CircNet

miRNA General Information

Basic
Network

miRNA ID	hsa-miR-4438
Description	Homo sapiens miR-4438 stem-loop
Comment	None
Experiment	Illumina [1]
Sequence	CACAGGCUUAGAAAAGACAGU

miRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan
chr8:100584111\|100600441	hsa-miR-4438	1	1	1
chr2:86147702\|86151520	hsa-miR-4438	1	1	1

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr20:58678751\|58678878	hsa-miR-4438	1	1
chr20:58678754\|58678878	hsa-miR-4438	1	1
chr16:85693630\|85693719	hsa-miR-4438	1	1
chr9:77931711\|77931884	hsa-miR-4438	1	1
chr19:42428661\|42428776	hsa-miR-4438	1	1
chr19:42428661\|42428780	hsa-miR-4438	1	1
chr7:55395264\|55395557	hsa-miR-4438	1	1
chr19:42428661\|42428814	hsa-miR-4438	1	1
chr19:42428661\|42428798	hsa-miR-4438	1	1
chr9:124358289\|124358553	hsa-miR-4438	1	1
chr22:36860995\|36861107	hsa-miR-4438	1	1

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr5:78113752\|78113901	hsa-miR-4438	1	0
chr20:37300215\|37300355	hsa-miR-4438	1	0
chr1:159918468\|159918657	hsa-miR-4438	1	0
chr11:44933490\|44933730	hsa-miR-4438	0	1
chr12:57529532\|57529667	hsa-miR-4438	0	1
chr17:44187400\|44187530	hsa-miR-4438	0	1
chr11:62800263\|62800393	hsa-miR-4438	0	1
chr10:71352695\|71352922	hsa-miR-4438	0	1
chr17:40456951\|40457097	hsa-miR-4438	0	1
chr19:18388896\|18389110	hsa-miR-4438	0	1
chr19:48211505\|48211607	hsa-miR-4438	0	1
chr3:50188480\|50188649	hsa-miR-4438	0	1
chr16:1700123\|1700228	hsa-miR-4438	0	1
chr1:29118707\|29118796	hsa-miR-4438	0	1
chr3:50331617\|50331856	hsa-miR-4438	0	1
chr17:40630714\|40630863	hsa-miR-4438	0	1
chr22:39132832\|39133014	hsa-miR-4438	0	1
chr16:22347075\|22347187	hsa-miR-4438	0	1
chr17:38511959\|38512044	hsa-miR-4438	0	1
chr12:56241453\|56241644	hsa-miR-4438	0	1
chr7:100819569\|100819725	hsa-miR-4438	0	1
chr2:201379128\|201379277	hsa-miR-4438	0	1
chr12:14882137\|14882269	hsa-miR-4438	0	1
chr2:219282842\|219283162	hsa-miR-4438	0	1
chr7:157682725\|157682937	hsa-miR-4438	0	1
chr14:105350368\|105350477	hsa-miR-4438	0	1
chr16:54113039\|54113162	hsa-miR-4438	0	1
chr14:24417240\|24417507	hsa-miR-4438	0	1
chr8:99868289\|99868410	hsa-miR-4438	0	1
chr14:73276869\|73277067	hsa-miR-4438	0	1
chr12:56143117\|56143333	hsa-miR-4438	0	1
chr21:31668799\|31668880	hsa-miR-4438	0	1
chr16:17107398\|17107567	hsa-miR-4438	0	1
chr17:7260271\|7260417	hsa-miR-4438	0	1
chr1:43452730\|43452820	hsa-miR-4438	0	1
chr15:67201775\|67201861	hsa-miR-4438	0	1
chr2:71076075\|71076223	hsa-miR-4438	0	1
chr6:33295319\|33295422	hsa-miR-4438	0	1
chr11:17388104\|17388250	hsa-miR-4438	0	1
chr19:58549117\|58549427	hsa-miR-4438	0	1
chr9:3395472\|3395596	hsa-miR-4438	0	1
chr19:1495304\|1495579	hsa-miR-4438	0	1
chr16:56367444\|56369251	hsa-miR-4438	0	1
chr5:78113752\|78113907	hsa-miR-4438	1	0
chr5:78113752\|78113850	hsa-miR-4438	1	0
chr17:39404701\|39404817	hsa-miR-4438	1	0
chr12:92798892\|92799086	hsa-miR-4438	1	0
chr16:1228359\|1228473	hsa-miR-4438	1	0
chr20:58678751\|58678894	hsa-miR-4438	1	0
chr20:419986\|420175	hsa-miR-4438	1	0
chr1:202001773\|202001878	hsa-miR-4438	0	1
chr16:15866643\|15866786	hsa-miR-4438	0	1
chr5:168616550\|168616700	hsa-miR-4438	0	1
chr14:69713550\|69713693	hsa-miR-4438	0	1
chr9:92315818\|92315941	hsa-miR-4438	0	1
chr14:106276694\|106276784	hsa-miR-4438	0	1
chr3:50188463\|50188649	hsa-miR-4438	0	1
chr10:102149941\|102150025	hsa-miR-4438	0	1
chr12:56343897\|56344112	hsa-miR-4438	0	1
chr3:49724412\|49724553	hsa-miR-4438	0	1
chr1:160211695\|160213238	hsa-miR-4438	0	1
chr13:22936277\|22936396	hsa-miR-4438	0	1
chr1:26281061\|26281198	hsa-miR-4438	0	1
chr17:78174337\|78174604	hsa-miR-4438	0	1
chr6:32217039\|32217240	hsa-miR-4438	0	1
chr19:58549079\|58549421	hsa-miR-4438	0	1
chr1:33142091\|33142168	hsa-miR-4438	0	1
chr2:237336270\|237336427	hsa-miR-4438	0	1
chr3:155826658\|155826748	hsa-miR-4438	0	1
chr6:33295319\|33295588	hsa-miR-4438	0	1
chr6:80442768\|80443049	hsa-miR-4438	0	1
chr3:169976946\|169988359	hsa-miR-4438	0	1
chr7:4996741\|4996835	hsa-miR-4438	0	1
chr8:37695040\|37695160	hsa-miR-4438	0	1
chr7:99443084\|99443244	hsa-miR-4438	0	1
chr5:471032\|471127	hsa-miR-4438	0	1
chr11:102527757\|102530607	hsa-miR-4438	0	1
chr10:101830433\|101830532	hsa-miR-4438	0	1
chr11:47781488\|47781655	hsa-miR-4438	0	1
chr1:155055792\|155056103	hsa-miR-4438	0	1
chr1:201900334\|201900499	hsa-miR-4438	0	1
chr19:14709978\|14710108	hsa-miR-4438	0	1
chr14:31313897\|31314139	hsa-miR-4438	0	1
chr16:30001664\|30001844	hsa-miR-4438	0	1
chr4:140862083\|140862234	hsa-miR-4438	0	1
chr4:867173\|867361	hsa-miR-4438	0	1
chr5:168616529\|168616700	hsa-miR-4438	0	1
chr14:104954404\|104954494	hsa-miR-4438	0	1
chr11:62615477~62615590	hsa-miR-4438	0	1
chr15:63407727~63407942	hsa-miR-4438	0	1
chr17:40456951~40457097	hsa-miR-4438	0	1
chr19:15272821~15272950	hsa-miR-4438	0	1
chr19:19112413~19112608	hsa-miR-4438	0	1
chr7:70762897~70763133	hsa-miR-4438	0	1
chr17:40456951~40457141	hsa-miR-4438	0	1
chr1:52355398~52355666	hsa-miR-4438	0	1
chr3:189100043~189100204	hsa-miR-4438	0	1
chr1:32773859~32774182	hsa-miR-4438	0	1
chr18:63493073~63499287	hsa-miR-4438	0	1
chr1:33142091~33142168	hsa-miR-4438	0	1
chr17:7260271~7260417	hsa-miR-4438	0	1
chr1:96108505~96108619	hsa-miR-4438	0	1
chr5:151662552~151662754	hsa-miR-4438	0	1
chr17:7260268~7260417	hsa-miR-4438	0	1
chr7:157682725~157682937	hsa-miR-4438	0	1
chr11:47638699~47639039	hsa-miR-4438	0	1
chr21:44320356~44320467	hsa-miR-4438	0	1
chr19:4011269~4011446	hsa-miR-4438	0	1
chr4:119298201\|119298334	hsa-miR-4438	0	1
chr6:33295319~33295544	hsa-miR-4438	0	1
chr7:4996680~4996835	hsa-miR-4438	0	1
chr8:37695040~37695160	hsa-miR-4438	0	1
chr3:187821413~187821565	hsa-miR-4438	0	1
chr1:43671628\|43671761	hsa-miR-4438	0	1
chr1:147773252~147773397	hsa-miR-4438	0	1
chr11:62615410~62615570	hsa-miR-4438	0	1
chr15:41826156~41826486	hsa-miR-4438	0	1
chr4:76003159~76003373	hsa-miR-4438	0	1
chr1:52355398\|52355666	hsa-miR-4438	0	1
chr2:237336270~237336427	hsa-miR-4438	0	1
chr6:33892040~33892150	hsa-miR-4438	0	1
chr12:56241453~56241644	hsa-miR-4438	0	1
chr6:24718540~24718823	hsa-miR-4438	0	1
chr1:228119413~228119766	hsa-miR-4438	0	1
chr6:36719893\|36720114	hsa-miR-4438	0	1
chr22:37314877\|37315106	hsa-miR-4438	0	1
chr2:105287033\|105287211	hsa-miR-4438	0	1
chr19:19193974\|19194122	hsa-miR-4438	0	1
chr11:2309591\|2309790	hsa-miR-4438	0	1
chr19:48229206\|48229365	hsa-miR-4438	0	1
chr1:64887875\|64888046	hsa-miR-4438	0	1
chr19:15426111\|15426191	hsa-miR-4438	0	1
chr4:142420047\|142420200	hsa-miR-4438	0	1
chr22:20057677\|20057773	hsa-miR-4438	0	1
chr10:21990587\|21990744	hsa-miR-4438	0	1
chr15:57259742\|57259915	hsa-miR-4438	0	1
chr9:114358130\|114359669	hsa-miR-4438	0	1
chr17:1003686\|1003910	hsa-miR-4438	0	1
chr6:43515595\|43515954	hsa-miR-4438	0	1
chr19:11210901\|11211016	hsa-miR-4438	1	0
chr11:66637437\|66637621	hsa-miR-4438	0	1
chr12:65461375\|65461477	hsa-miR-4438	0	1
chr20:3755469\|3755592	hsa-miR-4438	0	1
chr6:7229301\|7229407	hsa-miR-4438	0	1
chr17:6639032\|6639179	hsa-miR-4438	0	1
chr13:49081845\|49081967	hsa-miR-4438	0	1
chr6:18171756\|18171969	hsa-miR-4438	0	1
chr11:112091081\|112091285	hsa-miR-4438	0	1
chr1:43452630\|43452805	hsa-miR-4438	0	1
chr20:50095876\|50096000	hsa-miR-4438	0	1
chr12:7105002\|7105141	hsa-miR-4438	0	1
chr10:93668886\|93669113	hsa-miR-4438	0	1
chr22:23741204\|23741405	hsa-miR-4438	0	1
chr5:6354322\|6354562	hsa-miR-4438	0	1
chr14:90288381\|90288518	hsa-miR-4438	0	1
chr17:28631513\|28631588	hsa-miR-4438	1	0
chr17:30427789\|30427945	hsa-miR-4438	1	0
chr4:155932759\|155932864	hsa-miR-4438	1	0
chr21:38994555\|38994709	hsa-miR-4438	1	0
chr12:57529512\|57529674	hsa-miR-4438	0	1
chr5:168616574\|168616700	hsa-miR-4438	0	1
chr4:48294718\|48294846	hsa-miR-4438	0	1
chr10:45445526\|45445683	hsa-miR-4438	0	1
chr17:7260268\|7260417	hsa-miR-4438	0	1
chr1:22256366\|22256481	hsa-miR-4438	0	1
chr16:2239913\|2240107	hsa-miR-4438	0	1
chr17:38511864\|38512044	hsa-miR-4438	0	1
chr6:42692312\|42692592	hsa-miR-4438	0	1
chr11:44933500\|44933730	hsa-miR-4438	0	1
chr11:78218042\|78218261	hsa-miR-4438	0	1
chr12:123411818\|123411989	hsa-miR-4438	0	1
chr4:40348790\|40349046	hsa-miR-4438	0	1
chr20:25006347\|25006459	hsa-miR-4438	0	1
chr16:2275623\|2275718	hsa-miR-4438	0	1
chr11:65128948\|65129098	hsa-miR-4438	0	1
chr20:58678698\|58678878	hsa-miR-4438	0	1
chr16:2239913\|2240000	hsa-miR-4438	0	1
chr13:112882008\|112882307	hsa-miR-4438	0	1
chr3:11750769\|11751020	hsa-miR-4438	0	1
chr12:56088593\|56088790	hsa-miR-4438	0	1
chr5:168616515\|168616700	hsa-miR-4438	0	1
chr7:139298018\|139298176	hsa-miR-4438	0	1
chr10:75230766\|75230854	hsa-miR-4438	0	1
chr11:32103373\|32103480	hsa-miR-4438	0	1
chr15:41840573\|41840829	hsa-miR-4438	0	1
chr17:4937822\|4938064	hsa-miR-4438	0	1
chr6:31531082\|31531407	hsa-miR-4438	0	1
chr1:39968837\|39969024	hsa-miR-4438	0	1
chr6:43520334\|43520733	hsa-miR-4438	0	1
chr2:237521228\|237521409	hsa-miR-4438	0	1
chr5:472257\|472373	hsa-miR-4438	0	1
chr4:119494722\|119494876	hsa-miR-4438	0	1
chr20:50583612\|50583729	hsa-miR-4438	0	1
chr20:60207359\|60207508	hsa-miR-4438	0	1
chr13:46751844\|46752026	hsa-miR-4438	0	1
chr21:33358395\|33358590	hsa-miR-4438	0	1
chr3:5218073\|5218222	hsa-miR-4438	0	1
chr1:245687322\|245687471	hsa-miR-4438	0	1
chr10:100381898\|100382056	hsa-miR-4438	0	1
chr1:173824225\|173824428	hsa-miR-4438	0	1
chr16:75229390\|75229690	hsa-miR-4438	0	1
chr1:1144682\|1144794	hsa-miR-4438	0	1
chr1:245687359\|245687538	hsa-miR-4438	0	1
chr2:86151297\|86151383	hsa-miR-4438	0	1
chr19:53069945\|53070049	hsa-miR-4438	0	1
chr12:122230947\|122231067	hsa-miR-4438	0	1
chr19:48922587\|48922794	hsa-miR-4438	0	1
chrX:73826484\|73826602	hsa-miR-4438	0	1
chr6:32217039\|32217243	hsa-miR-4438	0	1
chr16:4258134\|4258237	hsa-miR-4438	0	1
chr1:48355670\|48359770	hsa-miR-4438	0	1
chr16:69284048\|69284244	hsa-miR-4438	0	1
chr9:16727797\|16738485	hsa-miR-4438	0	1
chrX:10445672\|10445852	hsa-miR-4438	0	1
chr1:145836510\|145836616	hsa-miR-4438	0	1
chr19:14709989\|14710108	hsa-miR-4438	0	1
chr1:39387813\|39387986	hsa-miR-4438	0	1
chr2:42350902\|42350968	hsa-miR-4438	0	1
chr1:154957652\|154957823	hsa-miR-4438	0	1
chr10:80506833\|80507004	hsa-miR-4438	0	1
chr17:38511943\|38512048	hsa-miR-4438	0	1
chrX:70432915\|70433212	hsa-miR-4438	0	1
chr6:43520392\|43520774	hsa-miR-4438	0	1
chr8:133243424\|133243606	hsa-miR-4438	0	1
chr11:71455141\|71460812	hsa-miR-4438	0	1
chr17:7260268\|7260394	hsa-miR-4438	0	1
chr7:30924392\|30924707	hsa-miR-4438	0	1
chr5:177513376\|177513474	hsa-miR-4438	0	1
chr3:5218080\|5218246	hsa-miR-4438	0	1
chr19:42428655\|42428823	hsa-miR-4438	0	1
chr17:42701459\|42701596	hsa-miR-4438	0	1
chr3:187821413\|187821565	hsa-miR-4438	0	1
chr4:867101\|867289	hsa-miR-4438	0	1
chr16:1700093\|1700228	hsa-miR-4438	0	1
chr2:64460255\|64460477	hsa-miR-4438	0	1
chr7:134065348\|134065519	hsa-miR-4438	0	1
chr11:66101543\|66101675	hsa-miR-4438	0	1
chr15:90920320\|90920544	hsa-miR-4438	0	1
chr7:30924395\|30924525	hsa-miR-4438	0	1
chr16:24218283\|24218399	hsa-miR-4438	0	1
chr1:180175061\|180175235	hsa-miR-4438	0	1
chr10:46215580\|46215797	hsa-miR-4438	0	1
chr1:32773859\|32774182	hsa-miR-4438	0	1
chr6:34589275\|34589525	hsa-miR-4438	0	1
chr3:50364199\|50364313	hsa-miR-4438	0	1
chr19:19112463\|19112608	hsa-miR-4438	0	1
chr19:53255049\|53255290	hsa-miR-4438	0	1
chr5:168616526\|168616700	hsa-miR-4438	0	1
chr13:112882029\|112882141	hsa-miR-4438	0	1
chr14:105860577\|105860757	hsa-miR-4438	0	1
chr7:44061353\|44061512	hsa-miR-4438	0	1
chr17:1003743\|1003838	hsa-miR-4438	0	1
chr7:44061336\|44061441	hsa-miR-4438	0	1
chr15:72160045\|72160237	hsa-miR-4438	0	1
chr15:72160045\|72160198	hsa-miR-4438	0	1
chr3:40422868\|40423073	hsa-miR-4438	0	1
chr17:60055567\|60056217	hsa-miR-4438	0	1
chr16:1700106\|1700228	hsa-miR-4438	-5	1
chr17:42701384\|42701560	hsa-miR-4438	-4	1
chr7:139646081\|139646224	hsa-miR-4438	-9	1
chr17:74786272\|74786488	hsa-miR-4438	-7	1
chr16:1242282\|1242531	hsa-miR-4438	1	0
chr12:101727919\|101728043	hsa-miR-4438	1	0
chrX:8488361\|8488412	hsa-miR-4438	1	0
chr20:420064\|420175	hsa-miR-4438	1	0
chr20:420020\|420137	hsa-miR-4438	1	0
chr17:7841550\|7841639	hsa-miR-4438	1	0
chr12:121778544\|121778677	hsa-miR-4438	0	1
chr19:58549117\|58549399	hsa-miR-4438	0	1
chr6:96521448\|96521560	hsa-miR-4438	0	1
chr17:17061202\|17061338	hsa-miR-4438	0	1
chr11:17375709\|17375842	hsa-miR-4438	0	1
chr2:86151297\|86151436	hsa-miR-4438	0	1
chr1:151405107\|151405268	hsa-miR-4438	0	1
chr7:134065296\|134065493	hsa-miR-4438	0	1
chr1:201900347\|201900447	hsa-miR-4438	0	1
chr20:25225873\|25226049	hsa-miR-4438	0	1
chr22:40030460\|40030714	hsa-miR-4438	0	1
chr20:25006354\|25006456	hsa-miR-4438	0	1
chr1:26280896\|26281266	hsa-miR-4438	0	1
chr17:7260268\|7260372	hsa-miR-4438	0	1
chr17:75892291\|75892386	hsa-miR-4438	0	1
chr19:58549061\|58549394	hsa-miR-4438	0	1
chrX:4544895\|4545010	hsa-miR-4438	0	1
chr16:58665338\|58665487	hsa-miR-4438	0	1
chr11:78218185\|78218298	hsa-miR-4438	0	1
chr15:90981002\|90981636	hsa-miR-4438	0	1
chr1:201900307\|201900425	hsa-miR-4438	0	1
chr3:194407524\|194407636	hsa-miR-4438	0	1
chr11:62800263\|62800385	hsa-miR-4438	0	1
chr15:90920011\|90920142	hsa-miR-4438	0	1
chr3:50331728\|50332091	hsa-miR-4438	0	1
chr17:39524760\|39524837	hsa-miR-4438	0	1
chr7:139298009\|139298176	hsa-miR-4438	0	1
chr6:106568926\|106569079	hsa-miR-4438	0	1
chrX:4544887\|4545010	hsa-miR-4438	0	1
chr6:43520642\|43520774	hsa-miR-4438	0	1
chr1:26280915\|26281291	hsa-miR-4438	0	1
chr3:49724412\|49724565	hsa-miR-4438	0	1
chr10:62092638\|62092777	hsa-miR-4438	0	1
chr17:38511831\|38512044	hsa-miR-4438	0	1
chr1:160997780\|160997903	hsa-miR-4438	0	1
chr6:43447708\|43447851	hsa-miR-4438	0	1
chr16:24218288\|24218399	hsa-miR-4438	0	1
chr19:13109568\|13109955	hsa-miR-4438	0	1
chr11:62615477\|62615628	hsa-miR-4438	0	1
chr9:130136333\|130136537	hsa-miR-4438	0	1
chr3:5218080\|5218222	hsa-miR-4438	0	1
chr3:101997407\|101997513	hsa-miR-4438	0	1
chr22:25195195\|25195403	hsa-miR-4438	0	1
chr9:35404375\|35404543	hsa-miR-4438	0	1
chrX:1311739\|1311924	hsa-miR-4438	0	1
chr6:151060384\|151060566	hsa-miR-4438	0	1
chrX:73826484\|73826641	hsa-miR-4438	0	1
chrX:73826471\|73826634	hsa-miR-4438	0	1
chr5:471032\|471131	hsa-miR-4438	0	1
chr6:81844110\|81844222	hsa-miR-4438	0	1
chrUn_JTFH01000788v1_decoy:218\|422	hsa-miR-4438	0	1
chr1:156644669\|156644779	hsa-miR-4438	0	1
chr7:100046646\|100046827	hsa-miR-4438	0	1
chr1:39387807\|39387986	hsa-miR-4438	0	1
chr15:40325461\|40325639	hsa-miR-4438	0	1
chr19:35250356\|35250608	hsa-miR-4438	0	1
chr17:58354827\|58355038	hsa-miR-4438	0	1
chr19:8490649\|8490925	hsa-miR-4438	0	1
chr15:72160093\|72160186	hsa-miR-4438	0	1
chr9:129505660\|129505848	hsa-miR-4438	0	1
chr9:114358149\|114359724	hsa-miR-4438	0	1
chr2:73080882\|73081091	hsa-miR-4438	0	1
chr8:2000702\|2000957	hsa-miR-4438	0	1
chr6:33295319\|33295590	hsa-miR-4438	0	1
chr1:220812440\|220812594	hsa-miR-4438	1	0
chr15:64958086\|64958216	hsa-miR-4438	1	0
chr13:45327408\|45327620	hsa-miR-4438	1	0
chr5:78113752\|78113919	hsa-miR-4438	1	0
chr12:123479640\|123479773	hsa-miR-4438	1	0
chr19:11210869\|11211061	hsa-miR-4438	1	0
chr11:60935712\|60935827	hsa-miR-4438	1	0

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-miR-4438	THUMPD3	THUMP domain containing 3	HGNC:24493	details
hsa-miR-4438	CBX5	chromobox 5	HGNC:1555	details
hsa-miR-4438	S1PR3	sphingosine-1-phosphate receptor 3	HGNC:3167	details
hsa-miR-4438	TMEM64	transmembrane protein 64	HGNC:25441	details
hsa-miR-4438	SLC16A1	solute carrier family 16 member 1	HGNC:10922	details
hsa-miR-4438	PPIF	peptidylprolyl isomerase F	HGNC:9259	details
hsa-miR-4438	GABRB1	gamma-aminobutyric acid type A receptor subunit beta1	HGNC:4081	details
hsa-miR-4438	FHL2	four and a half LIM domains 2	HGNC:3703	details
hsa-miR-4438	EIF4G2	eukaryotic translation initiation factor 4 gamma 2	HGNC:3297	details
hsa-miR-4438	VPS72	vacuolar protein sorting 72 homolog	HGNC:11644	details
hsa-miR-4438	THSD4	thrombospondin type 1 domain containing 4	HGNC:25835	details
hsa-miR-4438	ZSCAN25	zinc finger and SCAN domain containing 25	HGNC:21961	details
hsa-miR-4438	KCNC3	potassium voltage-gated channel subfamily C member 3	HGNC:6235	details
hsa-miR-4438	COL23A1	collagen type XXIII alpha 1 chain	HGNC:22990	details
hsa-miR-4438	SYPL1	synaptophysin like 1	HGNC:11507	details
hsa-miR-4438	BTG2	BTG anti-proliferation factor 2	HGNC:1131	details
hsa-miR-4438	TLK2	tousled like kinase 2	HGNC:11842	details
hsa-miR-4438	FBXO6	F-box protein 6	HGNC:13585	details
hsa-miR-4438	PRPF4	pre-mRNA processing factor 4	HGNC:17349	details
hsa-miR-4438	LAMP2	lysosomal associated membrane protein 2	HGNC:6501	details
hsa-miR-4438	NCAPD2	non-SMC condensin I complex subunit D2	HGNC:24305	details
hsa-miR-4438	FOS	Fos proto-oncogene, AP-1 transcription factor subunit	HGNC:3796	details
hsa-miR-4438	KPNA1	karyopherin subunit alpha 1	HGNC:6394	details
hsa-miR-4438				details
hsa-miR-4438	RTL8A	retrotransposon Gag like 8A	HGNC:24514	details
hsa-miR-4438	C1orf50	chromosome 1 open reading frame 50	HGNC:28795	details
hsa-miR-4438	ZNF730	zinc finger protein 730	HGNC:32470	details
hsa-miR-4438	CLUAP1	clusterin associated protein 1	HGNC:19009	details
hsa-miR-4438	ZNF865	zinc finger protein 865	HGNC:38705	details
hsa-miR-4438	ESR2	estrogen receptor 2	HGNC:3468	details
hsa-miR-4438	GALNT6	polypeptide N-acetylgalactosaminyltransferase 6	HGNC:4128	details
hsa-miR-4438	RBM4B	RNA binding motif protein 4B	HGNC:28842	details
hsa-miR-4438	CIAO1	cytosolic iron-sulfur assembly component 1	HGNC:14280	details
hsa-miR-4438	RAB3IP	RAB3A interacting protein	HGNC:16508	details
hsa-miR-4438	CD36	CD36 molecule	HGNC:1663	details
hsa-miR-4438	SIGLEC11	sialic acid binding Ig like lectin 11	HGNC:15622	details
hsa-miR-4438	CEP78	centrosomal protein 78	HGNC:25740	details
hsa-miR-4438	AHI1	Abelson helper integration site 1	HGNC:21575	details
hsa-miR-4438	TRPM1	transient receptor potential cation channel subfamily M member 1	HGNC:7146	details
hsa-miR-4438	MRPL52	mitochondrial ribosomal protein L52	HGNC:16655	details
hsa-miR-4438	VDR	vitamin D receptor	HGNC:12679	details
hsa-miR-4438	QRFPR	pyroglutamylated RFamide peptide receptor	HGNC:15565	details
hsa-miR-4438	ISY1	ISY1 splicing factor homolog	HGNC:29201	details
hsa-miR-4438	NINJ1	ninjurin 1	HGNC:7824	details
hsa-miR-4438	TRUB2	TruB pseudouridine synthase family member 2	HGNC:17170	details
hsa-miR-4438	COMTD1	catechol-O-methyltransferase domain containing 1	HGNC:26309	details
hsa-miR-4438	BCAS4	breast carcinoma amplified sequence 4	HGNC:14367	details
hsa-miR-4438	SNAP47	synaptosome associated protein 47	HGNC:30669	details
hsa-miR-4438	FAM89A	family with sequence similarity 89 member A	HGNC:25057	details
hsa-miR-4438	TRIM58	tripartite motif containing 58	HGNC:24150	details
hsa-miR-4438	DARS2	aspartyl-tRNA synthetase 2, mitochondrial	HGNC:25538	details
hsa-miR-4438	ZNF277	zinc finger protein 277	HGNC:13070	details
hsa-miR-4438	CAVIN1	caveolae associated protein 1	HGNC:9688	details
hsa-miR-4438	CYP20A1	cytochrome P450 family 20 subfamily A member 1	HGNC:20576	details
hsa-miR-4438				details
hsa-miR-4438	SLC35F6	solute carrier family 35 member F6	HGNC:26055	details
hsa-miR-4438				details
hsa-miR-4438	NT5C2	5'-nucleotidase, cytosolic II	HGNC:8022	details
hsa-miR-4438	KCTD21	potassium channel tetramerization domain containing 21	HGNC:27452	details
hsa-miR-4438	PBLD	phenazine biosynthesis like protein domain containing	HGNC:23301	details
hsa-miR-4438	CHST6	carbohydrate sulfotransferase 6	HGNC:6938	details
hsa-miR-4438	RAB11FIP4	RAB11 family interacting protein 4	HGNC:30267	details
hsa-miR-4438	ZNF491	zinc finger protein 491	HGNC:23706	details
hsa-miR-4438	DIS3L	DIS3 like exosome 3'-5' exoribonuclease	HGNC:28698	details
hsa-miR-4438	EFCAB11	EF-hand calcium binding domain 11	HGNC:20357	details
hsa-miR-4438	CLK4	CDC like kinase 4	HGNC:13659	details
hsa-miR-4438	ANKRD62	ankyrin repeat domain 62	HGNC:35241	details
hsa-miR-4438	IMPA1	inositol monophosphatase 1	HGNC:6050	details
hsa-miR-4438	RPL4	ribosomal protein L4	HGNC:10353	details
hsa-miR-4438	ABHD15	abhydrolase domain containing 15	HGNC:26971	details
hsa-miR-4438	COG7	component of oligomeric golgi complex 7	HGNC:18622	details
hsa-miR-4438	LSM3	LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated	HGNC:17874	details
hsa-miR-4438	ZNF565	zinc finger protein 565	HGNC:26726	details
hsa-miR-4438	FMC1	formation of mitochondrial complex V assembly factor 1 homolog	HGNC:26946	details
hsa-miR-4438	CLDN19	claudin 19	HGNC:2040	details
hsa-miR-4438	SMIM14	small integral membrane protein 14	HGNC:27321	details
hsa-miR-4438	ZNF514	zinc finger protein 514	HGNC:25894	details
hsa-miR-4438	ZNF563	zinc finger protein 563	HGNC:30498	details
hsa-miR-4438	CCL5	C-C motif chemokine ligand 5	HGNC:10632	details
hsa-miR-4438	STAR	steroidogenic acute regulatory protein	HGNC:11359	details
hsa-miR-4438	ZFP14	ZFP14 zinc finger protein	HGNC:29312	details
hsa-miR-4438	MED16	mediator complex subunit 16	HGNC:17556	details
hsa-miR-4438	NEK8	NIMA related kinase 8	HGNC:13387	details
hsa-miR-4438	NKD1	NKD inhibitor of WNT signaling pathway 1	HGNC:17045	details
hsa-miR-4438	PAICS	phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase	HGNC:8587	details
hsa-miR-4438	KCNK6	potassium two pore domain channel subfamily K member 6	HGNC:6281	details
hsa-miR-4438	CEP76	centrosomal protein 76	HGNC:25727	details
hsa-miR-4438	IVD	isovaleryl-CoA dehydrogenase	HGNC:6186	details
hsa-miR-4438	C3	complement C3	HGNC:1318	details
hsa-miR-4438	FIG4	FIG4 phosphoinositide 5-phosphatase	HGNC:16873	details
hsa-miR-4438	KCNA7	potassium voltage-gated channel subfamily A member 7	HGNC:6226	details
hsa-miR-4438	AQR	aquarius intron-binding spliceosomal factor	HGNC:29513	details
hsa-miR-4438	YIPF5	Yip1 domain family member 5	HGNC:24877	details
hsa-miR-4438	XIAP	X-linked inhibitor of apoptosis	HGNC:592	details
hsa-miR-4438	TMEM59	transmembrane protein 59	HGNC:1239	details
hsa-miR-4438	SLC1A5	solute carrier family 1 member 5	HGNC:10943	details
hsa-miR-4438	SLC16A10	solute carrier family 16 member 10	HGNC:17027	details
hsa-miR-4438	PSD4	pleckstrin and Sec7 domain containing 4	HGNC:19096	details
hsa-miR-4438	PLPBP	pyridoxal phosphate binding protein	HGNC:9457	details
hsa-miR-4438	PHLDA3	pleckstrin homology like domain family A member 3	HGNC:8934	details
hsa-miR-4438	NR2F6	nuclear receptor subfamily 2 group F member 6	HGNC:7977	details
hsa-miR-4438	NPFFR1	neuropeptide FF receptor 1	HGNC:17425	details
hsa-miR-4438	NKAP	NFKB activating protein	HGNC:29873	details
hsa-miR-4438	MOB4	MOB family member 4, phocein	HGNC:17261	details
hsa-miR-4438	LSM11	LSM11, U7 small nuclear RNA associated	HGNC:30860	details
hsa-miR-4438	KPNA6	karyopherin subunit alpha 6	HGNC:6399	details
hsa-miR-4438	IPO9	importin 9	HGNC:19425	details
hsa-miR-4438	INTU	inturned planar cell polarity protein	HGNC:29239	details
hsa-miR-4438	IL6R	interleukin 6 receptor	HGNC:6019	details
hsa-miR-4438	ICMT	isoprenylcysteine carboxyl methyltransferase	HGNC:5350	details
hsa-miR-4438	HSPE1-MOB4	HSPE1-MOB4 readthrough	HGNC:49184	details
hsa-miR-4438	FAM83D	family with sequence similarity 83 member D	HGNC:16122	details
hsa-miR-4438	MINDY2	MINDY lysine 48 deubiquitinase 2	HGNC:26954	details
hsa-miR-4438	FAM126B	family with sequence similarity 126 member B	HGNC:28593	details
hsa-miR-4438	EIF4E	eukaryotic translation initiation factor 4E	HGNC:3287	details
hsa-miR-4438	DSTYK	dual serine/threonine and tyrosine protein kinase	HGNC:29043	details
hsa-miR-4438	CREB1	cAMP responsive element binding protein 1	HGNC:2345	details
hsa-miR-4438	ATM	ATM serine/threonine kinase	HGNC:795	details
hsa-miR-4438	CLPP	caseinolytic mitochondrial matrix peptidase proteolytic subunit	HGNC:2084	details
hsa-miR-4438	SIGLEC10	sialic acid binding Ig like lectin 10	HGNC:15620	details
hsa-miR-4438	TMC7	transmembrane channel like 7	HGNC:23000	details
hsa-miR-4438	ZNF135	zinc finger protein 135	HGNC:12919	details
hsa-miR-4438	CCDC174	coiled-coil domain containing 174	HGNC:28033	details
hsa-miR-4438	MPLKIP	M-phase specific PLK1 interacting protein	HGNC:16002	details
hsa-miR-4438	TXK	TXK tyrosine kinase	HGNC:12434	details
hsa-miR-4438	FHDC1	FH2 domain containing 1	HGNC:29363	details
hsa-miR-4438	HAUS3	HAUS augmin like complex subunit 3	HGNC:28719	details
hsa-miR-4438	TRIM13	tripartite motif containing 13	HGNC:9976	details
hsa-miR-4438	TPM4	tropomyosin 4	HGNC:12013	details
hsa-miR-4438	TM7SF3	transmembrane 7 superfamily member 3	HGNC:23049	details
hsa-miR-4438	TGFBR2	transforming growth factor beta receptor 2	HGNC:11773	details
hsa-miR-4438	SLC9A7	solute carrier family 9 member A7	HGNC:17123	details
hsa-miR-4438	MLLT10	MLLT10 histone lysine methyltransferase DOT1L cofactor	HGNC:16063	details
hsa-miR-4438	MASTL	microtubule associated serine/threonine kinase like	HGNC:19042	details
hsa-miR-4438				details
hsa-miR-4438	MYO1C	myosin IC	HGNC:7597	details
hsa-miR-4438	HSPA4L	heat shock protein family A (Hsp70) member 4 like	HGNC:17041	details
hsa-miR-4438	F2RL3	F2R like thrombin or trypsin receptor 3	HGNC:3540	details
hsa-miR-4438	PARK7	Parkinsonism associated deglycase	HGNC:16369	details
hsa-miR-4438	TMEM241	transmembrane protein 241	HGNC:31723	details
hsa-miR-4438	C7orf26	chromosome 7 open reading frame 26	HGNC:21702	details
hsa-miR-4438	C3orf62	chromosome 3 open reading frame 62	HGNC:24771	details
hsa-miR-4438	PRIM1	DNA primase subunit 1	HGNC:9369	details
hsa-miR-4438	NPTXR	neuronal pentraxin receptor	HGNC:7954	details
hsa-miR-4438	UBE2V1	ubiquitin conjugating enzyme E2 V1	HGNC:12494	details
hsa-miR-4438				details
hsa-miR-4438				details
hsa-miR-4438	KLF13	Kruppel like factor 13	HGNC:13672	details
hsa-miR-4438	LETMD1	LETM1 domain containing 1	HGNC:24241	details
hsa-miR-4438	FAM120C	family with sequence similarity 120C	HGNC:16949	details
hsa-miR-4438	GMPS	guanine monophosphate synthase	HGNC:4378	details
hsa-miR-4438	PXDN	peroxidasin	HGNC:14966	details
hsa-miR-4438	MCTS1	MCTS1 re-initiation and release factor	HGNC:23357	details
hsa-miR-4438	MFSD4B	major facilitator superfamily domain containing 4B	HGNC:21053	details
hsa-miR-4438	RRP36	ribosomal RNA processing 36	HGNC:21374	details
hsa-miR-4438	RNF149	ring finger protein 149	HGNC:23137	details
hsa-miR-4438	ZKSCAN1	zinc finger with KRAB and SCAN domains 1	HGNC:13101	details
hsa-miR-4438	NODAL	nodal growth differentiation factor	HGNC:7865	details
hsa-miR-4438	WDR53	WD repeat domain 53	HGNC:28786	details
hsa-miR-4438	DUXA	double homeobox A	HGNC:32179	details
hsa-miR-4438	INTS7	integrator complex subunit 7	HGNC:24484	details
hsa-miR-4438	TPST2	tyrosylprotein sulfotransferase 2	HGNC:12021	details
hsa-miR-4438				details
hsa-miR-4438	NME6	NME/NM23 nucleoside diphosphate kinase 6	HGNC:20567	details
hsa-miR-4438	MAPK1	mitogen-activated protein kinase 1	HGNC:6871	details
hsa-miR-4438	ZNF382	zinc finger protein 382	HGNC:17409	details
hsa-miR-4438	RANGAP1	Ran GTPase activating protein 1	HGNC:9854	details
hsa-miR-4438	ZNF621	zinc finger protein 621	HGNC:24787	details
hsa-miR-4438	POPDC2	popeye domain containing 2	HGNC:17648	details
hsa-miR-4438	DENND5B	DENN domain containing 5B	HGNC:28338	details
hsa-miR-4438	PRKD2	protein kinase D2	HGNC:17293	details
hsa-miR-4438				details
hsa-miR-4438	PCLAF	PCNA clamp associated factor	HGNC:28961	details
hsa-miR-4438	TCHP	trichoplein keratin filament binding	HGNC:28135	details
hsa-miR-4438	RNF14	ring finger protein 14	HGNC:10058	details
hsa-miR-4438				details
hsa-miR-4438	POLR3F	RNA polymerase III subunit F	HGNC:15763	details
hsa-miR-4438	PLCE1	phospholipase C epsilon 1	HGNC:17175	details
hsa-miR-4438	CYP27C1	cytochrome P450 family 27 subfamily C member 1	HGNC:33480	details
hsa-miR-4438	ARGFX	arginine-fifty homeobox	HGNC:30146	details
hsa-miR-4438	LNPK	lunapark, ER junction formation factor	HGNC:21610	details
hsa-miR-4438	YIPF4	Yip1 domain family member 4	HGNC:28145	details
hsa-miR-4438	SYNJ2BP	synaptojanin 2 binding protein	HGNC:18955	details
hsa-miR-4438	STX7	syntaxin 7	HGNC:11442	details
hsa-miR-4438	FAM83F	family with sequence similarity 83 member F	HGNC:25148	details
hsa-miR-4438	DPY19L4	dpy-19 like 4	HGNC:27829	details
hsa-miR-4438	CPT1A	carnitine palmitoyltransferase 1A	HGNC:2328	details
hsa-miR-4438	RASGRP3	RAS guanyl releasing protein 3	HGNC:14545	details
hsa-miR-4438	LRRC47	leucine rich repeat containing 47	HGNC:29207	details
hsa-miR-4438	ERGIC1	endoplasmic reticulum-golgi intermediate compartment 1	HGNC:29205	details
hsa-miR-4438	MTO1	mitochondrial tRNA translation optimization 1	HGNC:19261	details
hsa-miR-4438	NFRKB	nuclear factor related to kappaB binding protein	HGNC:7802	details
hsa-miR-4438	RAB10	RAB10, member RAS oncogene family	HGNC:9759	details
hsa-miR-4438	TLCD2	TLC domain containing 2	HGNC:33522	details
hsa-miR-4438	ICA1L	islet cell autoantigen 1 like	HGNC:14442	details
hsa-miR-4438	PRPF38A	pre-mRNA processing factor 38A	HGNC:25930	details
hsa-miR-4438	GRM6	glutamate metabotropic receptor 6	HGNC:4598	details
hsa-miR-4438	RPL7L1	ribosomal protein L7 like 1	HGNC:21370	details
hsa-miR-4438	METTL21A	methyltransferase 21A, HSPA lysine	HGNC:30476	details
hsa-miR-4438	MACC1	MET transcriptional regulator MACC1	HGNC:30215	details
hsa-miR-4438	BHMT2	betaine--homocysteine S-methyltransferase 2	HGNC:1048	details
hsa-miR-4438	KREMEN1	kringle containing transmembrane protein 1	HGNC:17550	details
hsa-miR-4438	CD99	CD99 molecule (Xg blood group)	HGNC:7082	details
hsa-miR-4438	WNT2B	Wnt family member 2B	HGNC:12781	details
hsa-miR-4438	CAPZA2	capping actin protein of muscle Z-line subunit alpha 2	HGNC:1490	details
hsa-miR-4438	ZMYM4	zinc finger MYM-type containing 4	HGNC:13055	details
hsa-miR-4438	SIK2	salt inducible kinase 2	HGNC:21680	details
hsa-miR-4438	STAT3	signal transducer and activator of transcription 3	HGNC:11364	details
hsa-miR-4438	GOLGA2	golgin A2	HGNC:4425	details
hsa-miR-4438	RDH13	retinol dehydrogenase 13	HGNC:19978	details
hsa-miR-4438	TMEM106B	transmembrane protein 106B	HGNC:22407	details
hsa-miR-4438	TTC38	tetratricopeptide repeat domain 38	HGNC:26082	details
hsa-miR-4438	FBXO48	F-box protein 48	HGNC:33857	details
hsa-miR-4438	ZNF454	zinc finger protein 454	HGNC:21200	details
hsa-miR-4438	ZNF417	zinc finger protein 417	HGNC:20646	details
hsa-miR-4438	LRRC58	leucine rich repeat containing 58	HGNC:26968	details
hsa-miR-4438	GATAD1	GATA zinc finger domain containing 1	HGNC:29941	details
hsa-miR-4438	TAS2R5	taste 2 receptor member 5	HGNC:14912	details
hsa-miR-4438	WDR73	WD repeat domain 73	HGNC:25928	details
hsa-miR-4438	RMND1	required for meiotic nuclear division 1 homolog	HGNC:21176	details
hsa-miR-4438	ABI2	abl interactor 2	HGNC:24011	details
hsa-miR-4438	RAB42	RAB42, member RAS oncogene family	HGNC:28702	details
hsa-miR-4438	FAM227A	family with sequence similarity 227 member A	HGNC:44197	details
hsa-miR-4438	ZNF852	zinc finger protein 852	HGNC:27713	details
hsa-miR-4438	MUC20	mucin 20, cell surface associated	HGNC:23282	details
hsa-miR-4438	ZNF431	zinc finger protein 431	HGNC:20809	details
hsa-miR-4438	RAB11FIP1	RAB11 family interacting protein 1	HGNC:30265	details
hsa-miR-4438	ERVV-1	endogenous retrovirus group V member 1, envelope	HGNC:26501	details
hsa-miR-4438	WFDC6	WAP four-disulfide core domain 6	HGNC:16164	details
hsa-miR-4438	FANCA	FA complementation group A	HGNC:3582	details
hsa-miR-4438	ZNF878	zinc finger protein 878	HGNC:37246	details
hsa-miR-4438	AP3B2	adaptor related protein complex 3 subunit beta 2	HGNC:567	details
hsa-miR-4438	CCS	copper chaperone for superoxide dismutase	HGNC:1613	details
hsa-miR-4438	GTF2H2C	GTF2H2 family member C	HGNC:31394	details
hsa-miR-4438	PCP4L1	Purkinje cell protein 4 like 1	HGNC:20448	details
hsa-miR-4438	OCIAD1	OCIA domain containing 1	HGNC:16074	details
hsa-miR-4438	C9orf64	chromosome 9 open reading frame 64	HGNC:28144	details
hsa-miR-4438	IFIT3	interferon induced protein with tetratricopeptide repeats 3	HGNC:5411	details
hsa-miR-4438	GPR137B	G protein-coupled receptor 137B	HGNC:11862	details
hsa-miR-4438	ORAI2	ORAI calcium release-activated calcium modulator 2	HGNC:21667	details
hsa-miR-4438	SLC2A11	solute carrier family 2 member 11	HGNC:14239	details
hsa-miR-4438	LRRD1	leucine rich repeats and death domain containing 1	HGNC:34300	details
hsa-miR-4438	ASB16	ankyrin repeat and SOCS box containing 16	HGNC:19768	details
hsa-miR-4438	CACNG8	calcium voltage-gated channel auxiliary subunit gamma 8	HGNC:13628	details
hsa-miR-4438	ZNF426	zinc finger protein 426	HGNC:20725	details
hsa-miR-4438	RTN2	reticulon 2	HGNC:10468	details
hsa-miR-4438	TNFSF14	TNF superfamily member 14	HGNC:11930	details
hsa-miR-4438	PTGIS	prostaglandin I2 synthase	HGNC:9603	details
hsa-miR-4438	PNPLA3	patatin like phospholipase domain containing 3	HGNC:18590	details
hsa-miR-4438	HS3ST1	heparan sulfate-glucosamine 3-sulfotransferase 1	HGNC:5194	details
hsa-miR-4438	USP15	ubiquitin specific peptidase 15	HGNC:12613	details
hsa-miR-4438	UACA	uveal autoantigen with coiled-coil domains and ankyrin repeats	HGNC:15947	details
hsa-miR-4438	TRAF3IP2	TRAF3 interacting protein 2	HGNC:1343	details
hsa-miR-4438	TMOD3	tropomodulin 3	HGNC:11873	details
hsa-miR-4438	PTGFRN	prostaglandin F2 receptor inhibitor	HGNC:9601	details
hsa-miR-4438	NSUN4	NOP2/Sun RNA methyltransferase 4	HGNC:31802	details
hsa-miR-4438	LIMD1	LIM domain containing 1	HGNC:6612	details
hsa-miR-4438	GK5	glycerol kinase 5	HGNC:28635	details
hsa-miR-4438	GABPB1	GA binding protein transcription factor subunit beta 1	HGNC:4074	details
hsa-miR-4438	FKBP14	FKBP prolyl isomerase 14	HGNC:18625	details
hsa-miR-4438	SELENOI	selenoprotein I	HGNC:29361	details
hsa-miR-4438	DNAJB4	DnaJ heat shock protein family (Hsp40) member B4	HGNC:14886	details
hsa-miR-4438	FAM241A	family with sequence similarity 241 member A	HGNC:26813	details
hsa-miR-4438	ZNF665	zinc finger protein 665	HGNC:25885	details
hsa-miR-4438	GTF2H3	general transcription factor IIH subunit 3	HGNC:4657	details
hsa-miR-4438	CXorf38	chromosome X open reading frame 38	HGNC:28589	details
hsa-miR-4438	APEX2	apurinic/apyrimidinic endodeoxyribonuclease 2	HGNC:17889	details
hsa-miR-4438	PARD3	par-3 family cell polarity regulator	HGNC:16051	details
hsa-miR-4438	RBM41	RNA binding motif protein 41	HGNC:25617	details
hsa-miR-4438	ZNF347	zinc finger protein 347	HGNC:16447	details
hsa-miR-4438	RRP7A	ribosomal RNA processing 7 homolog A	HGNC:24286	details
hsa-miR-4438	ANKS4B	ankyrin repeat and sterile alpha motif domain containing 4B	HGNC:26795	details
hsa-miR-4438	ABCG8	ATP binding cassette subfamily G member 8	HGNC:13887	details
hsa-miR-4438	ZYG11A	zyg-11 family member A, cell cycle regulator	HGNC:32058	details
hsa-miR-4438	UBE2B	ubiquitin conjugating enzyme E2 B	HGNC:12473	details
hsa-miR-4438	SLC35F5	solute carrier family 35 member F5	HGNC:23617	details
hsa-miR-4438	SH3BP5	SH3 domain binding protein 5	HGNC:10827	details
hsa-miR-4438	PTPN4	protein tyrosine phosphatase non-receptor type 4	HGNC:9656	details
hsa-miR-4438				details
hsa-miR-4438	NAA40	N-alpha-acetyltransferase 40, NatD catalytic subunit	HGNC:25845	details
hsa-miR-4438	MOGAT1	monoacylglycerol O-acyltransferase 1	HGNC:18210	details
hsa-miR-4438	KIAA1549	KIAA1549	HGNC:22219	details
hsa-miR-4438	GSR	glutathione-disulfide reductase	HGNC:4623	details
hsa-miR-4438	CLPX	caseinolytic mitochondrial matrix peptidase chaperone subunit X	HGNC:2088	details
hsa-miR-4438	ATP1B3	ATPase Na+/K+ transporting subunit beta 3	HGNC:806	details
hsa-miR-4438	C1RL	complement C1r subcomponent like	HGNC:21265	details
hsa-miR-4438	FPGS	folylpolyglutamate synthase	HGNC:3824	details
hsa-miR-4438	TUBD1	tubulin delta 1	HGNC:16811	details
hsa-miR-4438	TNFAIP8L1	TNF alpha induced protein 8 like 1	HGNC:28279	details
hsa-miR-4438	DNAJC18	DnaJ heat shock protein family (Hsp40) member C18	HGNC:28429	details
hsa-miR-4438	ESYT2	extended synaptotagmin 2	HGNC:22211	details
hsa-miR-4438	PCNX2	pecanex 2	HGNC:8736	details
hsa-miR-4438	CDIPT	CDP-diacylglycerol--inositol 3-phosphatidyltransferase	HGNC:1769	details
hsa-miR-4438	SPECC1	sperm antigen with calponin homology and coiled-coil domains 1	HGNC:30615	details
hsa-miR-4438	ADAP2	ArfGAP with dual PH domains 2	HGNC:16487	details
hsa-miR-4438	AKR7A2	aldo-keto reductase family 7 member A2	HGNC:389	details
hsa-miR-4438	NUP93	nucleoporin 93	HGNC:28958	details
hsa-miR-4438	LETM2	leucine zipper and EF-hand containing transmembrane protein 2	HGNC:14648	details
hsa-miR-4438	CYP3A5	cytochrome P450 family 3 subfamily A member 5	HGNC:2638	details
hsa-miR-4438	CLDN7	claudin 7	HGNC:2049	details
hsa-miR-4438	GRB2	growth factor receptor bound protein 2	HGNC:4566	details
hsa-miR-4438	NONO	non-POU domain containing octamer binding	HGNC:7871	details
hsa-miR-4438	SETD5	SET domain containing 5	HGNC:25566	details
hsa-miR-4438	SLC25A6	solute carrier family 25 member 6	HGNC:10992	details
hsa-miR-4438	AGO4	argonaute RISC component 4	HGNC:18424	details
hsa-miR-4438	C15orf40	chromosome 15 open reading frame 40	HGNC:28443	details
hsa-miR-4438	DUSP18	dual specificity phosphatase 18	HGNC:18484	details
hsa-miR-4438	GIPC1	GIPC PDZ domain containing family member 1	HGNC:1226	details
hsa-miR-4438	GMEB1	glucocorticoid modulatory element binding protein 1	HGNC:4370	details
hsa-miR-4438	METTL2B	methyltransferase 2B, methylcytidine	HGNC:18272	details
hsa-miR-4438	PMEPA1	prostate transmembrane protein, androgen induced 1	HGNC:14107	details
hsa-miR-4438	PROSER2	proline and serine rich 2	HGNC:23728	details
hsa-miR-4438	PROSER3	proline and serine rich 3	HGNC:25204	details
hsa-miR-4438	SLC12A6	solute carrier family 12 member 6	HGNC:10914	details
hsa-miR-4438	SLC43A2	solute carrier family 43 member 2	HGNC:23087	details
hsa-miR-4438	SPIB	Spi-B transcription factor	HGNC:11242	details
hsa-miR-4438	TIGD2	tigger transposable element derived 2	HGNC:18333	details
hsa-miR-4438	TLR10	toll like receptor 10	HGNC:15634	details
hsa-miR-4438	TPMT	thiopurine S-methyltransferase	HGNC:12014	details
hsa-miR-4438	TXNL4A	thioredoxin like 4A	HGNC:30551	details
hsa-miR-4438	WASF2	WASP family member 2	HGNC:12733	details
hsa-miR-4438	ZNF70	zinc finger protein 70	HGNC:13140	details
hsa-miR-4438	ARMT1	acidic residue methyltransferase 1	HGNC:17872	details
hsa-miR-4438	CYB5R4	cytochrome b5 reductase 4	HGNC:20147	details
hsa-miR-4438	FDFT1	farnesyl-diphosphate farnesyltransferase 1	HGNC:3629	details
hsa-miR-4438	MGAT5	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase	HGNC:7049	details
hsa-miR-4438	MRPS10	mitochondrial ribosomal protein S10	HGNC:14502	details
hsa-miR-4438	SP2	Sp2 transcription factor	HGNC:11207	details
hsa-miR-4438	ZNF257	zinc finger protein 257	HGNC:13498	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)