miRNA Card

miRNA General Information
miRNA ID hsa-miR-4477a
Description Homo sapiens miR-4477a stem-loop
Comment None
Experiment Illumina [1]
Sequence CUAUUAAGGACAUUUGUGAUUC
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr10:68338670|68339469 hsa-miR-4477a 0 1 0
chr20:6025611|6025784 hsa-miR-4477a 0 1 0
chr10:68982901|68983164 hsa-miR-4477a 0 1 0
chr2:189010205|189010329 hsa-miR-4477a 0 1 0
chr2:189010178|189010343 hsa-miR-4477a 0 1 0
chr8:43079659|43079851 hsa-miR-4477a 0 1 0
chr7:1567504|1567745 hsa-miR-4477a 0 1 0
chr21:26838123|26838236 hsa-miR-4477a 0 1 0
chr10:68338670|68339484 hsa-miR-4477a 0 1 0
chr15:64592996|64593330 hsa-miR-4477a 0 1 0
chr10:68339140|68339478 hsa-miR-4477a 0 1 0
chr13:47933928|47934141 hsa-miR-4477a 0 1 0
chr19:34355154|34355276 hsa-miR-4477a 0 1 0
chr2:189010205~189010329 hsa-miR-4477a 0 1 0
chr6:39904377~39904548 hsa-miR-4477a 0 1 0
chr1:153763241~153763853 hsa-miR-4477a 0 1 0
chr19:10637678|10638059 hsa-miR-4477a 0 1 0
chr10:48828976|48829196 hsa-miR-4477a 0 1 0
chr2:224521810|224521932 hsa-miR-4477a 0 1 0
chr15:52547380|52547588 hsa-miR-4477a 0 1 0
chr14:55380709|55380818 hsa-miR-4477a 0 1 0
chr10:102162136|102162296 hsa-miR-4477a 0 1 0
chr1:153763238|153763853 hsa-miR-4477a 0 1 0
chr10:102162198|102162296 hsa-miR-4477a 0 1 0
chr2:189010178|189010329 hsa-miR-4477a 0 1 0
chr13:50010549|50010705 hsa-miR-4477a 0 1 0
chr3:197865423|197866219 hsa-miR-4477a 0 1 0
chr21:34717818|34717949 hsa-miR-4477a 0 1 0
chr2:237510677|237511039 hsa-miR-4477a 0 1 0
chr5:175929095|175929229 hsa-miR-4477a 0 1 0
chr2:189010205|189010343 hsa-miR-4477a 0 1 0
chr1:109401938|109402086 hsa-miR-4477a 0 1 0
chr18:57548746|57549021 hsa-miR-4477a 0 1 0
chr1:153763233|153763853 hsa-miR-4477a 0 1 0
chr10:68339140|68339469 hsa-miR-4477a 0 1 0
chr2:38981929|38982034 hsa-miR-4477a 0 1 0
chr2:64094204|64094267 hsa-miR-4477a 0 1 0
chr10:68339149|68339484 hsa-miR-4477a -12 1 0
chr16:66733065|66733294 hsa-miR-4477a -7 1 0
chr7:131493143|131493264 hsa-miR-4477a 0 1 0
chr10:68969101|68970350 hsa-miR-4477a 0 1 0
chr16:265541|265777 hsa-miR-4477a 0 1 0
chr2:232548680|232548873 hsa-miR-4477a 0 1 0
chr7:1567495|1567760 hsa-miR-4477a 0 1 0
chr3:197128510|197128761 hsa-miR-4477a 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4477a ALG14 ALG14 UDP-N-acetylglucosaminyltransferase subunit HGNC:28287 details
hsa-miR-4477a CHD8 chromodomain helicase DNA binding protein 8 HGNC:20153 details
hsa-miR-4477a NHS NHS actin remodeling regulator HGNC:7820 details
hsa-miR-4477a CUL3 cullin 3 HGNC:2553 details
hsa-miR-4477a DSEL dermatan sulfate epimerase like HGNC:18144 details
hsa-miR-4477a NEDD9 neural precursor cell expressed, developmentally down-regulated 9 HGNC:7733 details
hsa-miR-4477a ZNF644 zinc finger protein 644 HGNC:29222 details
hsa-miR-4477a SOCS3 suppressor of cytokine signaling 3 HGNC:19391 details
hsa-miR-4477a SMAD5 SMAD family member 5 HGNC:6771 details
hsa-miR-4477a SGMS1 sphingomyelin synthase 1 HGNC:29799 details
hsa-miR-4477a RPS14 ribosomal protein S14 HGNC:10387 details
hsa-miR-4477a R3HDM4 R3H domain containing 4 HGNC:28270 details
hsa-miR-4477a POFUT1 protein O-fucosyltransferase 1 HGNC:14988 details
hsa-miR-4477a PLIN3 perilipin 3 HGNC:16893 details
hsa-miR-4477a NAPG NSF attachment protein gamma HGNC:7642 details
hsa-miR-4477a NAA50 N-alpha-acetyltransferase 50, NatE catalytic subunit HGNC:29533 details
hsa-miR-4477a AKIRIN1 akirin 1 HGNC:25744 details
hsa-miR-4477a SEMA7A semaphorin 7A (John Milton Hagen blood group) HGNC:10741 details
hsa-miR-4477a FOXN3 forkhead box N3 HGNC:1928 details
hsa-miR-4477a TRIM24 tripartite motif containing 24 HGNC:11812 details
hsa-miR-4477a DOCK9 dedicator of cytokinesis 9 HGNC:14132 details
hsa-miR-4477a CLEC2D C-type lectin domain family 2 member D HGNC:14351 details
hsa-miR-4477a XPO4 exportin 4 HGNC:17796 details
hsa-miR-4477a PLEKHA1 pleckstrin homology domain containing A1 HGNC:14335 details
hsa-miR-4477a FBXL13 F-box and leucine rich repeat protein 13 HGNC:21658 details
hsa-miR-4477a SAT1 spermidine/spermine N1-acetyltransferase 1 HGNC:10540 details
hsa-miR-4477a ZIC5 Zic family member 5 HGNC:20322 details
hsa-miR-4477a TMOD3 tropomodulin 3 HGNC:11873 details
hsa-miR-4477a SHMT1 serine hydroxymethyltransferase 1 HGNC:10850 details
hsa-miR-4477a MIER3 MIER family member 3 HGNC:26678 details
hsa-miR-4477a HS3ST3B1 heparan sulfate-glucosamine 3-sulfotransferase 3B1 HGNC:5198 details
hsa-miR-4477a RPS19 ribosomal protein S19 HGNC:10402 details
hsa-miR-4477a details
hsa-miR-4477a RPL15 ribosomal protein L15 HGNC:10306 details
hsa-miR-4477a HSPA13 heat shock protein family A (Hsp70) member 13 HGNC:11375 details
hsa-miR-4477a ACTB actin beta HGNC:132 details
hsa-miR-4477a RPL7 ribosomal protein L7 HGNC:10363 details
hsa-miR-4477a TUBG1 tubulin gamma 1 HGNC:12417 details
hsa-miR-4477a PSAT1 phosphoserine aminotransferase 1 HGNC:19129 details
hsa-miR-4477a BTF3L4 basic transcription factor 3 like 4 HGNC:30547 details
hsa-miR-4477a ARPP19 cAMP regulated phosphoprotein 19 HGNC:16967 details
hsa-miR-4477a UGT2A1 UDP glucuronosyltransferase family 2 member A1 complex locus HGNC:12542 details
hsa-miR-4477a UGT2A2 UDP glucuronosyltransferase family 2 member A2 HGNC:28183 details
hsa-miR-4477a ARL8B ADP ribosylation factor like GTPase 8B HGNC:25564 details
hsa-miR-4477a FEZ2 fasciculation and elongation protein zeta 2 HGNC:3660 details
hsa-miR-4477a SPIN4 spindlin family member 4 HGNC:27040 details
hsa-miR-4477a RBM43 RNA binding motif protein 43 HGNC:24790 details
hsa-miR-4477a CLEC4D C-type lectin domain family 4 member D HGNC:14554 details
hsa-miR-4477a GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 HGNC:20883 details
hsa-miR-4477a CCNB1 cyclin B1 HGNC:1579 details
hsa-miR-4477a ZNF566 zinc finger protein 566 HGNC:25919 details
hsa-miR-4477a PHF6 PHD finger protein 6 HGNC:18145 details
hsa-miR-4477a NUP35 nucleoporin 35 HGNC:29797 details
hsa-miR-4477a MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase HGNC:7434 details
hsa-miR-4477a FAM102B family with sequence similarity 102 member B HGNC:27637 details
hsa-miR-4477a ERGIC2 ERGIC and golgi 2 HGNC:30208 details
hsa-miR-4477a ELAVL2 ELAV like RNA binding protein 2 HGNC:3313 details
hsa-miR-4477a BRI3BP BRI3 binding protein HGNC:14251 details
hsa-miR-4477a BMP2K BMP2 inducible kinase HGNC:18041 details
hsa-miR-4477a AMOTL1 angiomotin like 1 HGNC:17811 details
hsa-miR-4477a PDPK1 3-phosphoinositide dependent protein kinase 1 HGNC:8816 details
hsa-miR-4477a TMEM117 transmembrane protein 117 HGNC:25308 details
hsa-miR-4477a LYRM2 LYR motif containing 2 HGNC:25229 details
hsa-miR-4477a RPL10 ribosomal protein L10 HGNC:10298 details
hsa-miR-4477a CLSPN claspin HGNC:19715 details
hsa-miR-4477a MRPL58 mitochondrial ribosomal protein L58 HGNC:5359 details
hsa-miR-4477a ARF3 ADP ribosylation factor 3 HGNC:654 details
hsa-miR-4477a SMOC1 SPARC related modular calcium binding 1 HGNC:20318 details
hsa-miR-4477a PURB purine rich element binding protein B HGNC:9702 details
hsa-miR-4477a PPP6C protein phosphatase 6 catalytic subunit HGNC:9323 details
hsa-miR-4477a MED13 mediator complex subunit 13 HGNC:22474 details
hsa-miR-4477a GOLIM4 golgi integral membrane protein 4 HGNC:15448 details
hsa-miR-4477a CRNKL1 crooked neck pre-mRNA splicing factor 1 HGNC:15762 details
hsa-miR-4477a ACSL4 acyl-CoA synthetase long chain family member 4 HGNC:3571 details
hsa-miR-4477a LLGL2 LLGL scribble cell polarity complex component 2 HGNC:6629 details
hsa-miR-4477a RPS3 ribosomal protein S3 HGNC:10420 details
hsa-miR-4477a TRIM8 tripartite motif containing 8 HGNC:15579 details
hsa-miR-4477a MRFAP1 Morf4 family associated protein 1 HGNC:24549 details
hsa-miR-4477a LIMS1 LIM zinc finger domain containing 1 HGNC:6616 details
hsa-miR-4477a HOXA13 homeobox A13 HGNC:5102 details
hsa-miR-4477a FEM1B fem-1 homolog B HGNC:3649 details
hsa-miR-4477a ELK4 ETS transcription factor ELK4 HGNC:3326 details
hsa-miR-4477a CD2AP CD2 associated protein HGNC:14258 details
hsa-miR-4477a CCNE1 cyclin E1 HGNC:1589 details
hsa-miR-4477a CBX5 chromobox 5 HGNC:1555 details
hsa-miR-4477a BRAP BRCA1 associated protein HGNC:1099 details
hsa-miR-4477a PRNP prion protein HGNC:9449 details
hsa-miR-4477a GAL3ST3 galactose-3-O-sulfotransferase 3 HGNC:24144 details
hsa-miR-4477a PPIF peptidylprolyl isomerase F HGNC:9259 details
hsa-miR-4477a YDJC YdjC chitooligosaccharide deacetylase homolog HGNC:27158 details
hsa-miR-4477a CEBPB CCAAT enhancer binding protein beta HGNC:1834 details
hsa-miR-4477a TRMT5 tRNA methyltransferase 5 HGNC:23141 details
hsa-miR-4477a ZNF703 zinc finger protein 703 HGNC:25883 details
hsa-miR-4477a AZF1 azoospermia factor 1 HGNC:908 details
hsa-miR-4477a SLC6A8 solute carrier family 6 member 8 HGNC:11055 details
hsa-miR-4477a SCML2 Scm polycomb group protein like 2 HGNC:10581 details
hsa-miR-4477a LRRC58 leucine rich repeat containing 58 HGNC:26968 details
hsa-miR-4477a LEPROT leptin receptor overlapping transcript HGNC:29477 details
hsa-miR-4477a HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 HGNC:5033 details
hsa-miR-4477a HMGN2 high mobility group nucleosomal binding domain 2 HGNC:4986 details
hsa-miR-4477a FOXC1 forkhead box C1 HGNC:3800 details
hsa-miR-4477a CHSY1 chondroitin sulfate synthase 1 HGNC:17198 details
hsa-miR-4477a ARF6 ADP ribosylation factor 6 HGNC:659 details
hsa-miR-4477a ABHD13 abhydrolase domain containing 13 HGNC:20293 details
hsa-miR-4477a AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase HGNC:14235 details
hsa-miR-4477a PHF19 PHD finger protein 19 HGNC:24566 details
hsa-miR-4477a CDADC1 cytidine and dCMP deaminase domain containing 1 HGNC:20299 details
hsa-miR-4477a RBM23 RNA binding motif protein 23 HGNC:20155 details
hsa-miR-4477a SSX5 SSX family member 5 HGNC:11339 details
hsa-miR-4477a UGT8 UDP glycosyltransferase 8 HGNC:12555 details
hsa-miR-4477a SLFN13 schlafen family member 13 HGNC:26481 details
hsa-miR-4477a CEP135 centrosomal protein 135 HGNC:29086 details
hsa-miR-4477a JRKL JRK like HGNC:6200 details
hsa-miR-4477a MLLT6 MLLT6, PHD finger containing HGNC:7138 details
hsa-miR-4477a HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 HGNC:5031 details
hsa-miR-4477a PRR15L proline rich 15 like HGNC:28149 details
hsa-miR-4477a MBOAT2 membrane bound O-acyltransferase domain containing 2 HGNC:25193 details
hsa-miR-4477a GPATCH11 G-patch domain containing 11 HGNC:26768 details
hsa-miR-4477a C4orf3 chromosome 4 open reading frame 3 HGNC:19225 details
hsa-miR-4477a MEMO1 mediator of cell motility 1 HGNC:14014 details
hsa-miR-4477a WNT16 Wnt family member 16 HGNC:16267 details
hsa-miR-4477a UEVLD UEV and lactate/malate dehyrogenase domains HGNC:30866 details
hsa-miR-4477a TRIM33 tripartite motif containing 33 HGNC:16290 details
hsa-miR-4477a SLC38A7 solute carrier family 38 member 7 HGNC:25582 details
hsa-miR-4477a XRN2 5'-3' exoribonuclease 2 HGNC:12836 details
hsa-miR-4477a UTP18 UTP18 small subunit processome component HGNC:24274 details
hsa-miR-4477a WNK1 WNK lysine deficient protein kinase 1 HGNC:14540 details
hsa-miR-4477a ERCC6 ERCC excision repair 6, chromatin remodeling factor HGNC:3438 details
hsa-miR-4477a CLIP1 CAP-Gly domain containing linker protein 1 HGNC:10461 details
hsa-miR-4477a BBOX1 gamma-butyrobetaine hydroxylase 1 HGNC:964 details
hsa-miR-4477a KBTBD6 kelch repeat and BTB domain containing 6 HGNC:25340 details
hsa-miR-4477a SGCD sarcoglycan delta HGNC:10807 details
hsa-miR-4477a DCAF17 DDB1 and CUL4 associated factor 17 HGNC:25784 details
hsa-miR-4477a GPBP1 GC-rich promoter binding protein 1 HGNC:29520 details
hsa-miR-4477a GLUD1 glutamate dehydrogenase 1 HGNC:4335 details
hsa-miR-4477a CRK CRK proto-oncogene, adaptor protein HGNC:2362 details
hsa-miR-4477a DLGAP3 DLG associated protein 3 HGNC:30368 details
hsa-miR-4477a GRB10 growth factor receptor bound protein 10 HGNC:4564 details
hsa-miR-4477a RPS24 ribosomal protein S24 HGNC:10411 details
hsa-miR-4477a GINM1 glycoprotein integral membrane 1 HGNC:21074 details
hsa-miR-4477a RBM4B RNA binding motif protein 4B HGNC:28842 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab