miRNA Card

miRNA General Information
miRNA ID hsa-miR-4477b
Description Homo sapiens miR-4477b stem-loop
Comment None
Experiment Illumina [1]
Sequence AUUAAGGACAUUUGUGAUUGAU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr6:32826648|32826954 hsa-miR-4477b 1 0 0
chr12:109450362|109450480 hsa-miR-4477b 1 0 0
chr6:43784652|43784706 hsa-miR-4477b 0 1 0
chr11:46369314|46369456 hsa-miR-4477b 0 1 0
chr11:57816852|57817044 hsa-miR-4477b 0 1 0
chr5:135571022|135571222 hsa-miR-4477b 0 1 0
chr14:22879648|22879736 hsa-miR-4477b 0 1 0
chr5:128186576|128186675 hsa-miR-4477b 0 1 0
chr15:64160104|64162088 hsa-miR-4477b 0 1 0
chr4:86453030|86453181 hsa-miR-4477b 0 1 0
chr15:40393725|40393814 hsa-miR-4477b 0 1 0
chr19:57780395|57780542 hsa-miR-4477b 0 1 0
chr1:47046467|47048591 hsa-miR-4477b 0 1 0
chr17:65013802|65014002 hsa-miR-4477b 0 1 0
chr13:47933928|47934141 hsa-miR-4477b 0 1 0
chr19:34355154|34355276 hsa-miR-4477b 0 1 0
chr20:25294170~25294292 hsa-miR-4477b 0 1 0
chr7:30082725~30082827 hsa-miR-4477b 0 1 0
chr17:47292193~47292330 hsa-miR-4477b 0 1 0
chr6:159680183~159680308 hsa-miR-4477b 0 1 0
chr22:28000488~28000610 hsa-miR-4477b 0 1 0
chr11:57816950~57817068 hsa-miR-4477b 0 1 0
chr3:46448978~46449975 hsa-miR-4477b 0 1 0
chr15:64160104~64162117 hsa-miR-4477b 0 1 0
chr2:60923712~60924010 hsa-miR-4477b 0 1 0
chr16:53328812~53328932 hsa-miR-4477b 0 1 0
chr10:100151028~100151131 hsa-miR-4477b 0 1 0
chr10:131978231|131978438 hsa-miR-4477b 0 1 0
chr17:58274421|58274530 hsa-miR-4477b 0 1 0
chr17:58274419|58274582 hsa-miR-4477b 0 1 0
chr2:224521810|224521932 hsa-miR-4477b 0 1 0
chr1:40392677|40392854 hsa-miR-4477b 0 1 0
chr9:136218679|136218801 hsa-miR-4477b 0 1 0
chr5:139389398|139389482 hsa-miR-4477b 0 1 0
chr11:46375885|46376049 hsa-miR-4477b 0 1 0
chr19:34299869|34300050 hsa-miR-4477b 0 1 0
chr12:109450362|109450492 hsa-miR-4477b 1 0 0
chr18:58322446|58323334 hsa-miR-4477b 1 0 0
chr10:1080011|1080476 hsa-miR-4477b 1 0 0
chr20:25294170|25294292 hsa-miR-4477b 0 1 0
chr2:179104988|179105104 hsa-miR-4477b 0 1 0
chr15:64160104|64162117 hsa-miR-4477b 0 1 0
chr2:38981929|38982034 hsa-miR-4477b 0 1 0
chr20:49287941|49288073 hsa-miR-4477b 0 1 0
chr11:79069722|79069932 hsa-miR-4477b 0 1 0
chr13:50010549|50010705 hsa-miR-4477b 0 1 0
chr5:128186572|128186653 hsa-miR-4477b 0 1 0
chr4:55494331|55494468 hsa-miR-4477b 0 1 0
chr15:64160104|64162129 hsa-miR-4477b 0 1 0
chr21:32316605|32316755 hsa-miR-4477b 0 1 0
chr3:86939671|86939785 hsa-miR-4477b 0 1 0
chr1:78398951|78399025 hsa-miR-4477b 0 1 0
chr12:32607957|32611283 hsa-miR-4477b 0 1 0
chr16:53328812|53328932 hsa-miR-4477b 0 1 0
chr6:159680256|159680433 hsa-miR-4477b 0 1 0
chr11:57816921|57817044 hsa-miR-4477b 0 1 0
chr10:100151028|100151131 hsa-miR-4477b 0 1 0
chr15:79889093|79889278 hsa-miR-4477b 0 1 0
chr5:175929095|175929229 hsa-miR-4477b 0 1 0
chr21:32316596|32316750 hsa-miR-4477b 0 1 0
chr1:109401938|109402086 hsa-miR-4477b 0 1 0
chr14:81176379|81176552 hsa-miR-4477b 0 1 0
chr6:159680256|159680423 hsa-miR-4477b 0 1 0
chr17:46768623|46768739 hsa-miR-4477b 0 1 0
chr15:64160104|64160193 hsa-miR-4477b 0 1 0
chr16:2900472|2900670 hsa-miR-4477b 0 1 0
chr17:47292187|47292330 hsa-miR-4477b -2 1 0
chr11:64859924|64860112 hsa-miR-4477b -9 1 0
chr13:53050798|53051010 hsa-miR-4477b 1 0 0
chr12:109450362|109450483 hsa-miR-4477b 1 0 0
chr13:53050848|53051010 hsa-miR-4477b 1 0 0
chr20:62397312|62397391 hsa-miR-4477b 0 1 0
chrX:19355482|19357682 hsa-miR-4477b 0 1 0
chr17:40130684|40130790 hsa-miR-4477b 0 1 0
chr16:265541|265777 hsa-miR-4477b 0 1 0
chr6:159680256|159680367 hsa-miR-4477b 0 1 0
chr17:62065675|62065802 hsa-miR-4477b 0 1 0
chr2:47806626|47806900 hsa-miR-4477b 0 1 0
chr19:7267601|7267771 hsa-miR-4477b 0 1 0
chr12:56712850|56712908 hsa-miR-4477b 0 1 0
chr2:232548680|232548873 hsa-miR-4477b 0 1 0
chr7:142445887|142446036 hsa-miR-4477b 0 1 0
chr12:11892851|11892973 hsa-miR-4477b 1 0 0
chr15:74898088|74898236 hsa-miR-4477b 1 0 0
chr12:109450362|109450497 hsa-miR-4477b 1 0 0
chr12:54284645|54284844 hsa-miR-4477b 1 0 0
chr8:140530975|140531148 hsa-miR-4477b 1 0 0
chr3:197128510|197128761 hsa-miR-4477b 1 0 0
chr6:138089841|138089953 hsa-miR-4477b 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4477b details
hsa-miR-4477b UNC5C unc-5 netrin receptor C HGNC:12569 details
hsa-miR-4477b TSC22D2 TSC22 domain family member 2 HGNC:29095 details
hsa-miR-4477b ATAD5 ATPase family AAA domain containing 5 HGNC:25752 details
hsa-miR-4477b RPL30 ribosomal protein L30 HGNC:10333 details
hsa-miR-4477b COMMD5 COMM domain containing 5 HGNC:17902 details
hsa-miR-4477b QRFPR pyroglutamylated RFamide peptide receptor HGNC:15565 details
hsa-miR-4477b CRB1 crumbs cell polarity complex component 1 HGNC:2343 details
hsa-miR-4477b SETX senataxin HGNC:445 details
hsa-miR-4477b RDH10 retinol dehydrogenase 10 HGNC:19975 details
hsa-miR-4477b PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 HGNC:8575 details
hsa-miR-4477b GID4 GID complex subunit 4 homolog HGNC:28453 details
hsa-miR-4477b details
hsa-miR-4477b DDX6 DEAD-box helicase 6 HGNC:2747 details
hsa-miR-4477b CAPRIN2 caprin family member 2 HGNC:21259 details
hsa-miR-4477b CAND1 cullin associated and neddylation dissociated 1 HGNC:30688 details
hsa-miR-4477b CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase HGNC:1424 details
hsa-miR-4477b TYRP1 tyrosinase related protein 1 HGNC:12450 details
hsa-miR-4477b TERF2IP TERF2 interacting protein HGNC:19246 details
hsa-miR-4477b SPRY1 sprouty RTK signaling antagonist 1 HGNC:11269 details
hsa-miR-4477b POC1B-GALNT4 POC1B-GALNT4 readthrough HGNC:42957 details
hsa-miR-4477b GALNT4 polypeptide N-acetylgalactosaminyltransferase 4 HGNC:4126 details
hsa-miR-4477b CAB39 calcium binding protein 39 HGNC:20292 details
hsa-miR-4477b details
hsa-miR-4477b BUB3 BUB3 mitotic checkpoint protein HGNC:1151 details
hsa-miR-4477b HSPA13 heat shock protein family A (Hsp70) member 13 HGNC:11375 details
hsa-miR-4477b ZBTB47 zinc finger and BTB domain containing 47 HGNC:26955 details
hsa-miR-4477b details
hsa-miR-4477b ARPP19 cAMP regulated phosphoprotein 19 HGNC:16967 details
hsa-miR-4477b ZNF626 zinc finger protein 626 HGNC:30461 details
hsa-miR-4477b TPM4 tropomyosin 4 HGNC:12013 details
hsa-miR-4477b PTGDR prostaglandin D2 receptor HGNC:9591 details
hsa-miR-4477b MAML3 mastermind like transcriptional coactivator 3 HGNC:16272 details
hsa-miR-4477b GOLGA3 golgin A3 HGNC:4426 details
hsa-miR-4477b CLDN12 claudin 12 HGNC:2034 details
hsa-miR-4477b COCH cochlin HGNC:2180 details
hsa-miR-4477b HDGFL3 HDGF like 3 HGNC:24937 details
hsa-miR-4477b GFPT1 glutamine--fructose-6-phosphate transaminase 1 HGNC:4241 details
hsa-miR-4477b E2F8 E2F transcription factor 8 HGNC:24727 details
hsa-miR-4477b ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 HGNC:689 details
hsa-miR-4477b ZNF267 zinc finger protein 267 HGNC:13060 details
hsa-miR-4477b RNF138 ring finger protein 138 HGNC:17765 details
hsa-miR-4477b RNF11 ring finger protein 11 HGNC:10056 details
hsa-miR-4477b PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase HGNC:8728 details
hsa-miR-4477b EFCAB14 EF-hand calcium binding domain 14 HGNC:29051 details
hsa-miR-4477b CNOT6L CCR4-NOT transcription complex subunit 6 like HGNC:18042 details
hsa-miR-4477b EIF2S2 eukaryotic translation initiation factor 2 subunit beta HGNC:3266 details
hsa-miR-4477b GTF3C4 general transcription factor IIIC subunit 4 HGNC:4667 details
hsa-miR-4477b SDE2 SDE2 telomere maintenance homolog HGNC:26643 details
hsa-miR-4477b PTBP1 polypyrimidine tract binding protein 1 HGNC:9583 details
hsa-miR-4477b NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-4477b GNG5 G protein subunit gamma 5 HGNC:4408 details
hsa-miR-4477b GNG12 G protein subunit gamma 12 HGNC:19663 details
hsa-miR-4477b ANP32E acidic nuclear phosphoprotein 32 family member E HGNC:16673 details
hsa-miR-4477b CMTM6 CKLF like MARVEL transmembrane domain containing 6 HGNC:19177 details
hsa-miR-4477b TGFBR3 transforming growth factor beta receptor 3 HGNC:11774 details
hsa-miR-4477b TFCP2 transcription factor CP2 HGNC:11748 details
hsa-miR-4477b AAGAB alpha and gamma adaptin binding protein HGNC:25662 details
hsa-miR-4477b MYADM myeloid associated differentiation marker HGNC:7544 details
hsa-miR-4477b NEBL nebulette HGNC:16932 details
hsa-miR-4477b CD1D CD1d molecule HGNC:1637 details
hsa-miR-4477b C15orf40 chromosome 15 open reading frame 40 HGNC:28443 details
hsa-miR-4477b TP63 tumor protein p63 HGNC:15979 details
hsa-miR-4477b TAOK1 TAO kinase 1 HGNC:29259 details
hsa-miR-4477b MYO10 myosin X HGNC:7593 details
hsa-miR-4477b JARID2 jumonji and AT-rich interaction domain containing 2 HGNC:6196 details
hsa-miR-4477b EIF5A2 eukaryotic translation initiation factor 5A2 HGNC:3301 details
hsa-miR-4477b BLOC1S5 biogenesis of lysosomal organelles complex 1 subunit 5 HGNC:18561 details
hsa-miR-4477b ANAPC1 anaphase promoting complex subunit 1 HGNC:19988 details
hsa-miR-4477b ZBTB3 zinc finger and BTB domain containing 3 HGNC:22918 details
hsa-miR-4477b AZF1 azoospermia factor 1 HGNC:908 details
hsa-miR-4477b RUFY2 RUN and FYVE domain containing 2 HGNC:19761 details
hsa-miR-4477b RNF38 ring finger protein 38 HGNC:18052 details
hsa-miR-4477b COL13A1 collagen type XIII alpha 1 chain HGNC:2190 details
hsa-miR-4477b PSME4 proteasome activator subunit 4 HGNC:20635 details
hsa-miR-4477b ZBTB8B zinc finger and BTB domain containing 8B HGNC:37057 details
hsa-miR-4477b EIF1AD eukaryotic translation initiation factor 1A domain containing HGNC:28147 details
hsa-miR-4477b KDM2A lysine demethylase 2A HGNC:13606 details
hsa-miR-4477b NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 HGNC:29923 details
hsa-miR-4477b AIDA axin interactor, dorsalization associated HGNC:25761 details
hsa-miR-4477b B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 HGNC:28596 details
hsa-miR-4477b KPNA4 karyopherin subunit alpha 4 HGNC:6397 details
hsa-miR-4477b MDH2 malate dehydrogenase 2 HGNC:6971 details
hsa-miR-4477b NAA10 N-alpha-acetyltransferase 10, NatA catalytic subunit HGNC:18704 details
hsa-miR-4477b PSENEN presenilin enhancer, gamma-secretase subunit HGNC:30100 details
hsa-miR-4477b RHOF ras homolog family member F, filopodia associated HGNC:15703 details
hsa-miR-4477b SPRYD4 SPRY domain containing 4 HGNC:27468 details
hsa-miR-4477b TCAIM T cell activation inhibitor, mitochondrial HGNC:25241 details
hsa-miR-4477b ARSD arylsulfatase D HGNC:717 details
hsa-miR-4477b NT5C2 5'-nucleotidase, cytosolic II HGNC:8022 details
hsa-miR-4477b OSBPL6 oxysterol binding protein like 6 HGNC:16388 details
hsa-miR-4477b TEX22 testis expressed 22 HGNC:40026 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab