274983	hsa-miR-3973	0	1
chr20:4700428\|4700633	hsa-miR-3973	0	1
chr6:170535159~170535297	hsa-miR-3973	0	1
chr7:100433323~100433644	hsa-miR-3973	0	1
chr6:43785279~43785427	hsa-miR-3973	0	1
chr1:6592244~6592479	hsa-miR-3973	0	1
chr16:4695655~4695777	hsa-miR-3973	0	1
chr10:103441943~103442287	hsa-miR-3973	0	1
chr1:153763241~153763853	hsa-miR-3973	0	1
chr19:55230020~55230240	hsa-miR-3973	0	1
chr11:130133661~130135599	hsa-miR-3973	0	1
chr1:54718983~54719114	hsa-miR-3973	0	1
chr19:10391616~10391706	hsa-miR-3973	0	1
chr15:49895227\|49895363	hsa-miR-3973	0	1
chr4:6800294\|6800410	hsa-miR-3973	0	1
chr16:69334829\|69334910	hsa-miR-3973	0	1
chr7:93259248\|93259409	hsa-miR-3973	0	1
chr13:40903154\|40903368	hsa-miR-3973	0	1
chr3:183776038\|183776123	hsa-miR-3973	0	1
chr14:60124449\|60124578	hsa-miR-3973	0	1
chr8:24339731\|24339870	hsa-miR-3973	0	1
chr9:2120579\|2120761	hsa-miR-3973	0	1
chr1:24439971\|24440072	hsa-miR-3973	0	1
chr19:10745252\|10745409	hsa-miR-3973	0	1
chr2:20251172\|20251359	hsa-miR-3973	0	1
chr14:45245759\|45245875	hsa-miR-3973	1	0
chr12:45287365\|45287561	hsa-miR-3973	0	1
chr11:43820725\|43820880	hsa-miR-3973	0	1
chr17:67949161\|67949361	hsa-miR-3973	0	1
chr22:41886652\|41886762	hsa-miR-3973	0	1
chr3:56732081\|56732213	hsa-miR-3973	0	1
chr9:35741712\|35741851	hsa-miR-3973	0	1
chr1:233054344\|233054472	hsa-miR-3973	0	1
chr2:232790859\|232791058	hsa-miR-3973	0	1
chr20:35177105\|35177252	hsa-miR-3973	0	1
chr1:38863709\|38863816	hsa-miR-3973	0	1
chr3:49423754\|49423969	hsa-miR-3973	0	1
chr6:43785279\|43785427	hsa-miR-3973	0	1
chr11:114314525\|114314655	hsa-miR-3973	0	1
chr1:153763238\|153763853	hsa-miR-3973	0	1
chr1:93521625\|93521799	hsa-miR-3973	0	1
chr19:55230030\|55230225	hsa-miR-3973	0	1
chr10:21733737\|21733860	hsa-miR-3973	0	1
chr14:77469118\|77469239	hsa-miR-3973	0	1
chr2:237641171\|237641426	hsa-miR-3973	0	1
chrX:66033549\|66033648	hsa-miR-3973	0	1
chr19:6419235\|6420132	hsa-miR-3973	0	1
chr11:130133664\|130135599	hsa-miR-3973	0	1
chr20:15636604\|15636772	hsa-miR-3973	0	1
chr22:50524005\|50524096	hsa-miR-3973	0	1
chr6:43785287\|43785427	hsa-miR-3973	0	1
chr6:43785300\|43785427	hsa-miR-3973	0	1
chr19:10391563\|10391706	hsa-miR-3973	0	1
chr6:2948619\|2948995	hsa-miR-3973	0	1
chr6:31860865\|31861021	hsa-miR-3973	0	1
chr8:140864312\|140890769	hsa-miR-3973	0	1
chr11:108176246\|108177090	hsa-miR-3973	0	1
chr9:112472229\|112472354	hsa-miR-3973	0	1
chr1:150574523\|150574705	hsa-miR-3973	0	1
chr10:17704431\|17705741	hsa-miR-3973	0	1
chr19:55230030\|55230246	hsa-miR-3973	0	1
chr11:65126618\|65126751	hsa-miR-3973	0	1
chr11:130133657\|130135599	hsa-miR-3973	0	1
chr4:52873667\|52873908	hsa-miR-3973	0	1
chr19:55230138\|55230276	hsa-miR-3973	0	1
chr1:20744036\|20744233	hsa-miR-3973	0	1
chr6:43785312\|43785436	hsa-miR-3973	0	1
chr8:23022028\|23022189	hsa-miR-3973	0	1
chr6:17615990\|17616107	hsa-miR-3973	0	1
chr4:141234020\|141234132	hsa-miR-3973	0	1
chr7:101097497\|101097656	hsa-miR-3973	0	1
chr10:73801204\|73801346	hsa-miR-3973	0	1
chr17:75262624\|75262867	hsa-miR-3973	0	1
chr19:55230020\|55230244	hsa-miR-3973	0	1
chr6:43785300\|43785455	hsa-miR-3973	0	1
chr1:153763271\|153763853	hsa-miR-3973	0	1
chr5:141318639\|141318733	hsa-miR-3973	0	1
chr17:80347891\|80348082	hsa-miR-3973	0	1
chr6:43785294\|43785427	hsa-miR-3973	0	1
chr1:153763233\|153763853	hsa-miR-3973	0	1
chr11:130133629\|130135599	hsa-miR-3973	0	1
chr1:116395121\|116395210	hsa-miR-3973	-7	1
chr11:47733784\|47733903	hsa-miR-3973	-7	1
chr19:55230138\|55230297	hsa-miR-3973	-6	1
chr2:46364918\|46365084	hsa-miR-3973	-9	1
chr2:69719989\|69720107	hsa-miR-3973	-4	1
chr20:35176983\|35177252	hsa-miR-3973	-10	1
chr12:48222616\|48222800	hsa-miR-3973	-10	1
chr1:38863709\|38863863	hsa-miR-3973	-10	1
chr11:126294463\|126294552	hsa-miR-3973	0	1
chr5:150183510\|150183732	hsa-miR-3973	1	0
chr6:42889210\|42889303	hsa-miR-3973	1	0
chr17:35573287\|35573425	hsa-miR-3973	0	1
chr7:99394491\|99394671	hsa-miR-3973	0	1
chrX:19360279\|19360423	hsa-miR-3973	0	1
chr10:68342102\|68342322	hsa-miR-3973	0	1
chr7:979982\|980161	hsa-miR-3973	0	1
chr1:116395121\|116395274	hsa-miR-3973	0	1
chr16:85921338\|85921511	hsa-miR-3973	0	1
chr10:119070886\|119070999	hsa-miR-3973	0	1
chr7:100433287\|100433562	hsa-miR-3973	0	1
chr1:2402188\|2402311	hsa-miR-3973	0	1
chr3:53185932\|53186316	hsa-miR-3973	0	1
chr13:44573462\|44573569	hsa-miR-3973	0	1
chr5:112838738\|112838936	hsa-miR-3973	0	1
chr1:166917461\|166917635	hsa-miR-3973	0	1
chr16:583068\|583180	hsa-miR-3973	0	1
chr7:101097505\|101097656	hsa-miR-3973	0	1
chr16:2759368\|2759774	hsa-miR-3973	0	1
chr7:100433328\|100433562	hsa-miR-3973	0	1
chr8:98190470\|98190577	hsa-miR-3973	0	1
chr7:75888301\|75888507	hsa-miR-3973	0	1
chr17:17260442\|17262106	hsa-miR-3973	0	1
chr11:65126526\|65126751	hsa-miR-3973	0	1
chr20:32165938\|32166097	hsa-miR-3973	0	1
chr10:80418699\|80418805	hsa-miR-3973	0	1
chr11:47422660\|47422943	hsa-miR-3973	0	1
chr15:84634382\|84634594	hsa-miR-3973	0	1
chr5:143227665\|143227794	hsa-miR-3973	0	1
chrX:103924775\|103924934	hsa-miR-3973	0	1
chr5:128188433\|128188671	hsa-miR-3973	0	1
chr11:125612706\|125613100	hsa-miR-3973	0	1
chr16:58599404\|58599511	hsa-miR-3973	0	1
chr11:65661718\|65661961	hsa-miR-3973	0	1
chr19:55230030\|55230236	hsa-miR-3973	0	1
chr6:24804802\|24804922	hsa-miR-3973	0	1
chr12:53307601\|53307702	hsa-miR-3973	1	0
chr13:50529062\|50529204	hsa-miR-3973	1	0
chr17:75730241\|75730504	hsa-miR-3973	1	0

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-miR-3973				details
hsa-miR-3973	ZNRF2	zinc and ring finger 2	HGNC:22316	details
hsa-miR-3973	RIMKLB	ribosomal modification protein rimK like family member B	HGNC:29228	details
hsa-miR-3973	MCC	MCC regulator of WNT signaling pathway	HGNC:6935	details
hsa-miR-3973	RASA2	RAS p21 protein activator 2	HGNC:9872	details
hsa-miR-3973	ZNF354C	zinc finger protein 354C	HGNC:16736	details
hsa-miR-3973	PSMA1	proteasome 20S subunit alpha 1	HGNC:9530	details
hsa-miR-3973	CRYZ	crystallin zeta	HGNC:2419	details
hsa-miR-3973	CCDC77	coiled-coil domain containing 77	HGNC:28203	details
hsa-miR-3973	ZBTB38	zinc finger and BTB domain containing 38	HGNC:26636	details
hsa-miR-3973	NSD2	nuclear receptor binding SET domain protein 2	HGNC:12766	details
hsa-miR-3973	TGOLN2	trans-golgi network protein 2	HGNC:15450	details
hsa-miR-3973	PPP2R5E	protein phosphatase 2 regulatory subunit B'epsilon	HGNC:9313	details
hsa-miR-3973	NUFIP2	nuclear FMR1 interacting protein 2	HGNC:17634	details
hsa-miR-3973	KLHL11	kelch like family member 11	HGNC:19008	details
hsa-miR-3973	GOLGA8A	golgin A8 family member A	HGNC:31972	details
hsa-miR-3973	G2E3	G2/M-phase specific E3 ubiquitin protein ligase	HGNC:20338	details
hsa-miR-3973	B2M	beta-2-microglobulin	HGNC:914	details
hsa-miR-3973	ARL10	ADP ribosylation factor like GTPase 10	HGNC:22042	details
hsa-miR-3973	APEX1	apurinic/apyrimidinic endodeoxyribonuclease 1	HGNC:587	details
hsa-miR-3973	ACTB	actin beta	HGNC:132	details
hsa-miR-3973	ABHD5	abhydrolase domain containing 5, lysophosphatidic acid acyltransferase	HGNC:21396	details
hsa-miR-3973	FOXQ1	forkhead box Q1	HGNC:20951	details
hsa-miR-3973	LPAR2	lysophosphatidic acid receptor 2	HGNC:3168	details
hsa-miR-3973	MUC20	mucin 20, cell surface associated	HGNC:23282	details
hsa-miR-3973	MORC1	MORC family CW-type zinc finger 1	HGNC:7198	details
hsa-miR-3973	JRKL	JRK like	HGNC:6200	details
hsa-miR-3973	RGS17	regulator of G protein signaling 17	HGNC:14088	details
hsa-miR-3973	OXGR1	oxoglutarate receptor 1	HGNC:4531	details
hsa-miR-3973	PABPC3	poly(A) binding protein cytoplasmic 3	HGNC:8556	details
hsa-miR-3973	INHBA	inhibin subunit beta A	HGNC:6066	details
hsa-miR-3973	USP53	ubiquitin specific peptidase 53	HGNC:29255	details
hsa-miR-3973	SPRYD4	SPRY domain containing 4	HGNC:27468	details
hsa-miR-3973	SMAD7	SMAD family member 7	HGNC:6773	details
hsa-miR-3973	PTPN4	protein tyrosine phosphatase non-receptor type 4	HGNC:9656	details
hsa-miR-3973	PLEKHA1	pleckstrin homology domain containing A1	HGNC:14335	details
hsa-miR-3973	CELSR3	cadherin EGF LAG seven-pass G-type receptor 3	HGNC:3230	details
hsa-miR-3973	CDK4	cyclin dependent kinase 4	HGNC:1773	details
hsa-miR-3973	RSBN1	round spermatid basic protein 1	HGNC:25642	details
hsa-miR-3973	NUP54	nucleoporin 54	HGNC:17359	details
hsa-miR-3973	ELK4	ETS transcription factor ELK4	HGNC:3326	details
hsa-miR-3973				details
hsa-miR-3973	NPM3	nucleophosmin/nucleoplasmin 3	HGNC:7931	details
hsa-miR-3973	TRIM73	tripartite motif containing 73	HGNC:18162	details
hsa-miR-3973	TRIM74	tripartite motif containing 74	HGNC:17453	details
hsa-miR-3973	A1CF	APOBEC1 complementation factor	HGNC:24086	details
hsa-miR-3973	CHST6	carbohydrate sulfotransferase 6	HGNC:6938	details
hsa-miR-3973	FRY	FRY microtubule binding protein	HGNC:20367	details
hsa-miR-3973				details
hsa-miR-3973	C7orf33	chromosome 7 open reading frame 33	HGNC:21724	details
hsa-miR-3973	EXO5	exonuclease 5	HGNC:26115	details
hsa-miR-3973	RRP8	ribosomal RNA processing 8	HGNC:29030	details
hsa-miR-3973	ZFHX3	zinc finger homeobox 3	HGNC:777	details
hsa-miR-3973	YOD1	YOD1 deubiquitinase	HGNC:25035	details
hsa-miR-3973	VLDLR	very low density lipoprotein receptor	HGNC:12698	details
hsa-miR-3973	SRPK1	SRSF protein kinase 1	HGNC:11305	details
hsa-miR-3973	SCML2	Scm polycomb group protein like 2	HGNC:10581	details
hsa-miR-3973	IKZF5	IKAROS family zinc finger 5	HGNC:14283	details
hsa-miR-3973	GALNT7	polypeptide N-acetylgalactosaminyltransferase 7	HGNC:4129	details
hsa-miR-3973				details
hsa-miR-3973	ATMIN	ATM interactor	HGNC:29034	details
hsa-miR-3973	ANP32E	acidic nuclear phosphoprotein 32 family member E	HGNC:16673	details
hsa-miR-3973	PABPC1	poly(A) binding protein cytoplasmic 1	HGNC:8554	details
hsa-miR-3973	MSMO1	methylsterol monooxygenase 1	HGNC:10545	details
hsa-miR-3973	CCND1	cyclin D1	HGNC:1582	details
hsa-miR-3973	G3BP1	G3BP stress granule assembly factor 1	HGNC:30292	details
hsa-miR-3973	YWHAZ	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta	HGNC:12855	details
hsa-miR-3973	UBE2D2	ubiquitin conjugating enzyme E2 D2	HGNC:12475	details
hsa-miR-3973	SAMD8	sterile alpha motif domain containing 8	HGNC:26320	details
hsa-miR-3973	MARCKS	myristoylated alanine rich protein kinase C substrate	HGNC:6759	details
hsa-miR-3973	LAMC1	laminin subunit gamma 1	HGNC:6492	details
hsa-miR-3973	KLHL28	kelch like family member 28	HGNC:19741	details
hsa-miR-3973	ELAVL2	ELAV like RNA binding protein 2	HGNC:3313	details
hsa-miR-3973	EIF2S1	eukaryotic translation initiation factor 2 subunit alpha	HGNC:3265	details
hsa-miR-3973	CHERP	calcium homeostasis endoplasmic reticulum protein	HGNC:16930	details
hsa-miR-3973	MSANTD4	Myb/SANT DNA binding domain containing 4 with coiled-coils	HGNC:29383	details
hsa-miR-3973	FXR1	FMR1 autosomal homolog 1	HGNC:4023	details
hsa-miR-3973	CBX3	chromobox 3	HGNC:1553	details
hsa-miR-3973	TBC1D13	TBC1 domain family member 13	HGNC:25571	details
hsa-miR-3973	THRAP3	thyroid hormone receptor associated protein 3	HGNC:22964	details
hsa-miR-3973	RAB8B	RAB8B, member RAS oncogene family	HGNC:30273	details
hsa-miR-3973	LCOR	ligand dependent nuclear receptor corepressor	HGNC:29503	details
hsa-miR-3973	GNG12	G protein subunit gamma 12	HGNC:19663	details
hsa-miR-3973	CSTF2	cleavage stimulation factor subunit 2	HGNC:2484	details
hsa-miR-3973	CAV1	caveolin 1	HGNC:1527	details
hsa-miR-3973	ATF7IP	activating transcription factor 7 interacting protein	HGNC:20092	details
hsa-miR-3973	DMD	dystrophin	HGNC:2928	details
hsa-miR-3973	CCDC80	coiled-coil domain containing 80	HGNC:30649	details
hsa-miR-3973	TMPO	thymopoietin	HGNC:11875	details
hsa-miR-3973	FEM1A	fem-1 homolog A	HGNC:16934	details
hsa-miR-3973	BNC2	basonuclin 2	HGNC:30988	details
hsa-miR-3973	COQ7	coenzyme Q7, hydroxylase	HGNC:2244	details
hsa-miR-3973	QSOX2	quiescin sulfhydryl oxidase 2	HGNC:30249	details
hsa-miR-3973	CHRM3	cholinergic receptor muscarinic 3	HGNC:1952	details
hsa-miR-3973	PIK3C2B	phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta	HGNC:8972	details
hsa-miR-3973	MELK	maternal embryonic leucine zipper kinase	HGNC:16870	details
hsa-miR-3973	CARHSP1	calcium regulated heat stable protein 1	HGNC:17150	details
hsa-miR-3973	PKP1	plakophilin 1	HGNC:9023	details
hsa-miR-3973	C1orf210	chromosome 1 open reading frame 210	HGNC:28755	details
hsa-miR-3973	SKI	SKI proto-oncogene	HGNC:10896	details
hsa-miR-3973	CEP68	centrosomal protein 68	HGNC:29076	details
hsa-miR-3973	TRIB1	tribbles pseudokinase 1	HGNC:16891	details
hsa-miR-3973	SMIM17	small integral membrane protein 17	HGNC:27114	details
hsa-miR-3973	PPP1R3G	protein phosphatase 1 regulatory subunit 3G	HGNC:14945	details
hsa-miR-3973	CUBN	cubilin	HGNC:2548	details
hsa-miR-3973	SPTY2D1	SPT2 chromatin protein domain containing 1	HGNC:26818	details
hsa-miR-3973	RANBP2	RAN binding protein 2	HGNC:9848	details
hsa-miR-3973	MRPL44	mitochondrial ribosomal protein L44	HGNC:16650	details
hsa-miR-3973	ELMOD2	ELMO domain containing 2	HGNC:28111	details
hsa-miR-3973	DTX3L	deltex E3 ubiquitin ligase 3L	HGNC:30323	details
hsa-miR-3973	ZNF554	zinc finger protein 554	HGNC:26629	details
hsa-miR-3973	EMC7	ER membrane protein complex subunit 7	HGNC:24301	details
hsa-miR-3973	CYP20A1	cytochrome P450 family 20 subfamily A member 1	HGNC:20576	details
hsa-miR-3973	TNFAIP8L1	TNF alpha induced protein 8 like 1	HGNC:28279	details
hsa-miR-3973	TAF1D	TATA-box binding protein associated factor, RNA polymerase I subunit D	HGNC:28759	details
hsa-miR-3973	FOLR1	folate receptor alpha	HGNC:3791	details
hsa-miR-3973	PI4K2B	phosphatidylinositol 4-kinase type 2 beta	HGNC:18215	details
hsa-miR-3973	RPL37A	ribosomal protein L37a	HGNC:10348	details
hsa-miR-3973	IPP	intracisternal A particle-promoted polypeptide	HGNC:6108	details
hsa-miR-3973	SLC43A3	solute carrier family 43 member 3	HGNC:17466	details
hsa-miR-3973	ZNF446	zinc finger protein 446	HGNC:21036	details
hsa-miR-3973	VBP1	VHL binding protein 1	HGNC:12662	details
hsa-miR-3973	ZNF174	zinc finger protein 174	HGNC:12963	details
hsa-miR-3973	SUGP1	SURP and G-patch domain containing 1	HGNC:18643	details
hsa-miR-3973	TSPAN6	tetraspanin 6	HGNC:11858	details
hsa-miR-3973	SEMA4D	semaphorin 4D	HGNC:10732	details
hsa-miR-3973	HIPK3	homeodomain interacting protein kinase 3	HGNC:4915	details
hsa-miR-3973	GABPB1	GA binding protein transcription factor subunit beta 1	HGNC:4074	details
hsa-miR-3973	EFCAB14	EF-hand calcium binding domain 14	HGNC:29051	details
hsa-miR-3973	DNAJB4	DnaJ heat shock protein family (Hsp40) member B4	HGNC:14886	details
hsa-miR-3973	CTNNB1	catenin beta 1	HGNC:2514	details
hsa-miR-3973	CHCHD3	coiled-coil-helix-coiled-coil-helix domain containing 3	HGNC:21906	details
hsa-miR-3973	ENTHD1	ENTH domain containing 1	HGNC:26352	details
hsa-miR-3973	TBL3	transducin beta like 3	HGNC:11587	details
hsa-miR-3973	RPS24	ribosomal protein S24	HGNC:10411	details
hsa-miR-3973	B4GALNT3	beta-1,4-N-acetyl-galactosaminyltransferase 3	HGNC:24137	details
hsa-miR-3973	APLP2	amyloid beta precursor like protein 2	HGNC:598	details
hsa-miR-3973	GPATCH3	G-patch domain containing 3	HGNC:25720	details
hsa-miR-3973	PLEKHM1	pleckstrin homology and RUN domain containing M1	HGNC:29017	details
hsa-miR-3973	PPP1R18	protein phosphatase 1 regulatory subunit 18	HGNC:29413	details
hsa-miR-3973	PTPN1	protein tyrosine phosphatase non-receptor type 1	HGNC:9642	details
hsa-miR-3973	SDE2	SDE2 telomere maintenance homolog	HGNC:26643	details
hsa-miR-3973	CDKL2	cyclin dependent kinase like 2	HGNC:1782	details
hsa-miR-3973	HMGN2	high mobility group nucleosomal binding domain 2	HGNC:4986	details
hsa-miR-3973	LIMK1	LIM domain kinase 1	HGNC:6613	details
hsa-miR-3973	LIPA	lipase A, lysosomal acid type	HGNC:6617	details
hsa-miR-3973	MGAT1	alpha-1,3-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase	HGNC:7044	details
hsa-miR-3973	NCOA4	nuclear receptor coactivator 4	HGNC:7671	details
hsa-miR-3973	POLR3F	RNA polymerase III subunit F	HGNC:15763	details
hsa-miR-3973	PROX1	prospero homeobox 1	HGNC:9459	details
hsa-miR-3973	RBMS2	RNA binding motif single stranded interacting protein 2	HGNC:9909	details
hsa-miR-3973	RDH11	retinol dehydrogenase 11	HGNC:17964	details
hsa-miR-3973	SUGT1	SGT1 homolog, MIS12 kinetochore complex assembly cochaperone	HGNC:16987	details
hsa-miR-3973	ZMPSTE24	zinc metallopeptidase STE24	HGNC:12877	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)