miRNA Card

miRNA General Information
miRNA ID hsa-miR-4424
Description Homo sapiens miR-4424 stem-loop
Comment None
Experiment Illumina [1]
Sequence AGAGUUAACUCAAAAUGGACUA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr19:53491235|53491486 hsa-miR-4424 0 1 0
chrX:41343737|41344074 hsa-miR-4424 0 1 0
chr9:14146689|14150265 hsa-miR-4424 0 1 0
chr11:125612712|125613100 hsa-miR-4424 0 1 0
chr22:38863971|38864174 hsa-miR-4424 0 1 0
chr2:203138209|203138315 hsa-miR-4424 0 1 0
chr14:21492545|21492654 hsa-miR-4424 1 0 0
chr3:188262413|188262509 hsa-miR-4424 1 0 0
chr1:38855827|38855892 hsa-miR-4424 0 1 0
chr18:673097|673315 hsa-miR-4424 0 1 0
chr17:73207433|73207599 hsa-miR-4424 0 1 0
chr1:94730574|94730649 hsa-miR-4424 0 1 0
chr9:128822136|128822236 hsa-miR-4424 0 1 0
chr18:673059|673228 hsa-miR-4424 0 1 0
chr11:125612706~125613100 hsa-miR-4424 0 1 0
chr14:21492545~21492654 hsa-miR-4424 0 1 0
chr22:38863971~38864142 hsa-miR-4424 0 1 0
chr22:38863971~38864131 hsa-miR-4424 0 1 0
chr22:38863971~38864126 hsa-miR-4424 0 1 0
chr22:35742419~35742567 hsa-miR-4424 0 1 0
chr22:50732902~50733044 hsa-miR-4424 0 1 0
chr22:38863936|38864082 hsa-miR-4424 0 1 0
chr3:52399473|52399620 hsa-miR-4424 0 1 0
chr17:56888950|56889202 hsa-miR-4424 0 1 0
chr4:8362148|8362287 hsa-miR-4424 0 1 0
chr4:16325966|16326091 hsa-miR-4424 0 1 0
chr2:130346805|130346998 hsa-miR-4424 0 1 0
chr6:26405452|26405586 hsa-miR-4424 0 1 0
chr4:87892784|87893002 hsa-miR-4424 0 1 0
chr2:43223456|43223558 hsa-miR-4424 0 1 0
chr14:32157490|32157682 hsa-miR-4424 0 1 0
chr9:128822082|128822226 hsa-miR-4424 0 1 0
chr8:61569853|61570065 hsa-miR-4424 0 1 0
chr19:49865380|49865511 hsa-miR-4424 0 1 0
chr6:144537582|144542870 hsa-miR-4424 0 1 0
chr6:144537582|144539443 hsa-miR-4424 0 1 0
chr22:30029491|30029698 hsa-miR-4424 0 1 0
chr14:32157425|32157558 hsa-miR-4424 0 1 0
chr2:10443251|10443560 hsa-miR-4424 0 1 0
chr15:50499563|50499667 hsa-miR-4424 0 1 0
chr22:38863929|38864131 hsa-miR-4424 0 1 0
chr20:32437688|32437800 hsa-miR-4424 0 1 0
chr18:673090|673315 hsa-miR-4424 0 1 0
chr4:87892732|87893002 hsa-miR-4424 0 1 0
chr4:169721376|169721607 hsa-miR-4424 0 1 0
chr7:129418059|129418168 hsa-miR-4424 0 1 0
chr22:38863971|38864101 hsa-miR-4424 0 1 0
chr1:151166172|151166964 hsa-miR-4424 -9 1 0
chr22:35742419|35742567 hsa-miR-4424 0 1 0
chr11:125612706|125613100 hsa-miR-4424 0 1 0
chr2:99390246|99390401 hsa-miR-4424 0 1 0
chr1:222659757|222660006 hsa-miR-4424 0 1 0
chr11:65861051|65861424 hsa-miR-4424 0 1 0
chr22:38863971|38864113 hsa-miR-4424 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4424 SLC7A14 solute carrier family 7 member 14 HGNC:29326 details
hsa-miR-4424 ST13 ST13 Hsp70 interacting protein HGNC:11343 details
hsa-miR-4424 GOLGA8H golgin A8 family member H HGNC:37443 details
hsa-miR-4424 GOLGA8M golgin A8 family member M HGNC:44404 details
hsa-miR-4424 GOLGA6L4 golgin A6 family like 4 HGNC:27256 details
hsa-miR-4424 GPR89B G protein-coupled receptor 89B HGNC:13840 details
hsa-miR-4424 GOLGA6L10 golgin A6 family like 10 HGNC:37228 details
hsa-miR-4424 SMYD1 SET and MYND domain containing 1 HGNC:20986 details
hsa-miR-4424 SEC14L3 SEC14 like lipid binding 3 HGNC:18655 details
hsa-miR-4424 GRAMD1C GRAM domain containing 1C HGNC:25252 details
hsa-miR-4424 GOLGA8J golgin A8 family member J HGNC:38650 details
hsa-miR-4424 GPR89A G protein-coupled receptor 89A HGNC:31984 details
hsa-miR-4424 UQCRB ubiquinol-cytochrome c reductase binding protein HGNC:12582 details
hsa-miR-4424 RNF13 ring finger protein 13 HGNC:10057 details
hsa-miR-4424 UFC1 ubiquitin-fold modifier conjugating enzyme 1 HGNC:26941 details
hsa-miR-4424 ZBTB34 zinc finger and BTB domain containing 34 HGNC:31446 details
hsa-miR-4424 TOR2A torsin family 2 member A HGNC:11996 details
hsa-miR-4424 TFAM transcription factor A, mitochondrial HGNC:11741 details
hsa-miR-4424 SSRP1 structure specific recognition protein 1 HGNC:11327 details
hsa-miR-4424 SRSF1 serine and arginine rich splicing factor 1 HGNC:10780 details
hsa-miR-4424 PDZD8 PDZ domain containing 8 HGNC:26974 details
hsa-miR-4424 NPEPPS aminopeptidase puromycin sensitive HGNC:7900 details
hsa-miR-4424 NAA40 N-alpha-acetyltransferase 40, NatD catalytic subunit HGNC:25845 details
hsa-miR-4424 AFF4 AF4/FMR2 family member 4 HGNC:17869 details
hsa-miR-4424 TMEM126B transmembrane protein 126B HGNC:30883 details
hsa-miR-4424 MZT1 mitotic spindle organizing protein 1 HGNC:33830 details
hsa-miR-4424 CALCR calcitonin receptor HGNC:1440 details
hsa-miR-4424 GLUD1 glutamate dehydrogenase 1 HGNC:4335 details
hsa-miR-4424 TBRG1 transforming growth factor beta regulator 1 HGNC:29551 details
hsa-miR-4424 ELOC elongin C HGNC:11617 details
hsa-miR-4424 SCARB2 scavenger receptor class B member 2 HGNC:1665 details
hsa-miR-4424 GIGYF1 GRB10 interacting GYF protein 1 HGNC:9126 details
hsa-miR-4424 SIKE1 suppressor of IKBKE 1 HGNC:26119 details
hsa-miR-4424 MAML3 mastermind like transcriptional coactivator 3 HGNC:16272 details
hsa-miR-4424 TMBIM6 transmembrane BAX inhibitor motif containing 6 HGNC:11723 details
hsa-miR-4424 CREBL2 cAMP responsive element binding protein like 2 HGNC:2350 details
hsa-miR-4424 MOAP1 modulator of apoptosis 1 HGNC:16658 details
hsa-miR-4424 details
hsa-miR-4424 SOD2 superoxide dismutase 2 HGNC:11180 details
hsa-miR-4424 HSPA1A heat shock protein family A (Hsp70) member 1A HGNC:5232 details
hsa-miR-4424 MYBPC1 myosin binding protein C1 HGNC:7549 details
hsa-miR-4424 USP1 ubiquitin specific peptidase 1 HGNC:12607 details
hsa-miR-4424 TRPS1 transcriptional repressor GATA binding 1 HGNC:12340 details
hsa-miR-4424 TATDN2 TatD DNase domain containing 2 HGNC:28988 details
hsa-miR-4424 STK4 serine/threonine kinase 4 HGNC:11408 details
hsa-miR-4424 SUMO1 small ubiquitin like modifier 1 HGNC:12502 details
hsa-miR-4424 OTUB2 OTU deubiquitinase, ubiquitin aldehyde binding 2 HGNC:20351 details
hsa-miR-4424 NHLRC2 NHL repeat containing 2 HGNC:24731 details
hsa-miR-4424 ARF3 ADP ribosylation factor 3 HGNC:654 details
hsa-miR-4424 NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-4424 RPL7L1 ribosomal protein L7 like 1 HGNC:21370 details
hsa-miR-4424 KIF3B kinesin family member 3B HGNC:6320 details
hsa-miR-4424 FEM1A fem-1 homolog A HGNC:16934 details
hsa-miR-4424 RAD18 RAD18 E3 ubiquitin protein ligase HGNC:18278 details
hsa-miR-4424 FAM8A1 family with sequence similarity 8 member A1 HGNC:16372 details
hsa-miR-4424 PNPO pyridoxamine 5'-phosphate oxidase HGNC:30260 details
hsa-miR-4424 STARD3NL STARD3 N-terminal like HGNC:19169 details
hsa-miR-4424 SOBP sine oculis binding protein homolog HGNC:29256 details
hsa-miR-4424 SLC35G1 solute carrier family 35 member G1 HGNC:26607 details
hsa-miR-4424 COL1A2 collagen type I alpha 2 chain HGNC:2198 details
hsa-miR-4424 ZNF625 zinc finger protein 625 HGNC:30571 details
hsa-miR-4424 VAPB VAMP associated protein B and C HGNC:12649 details
hsa-miR-4424 FAM126B family with sequence similarity 126 member B HGNC:28593 details
hsa-miR-4424 GNA12 G protein subunit alpha 12 HGNC:4380 details
hsa-miR-4424 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 HGNC:16038 details
hsa-miR-4424 HMGB1 high mobility group box 1 HGNC:4983 details
hsa-miR-4424 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 HGNC:21033 details
hsa-miR-4424 FAHD1 fumarylacetoacetate hydrolase domain containing 1 HGNC:14169 details
hsa-miR-4424 EFCAB14 EF-hand calcium binding domain 14 HGNC:29051 details
hsa-miR-4424 COBLL1 cordon-bleu WH2 repeat protein like 1 HGNC:23571 details
hsa-miR-4424 SLC30A10 solute carrier family 30 member 10 HGNC:25355 details
hsa-miR-4424 MSN moesin HGNC:7373 details
hsa-miR-4424 WASF2 WASP family member 2 HGNC:12733 details
hsa-miR-4424 BCL2L11 BCL2 like 11 HGNC:994 details
hsa-miR-4424 PIK3CB phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta HGNC:8976 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab