miRNA Card

miRNA General Information
miRNA ID hsa-miR-4495
Description Homo sapiens miR-4495 stem-loop
Comment None
Experiment Illumina [1]
Sequence AAUGUAAACAGGCUUUUUGCU
miRNA Expression in different cancers


circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr11:116859339|116859541 hsa-miR-4495 0 1 0
chr11:63760155|63760356 hsa-miR-4495 1 0 0
chr11:13011622|13011936 hsa-miR-4495 0 1 0
chr15:90228880|90229053 hsa-miR-4495 0 1 0
chr6:32979860|32980100 hsa-miR-4495 0 1 0
chr1:109594100|109594289 hsa-miR-4495 0 1 0
chrX:51895455|51895656 hsa-miR-4495 0 1 0
chr22:40334504|40334778 hsa-miR-4495 0 1 0
chr8:46155644|46155815 hsa-miR-4495 0 1 0
chr17:41867684|41867800 hsa-miR-4495 0 1 0
chr17:41867684~41867806 hsa-miR-4495 0 1 0
chr1:32773253~32773431 hsa-miR-4495 0 1 0
chr21:26840418~26840501 hsa-miR-4495 0 1 0
chr10:22608427|22608563 hsa-miR-4495 0 1 0
chr22:31336134|31336294 hsa-miR-4495 0 1 0
chr3:50102606|50102738 hsa-miR-4495 0 1 0
chr20:6000303|6000447 hsa-miR-4495 0 1 0
chr18:58919927|58920087 hsa-miR-4495 0 1 0
chr17:41867684|41867872 hsa-miR-4495 0 1 0
chr12:47841645|47841770 hsa-miR-4495 0 1 0
chr18:58696366|58700591 hsa-miR-4495 0 1 0
chrX:51895532|51895656 hsa-miR-4495 0 1 0
chr7:65960770|65960954 hsa-miR-4495 0 1 0
chr11:82689607|82689799 hsa-miR-4495 0 1 0
chr18:58919906|58920155 hsa-miR-4495 0 1 0
chr3:183683353|183683589 hsa-miR-4495 0 1 0
chrX:51895575|51895760 hsa-miR-4495 0 1 0
chr17:41867684|41867806 hsa-miR-4495 0 1 0
chr12:112022467|112022676 hsa-miR-4495 0 1 0
chr12:112022413|112022676 hsa-miR-4495 0 1 0
chr19:39863433|39863664 hsa-miR-4495 0 1 0
chr19:39863427|39863763 hsa-miR-4495 0 1 0
chr16:15703286|15703598 hsa-miR-4495 0 1 0
chr3:32526661|32526783 hsa-miR-4495 0 1 0
chr8:8784700|8784840 hsa-miR-4495 0 1 0
chr3:113809728|113809833 hsa-miR-4495 0 1 0
chr20:35740484|35740849 hsa-miR-4495 0 1 0
chr16:15703286|15703441 hsa-miR-4495 0 1 0
chr5:108364738|108364957 hsa-miR-4495 0 1 0
chrX:51895575|51895656 hsa-miR-4495 0 1 0
chr22:38992468|38992575 hsa-miR-4495 0 1 0
chr16:15703286|15703455 hsa-miR-4495 0 1 0
chr12:112022525|112022676 hsa-miR-4495 0 1 0
chr12:112022443|112022676 hsa-miR-4495 0 1 0
chr8:81658142|81658256 hsa-miR-4495 0 1 0
chr11:7997181|7997281 hsa-miR-4495 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4495 ZBTB10 zinc finger and BTB domain containing 10 HGNC:30953 details
hsa-miR-4495 SUB1 SUB1 regulator of transcription HGNC:19985 details
hsa-miR-4495 GTF2H5 general transcription factor IIH subunit 5 HGNC:21157 details
hsa-miR-4495 ASXL2 ASXL transcriptional regulator 2 HGNC:23805 details
hsa-miR-4495 CCDC74B coiled-coil domain containing 74B HGNC:25267 details
hsa-miR-4495 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 HGNC:5030 details
hsa-miR-4495 CCDC74A coiled-coil domain containing 74A HGNC:25197 details
hsa-miR-4495 SH3TC2 SH3 domain and tetratricopeptide repeats 2 HGNC:29427 details
hsa-miR-4495 TGFA transforming growth factor alpha HGNC:11765 details
hsa-miR-4495 GLO1 glyoxalase I HGNC:4323 details
hsa-miR-4495 UBE2K ubiquitin conjugating enzyme E2 K HGNC:4914 details
hsa-miR-4495 SEC61A2 SEC61 translocon subunit alpha 2 HGNC:17702 details
hsa-miR-4495 ROCK2 Rho associated coiled-coil containing protein kinase 2 HGNC:10252 details
hsa-miR-4495 NCOA3 nuclear receptor coactivator 3 HGNC:7670 details
hsa-miR-4495 GNA13 G protein subunit alpha 13 HGNC:4381 details
hsa-miR-4495 PPP2R1B protein phosphatase 2 scaffold subunit Abeta HGNC:9303 details
hsa-miR-4495 ZNF449 zinc finger protein 449 HGNC:21039 details
hsa-miR-4495 SPRED1 sprouty related EVH1 domain containing 1 HGNC:20249 details
hsa-miR-4495 SLC16A6 solute carrier family 16 member 6 HGNC:10927 details
hsa-miR-4495 SHOC2 SHOC2 leucine rich repeat scaffold protein HGNC:15454 details
hsa-miR-4495 SFXN1 sideroflexin 1 HGNC:16085 details
hsa-miR-4495 PHF13 PHD finger protein 13 HGNC:22983 details
hsa-miR-4495 ORMDL1 ORMDL sphingolipid biosynthesis regulator 1 HGNC:16036 details
hsa-miR-4495 TSPAN1 tetraspanin 1 HGNC:20657 details
hsa-miR-4495 LARP1 La ribonucleoprotein 1, translational regulator HGNC:29531 details
hsa-miR-4495 EIF1AX eukaryotic translation initiation factor 1A X-linked HGNC:3250 details
hsa-miR-4495 details
hsa-miR-4495 B2M beta-2-microglobulin HGNC:914 details
hsa-miR-4495 AZIN1 antizyme inhibitor 1 HGNC:16432 details
hsa-miR-4495 ALG9 ALG9 alpha-1,2-mannosyltransferase HGNC:15672 details
hsa-miR-4495 PTP4A1 protein tyrosine phosphatase 4A1 HGNC:9634 details
hsa-miR-4495 SOCS1 suppressor of cytokine signaling 1 HGNC:19383 details
hsa-miR-4495 POLR3E RNA polymerase III subunit E HGNC:30347 details
hsa-miR-4495 PTMA prothymosin alpha HGNC:9623 details
hsa-miR-4495 PRMT3 protein arginine methyltransferase 3 HGNC:30163 details
hsa-miR-4495 THBS1 thrombospondin 1 HGNC:11785 details
hsa-miR-4495 SYPL1 synaptophysin like 1 HGNC:11507 details
hsa-miR-4495 GINS4 GINS complex subunit 4 HGNC:28226 details
hsa-miR-4495 PGBD4 piggyBac transposable element derived 4 HGNC:19401 details
hsa-miR-4495 NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-4495 HIC2 HIC ZBTB transcriptional repressor 2 HGNC:18595 details
hsa-miR-4495 AMD1 adenosylmethionine decarboxylase 1 HGNC:457 details
hsa-miR-4495 CD226 CD226 molecule HGNC:16961 details
hsa-miR-4495 F2RL1 F2R like trypsin receptor 1 HGNC:3538 details
hsa-miR-4495 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 HGNC:9108 details
hsa-miR-4495 NRF1 nuclear respiratory factor 1 HGNC:7996 details
hsa-miR-4495 details
hsa-miR-4495 SOD2 superoxide dismutase 2 HGNC:11180 details
hsa-miR-4495 DCLRE1C DNA cross-link repair 1C HGNC:17642 details
hsa-miR-4495 TYW5 tRNA-yW synthesizing protein 5 HGNC:26754 details
hsa-miR-4495 RBM22 RNA binding motif protein 22 HGNC:25503 details
hsa-miR-4495 TFDP1 transcription factor Dp-1 HGNC:11749 details
hsa-miR-4495 MIPOL1 mirror-image polydactyly 1 HGNC:21460 details
hsa-miR-4495 ARHGAP15 Rho GTPase activating protein 15 HGNC:21030 details
hsa-miR-4495 NPPC natriuretic peptide C HGNC:7941 details
hsa-miR-4495 MYBPC1 myosin binding protein C1 HGNC:7549 details
hsa-miR-4495 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon HGNC:12851 details
hsa-miR-4495 UNKL unk like zinc finger HGNC:14184 details
hsa-miR-4495 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D HGNC:28759 details
hsa-miR-4495 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 HGNC:16809 details
hsa-miR-4495 SKIDA1 SKI/DACH domain containing 1 HGNC:32697 details
hsa-miR-4495 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 HGNC:30449 details
hsa-miR-4495 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 HGNC:20610 details
hsa-miR-4495 FNBP1L formin binding protein 1 like HGNC:20851 details
hsa-miR-4495 details
hsa-miR-4495 ERRFI1 ERBB receptor feedback inhibitor 1 HGNC:18185 details
hsa-miR-4495 TTLL11 tubulin tyrosine ligase like 11 HGNC:18113 details
hsa-miR-4495 SIKE1 suppressor of IKBKE 1 HGNC:26119 details
hsa-miR-4495 ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-4495 XPO1 exportin 1 HGNC:12825 details
hsa-miR-4495 RAP1B RAP1B, member of RAS oncogene family HGNC:9857 details
hsa-miR-4495 PLRG1 pleiotropic regulator 1 HGNC:9089 details
hsa-miR-4495 NETO2 neuropilin and tolloid like 2 HGNC:14644 details
hsa-miR-4495 KBTBD6 kelch repeat and BTB domain containing 6 HGNC:25340 details
hsa-miR-4495 HSPA13 heat shock protein family A (Hsp70) member 13 HGNC:11375 details
hsa-miR-4495 FBXW7 F-box and WD repeat domain containing 7 HGNC:16712 details
hsa-miR-4495 DR1 down-regulator of transcription 1 HGNC:3017 details
hsa-miR-4495 C5orf51 chromosome 5 open reading frame 51 HGNC:27750 details
hsa-miR-4495 APP amyloid beta precursor protein HGNC:620 details
hsa-miR-4495 MMADHC metabolism of cobalamin associated D HGNC:25221 details
hsa-miR-4495 UEVLD UEV and lactate/malate dehyrogenase domains HGNC:30866 details
hsa-miR-4495 SUPT7L SPT7 like, STAGA complex subunit gamma HGNC:30632 details
hsa-miR-4495 SRSF10 serine and arginine rich splicing factor 10 HGNC:16713 details
hsa-miR-4495 PDCD10 programmed cell death 10 HGNC:8761 details
hsa-miR-4495 NHLRC3 NHL repeat containing 3 HGNC:33751 details
hsa-miR-4495 KIF11 kinesin family member 11 HGNC:6388 details
hsa-miR-4495 HOXB3 homeobox B3 HGNC:5114 details
hsa-miR-4495 FOXN2 forkhead box N2 HGNC:5281 details
hsa-miR-4495 CDCA4 cell division cycle associated 4 HGNC:14625 details
hsa-miR-4495 C5orf24 chromosome 5 open reading frame 24 HGNC:26746 details
hsa-miR-4495 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB HGNC:13652 details
hsa-miR-4495 COMMD3-BMI1 COMMD3-BMI1 readthrough HGNC:48326 details
hsa-miR-4495 BMI1 BMI1 proto-oncogene, polycomb ring finger HGNC:1066 details
hsa-miR-4495 ZNF507 zinc finger protein 507 HGNC:23783 details
hsa-miR-4495 LSM12 LSM12 homolog HGNC:26407 details
hsa-miR-4495 LCLAT1 lysocardiolipin acyltransferase 1 HGNC:26756 details
hsa-miR-4495 PM20D2 peptidase M20 domain containing 2 HGNC:21408 details
hsa-miR-4495 TRIM71 tripartite motif containing 71 HGNC:32669 details
hsa-miR-4495 SCML2 Scm polycomb group protein like 2 HGNC:10581 details
hsa-miR-4495 IGFBP5 insulin like growth factor binding protein 5 HGNC:5474 details
hsa-miR-4495 FOXK1 forkhead box K1 HGNC:23480 details
hsa-miR-4495 EIF5 eukaryotic translation initiation factor 5 HGNC:3299 details
hsa-miR-4495 B4GALT5 beta-1,4-galactosyltransferase 5 HGNC:928 details
hsa-miR-4495 AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-4495 WDR26 WD repeat domain 26 HGNC:21208 details
hsa-miR-4495 QSER1 glutamine and serine rich 1 HGNC:26154 details
hsa-miR-4495 RBM12B RNA binding motif protein 12B HGNC:32310 details
hsa-miR-4495 CD36 CD36 molecule HGNC:1663 details
hsa-miR-4495 TUBD1 tubulin delta 1 HGNC:16811 details
hsa-miR-4495 BRD4 bromodomain containing 4 HGNC:13575 details
hsa-miR-4495 RAB11FIP1 RAB11 family interacting protein 1 HGNC:30265 details
hsa-miR-4495 GIN1 gypsy retrotransposon integrase 1 HGNC:25959 details
hsa-miR-4495 FAM182B family with sequence similarity 182 member B HGNC:34503 details
hsa-miR-4495 details
hsa-miR-4495 LIPG lipase G, endothelial type HGNC:6623 details
hsa-miR-4495 ABCB7 ATP binding cassette subfamily B member 7 HGNC:48 details
hsa-miR-4495 FSD1L fibronectin type III and SPRY domain containing 1 like HGNC:13753 details
hsa-miR-4495 PHTF2 putative homeodomain transcription factor 2 HGNC:13411 details
hsa-miR-4495 MAP1LC3B microtubule associated protein 1 light chain 3 beta HGNC:13352 details
hsa-miR-4495 ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 HGNC:812 details
hsa-miR-4495 ADM adrenomedullin HGNC:259 details
hsa-miR-4495 ADAM9 ADAM metallopeptidase domain 9 HGNC:216 details
hsa-miR-4495 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 HGNC:26068 details
hsa-miR-4495 CAPZA2 capping actin protein of muscle Z-line subunit alpha 2 HGNC:1490 details
hsa-miR-4495 CLDN4 claudin 4 HGNC:2046 details
hsa-miR-4495 SGMS1 sphingomyelin synthase 1 HGNC:29799 details
hsa-miR-4495 FEM1A fem-1 homolog A HGNC:16934 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab