miRNA Card

miRNA General Information
miRNA ID hsa-miR-4503
Description Homo sapiens miR-4503 stem-loop
Comment None
Experiment Illumina [1]
Sequence UUUAAGCAGGAAAUAGAAUUUA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr2:112003904|112008413 hsa-miR-4503 0 1 0
chr5:179112246|179112391 hsa-miR-4503 0 1 0
chr1:169464347|169464517 hsa-miR-4503 0 1 0
chr14:93183891|93184069 hsa-miR-4503 0 1 0
chr14:93183891|93184002 hsa-miR-4503 0 1 0
chr21:44850842|44850975 hsa-miR-4503 0 1 0
chr4:185160000|185160215 hsa-miR-4503 0 1 0
chr8:102208005|102208169 hsa-miR-4503 0 1 0
chr9:73167518|73167620 hsa-miR-4503 0 1 0
chr10:60088182|60088315 hsa-miR-4503 0 1 0
chr6:30711941|30712114 hsa-miR-4503 0 1 0
chr7:41961349|41961654 hsa-miR-4503 0 1 0
chr14:55298695~55298828 hsa-miR-4503 0 1 0
chr15:43193126~43193268 hsa-miR-4503 0 1 0
chr11:70188490~70188821 hsa-miR-4503 0 1 0
chr3:128807564~128813343 hsa-miR-4503 0 1 0
chr8:102208005~102208169 hsa-miR-4503 0 1 0
chr4:139110585|139110772 hsa-miR-4503 0 1 0
chr1:243221724|243225321 hsa-miR-4503 0 1 0
chr8:19851884|19851976 hsa-miR-4503 0 1 0
chr10:100274193|100274387 hsa-miR-4503 0 1 0
chr1:183143244|183143345 hsa-miR-4503 0 1 0
chr9:127108375|127108500 hsa-miR-4503 0 1 0
chr14:93183891|93184072 hsa-miR-4503 0 1 0
chr1:160485577|160485712 hsa-miR-4503 0 1 0
chr14:93183887|93183973 hsa-miR-4503 0 1 0
chr21:44850737|44851056 hsa-miR-4503 0 1 0
chr1:37499098|37499231 hsa-miR-4503 0 1 0
chr1:154602414|154602564 hsa-miR-4503 0 1 0
chr12:1289852|1290012 hsa-miR-4503 0 1 0
chr7:74758791|74758915 hsa-miR-4503 0 1 0
chr2:187464911|187465064 hsa-miR-4503 0 1 0
chr20:33811550|33811658 hsa-miR-4503 0 1 0
chr14:55298728|55298828 hsa-miR-4503 0 1 0
chr1:154602333|154602602 hsa-miR-4503 0 1 0
chr3:30681605|30681661 hsa-miR-4503 0 1 0
chr2:12742033|12742209 hsa-miR-4503 0 1 0
chr1:154602411|154602560 hsa-miR-4503 -8 1 0
chr1:204221747|204222035 hsa-miR-4503 1 0 0
chr1:154602432|154602560 hsa-miR-4503 0 1 0
chr14:93183821|93183973 hsa-miR-4503 0 1 0
chr19:9413957|9414125 hsa-miR-4503 0 1 0
chr11:70188440|70188738 hsa-miR-4503 0 1 0
chr12:57516664|57516909 hsa-miR-4503 0 1 0
chr6:36139374|36139534 hsa-miR-4503 0 1 0
chr2:27371636|27371847 hsa-miR-4503 0 1 0
chr14:22946562|22946695 hsa-miR-4503 0 1 0
chr8:97725657|97726030 hsa-miR-4503 0 1 0
chr9:100451294|100451495 hsa-miR-4503 0 1 0
chr7:55411929|55412082 hsa-miR-4503 0 1 0
chr14:55298725|55298828 hsa-miR-4503 0 1 0
chr6:13621696|13621790 hsa-miR-4503 0 1 0
chr9:124964816|124964970 hsa-miR-4503 0 1 0
chr1:228744961|228745110 hsa-miR-4503 0 1 0
chr2:112830430|112830573 hsa-miR-4503 0 1 0
chr12:107712132|107712246 hsa-miR-4503 0 1 0
chrX:65520858|65520973 hsa-miR-4503 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4503 NDRG1 N-myc downstream regulated 1 HGNC:7679 details
hsa-miR-4503 PCBD2 pterin-4 alpha-carbinolamine dehydratase 2 HGNC:24474 details
hsa-miR-4503 VAT1L vesicle amine transport 1 like HGNC:29315 details
hsa-miR-4503 TASP1 taspase 1 HGNC:15859 details
hsa-miR-4503 ERP44 endoplasmic reticulum protein 44 HGNC:18311 details
hsa-miR-4503 PXK PX domain containing serine/threonine kinase like HGNC:23326 details
hsa-miR-4503 G3BP1 G3BP stress granule assembly factor 1 HGNC:30292 details
hsa-miR-4503 FUT11 fucosyltransferase 11 HGNC:19233 details
hsa-miR-4503 AMOTL1 angiomotin like 1 HGNC:17811 details
hsa-miR-4503 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 HGNC:20886 details
hsa-miR-4503 CLTB clathrin light chain B HGNC:2091 details
hsa-miR-4503 PRDM6 PR/SET domain 6 HGNC:9350 details
hsa-miR-4503 IRF4 interferon regulatory factor 4 HGNC:6119 details
hsa-miR-4503 CHD1 chromodomain helicase DNA binding protein 1 HGNC:1915 details
hsa-miR-4503 TSPYL1 TSPY like 1 HGNC:12382 details
hsa-miR-4503 ZBTB34 zinc finger and BTB domain containing 34 HGNC:31446 details
hsa-miR-4503 NHS NHS actin remodeling regulator HGNC:7820 details
hsa-miR-4503 MORF4L1 mortality factor 4 like 1 HGNC:16989 details
hsa-miR-4503 LRIG2 leucine rich repeats and immunoglobulin like domains 2 HGNC:20889 details
hsa-miR-4503 C12orf4 chromosome 12 open reading frame 4 HGNC:1184 details
hsa-miR-4503 PKNOX1 PBX/knotted 1 homeobox 1 HGNC:9022 details
hsa-miR-4503 USP42 ubiquitin specific peptidase 42 HGNC:20068 details
hsa-miR-4503 ZFP14 ZFP14 zinc finger protein HGNC:29312 details
hsa-miR-4503 TRIM71 tripartite motif containing 71 HGNC:32669 details
hsa-miR-4503 PPP1CB protein phosphatase 1 catalytic subunit beta HGNC:9282 details
hsa-miR-4503 MYCN MYCN proto-oncogene, bHLH transcription factor HGNC:7559 details
hsa-miR-4503 GABRA5 gamma-aminobutyric acid type A receptor subunit alpha5 HGNC:4079 details
hsa-miR-4503 PHC3 polyhomeotic homolog 3 HGNC:15682 details
hsa-miR-4503 SEC63 SEC63 homolog, protein translocation regulator HGNC:21082 details
hsa-miR-4503 CLSPN claspin HGNC:19715 details
hsa-miR-4503 ZDHHC16 zinc finger DHHC-type palmitoyltransferase 16 HGNC:20714 details
hsa-miR-4503 RBM7 RNA binding motif protein 7 HGNC:9904 details
hsa-miR-4503 CCND2 cyclin D2 HGNC:1583 details
hsa-miR-4503 WARS2 tryptophanyl tRNA synthetase 2, mitochondrial HGNC:12730 details
hsa-miR-4503 RACGAP1 Rac GTPase activating protein 1 HGNC:9804 details
hsa-miR-4503 LIMS1 LIM zinc finger domain containing 1 HGNC:6616 details
hsa-miR-4503 SESN3 sestrin 3 HGNC:23060 details
hsa-miR-4503 TPD52 tumor protein D52 HGNC:12005 details
hsa-miR-4503 ATXN1 ataxin 1 HGNC:10548 details
hsa-miR-4503 PAOX polyamine oxidase HGNC:20837 details
hsa-miR-4503 SAMD5 sterile alpha motif domain containing 5 HGNC:21180 details
hsa-miR-4503 ACO1 aconitase 1 HGNC:117 details
hsa-miR-4503 SLC16A1 solute carrier family 16 member 1 HGNC:10922 details
hsa-miR-4503 PRPF4 pre-mRNA processing factor 4 HGNC:17349 details
hsa-miR-4503 RABGAP1 RAB GTPase activating protein 1 HGNC:17155 details
hsa-miR-4503 UNC93A unc-93 homolog A HGNC:12570 details
hsa-miR-4503 MPV17L MPV17 mitochondrial inner membrane protein like HGNC:26827 details
hsa-miR-4503 SPOP speckle type BTB/POZ protein HGNC:11254 details
hsa-miR-4503 NADSYN1 NAD synthetase 1 HGNC:29832 details
hsa-miR-4503 CCDC127 coiled-coil domain containing 127 HGNC:30520 details
hsa-miR-4503 IP6K1 inositol hexakisphosphate kinase 1 HGNC:18360 details
hsa-miR-4503 FSTL4 follistatin like 4 HGNC:21389 details
hsa-miR-4503 GALNT6 polypeptide N-acetylgalactosaminyltransferase 6 HGNC:4128 details
hsa-miR-4503 CARD6 caspase recruitment domain family member 6 HGNC:16394 details
hsa-miR-4503 PARD3 par-3 family cell polarity regulator HGNC:16051 details
hsa-miR-4503 UTP18 UTP18 small subunit processome component HGNC:24274 details
hsa-miR-4503 INSIG1 insulin induced gene 1 HGNC:6083 details
hsa-miR-4503 SLC25A27 solute carrier family 25 member 27 HGNC:21065 details
hsa-miR-4503 ZNF398 zinc finger protein 398 HGNC:18373 details
hsa-miR-4503 DCAF17 DDB1 and CUL4 associated factor 17 HGNC:25784 details
hsa-miR-4503 CAPS2 calcyphosine 2 HGNC:16471 details
hsa-miR-4503 MYT1L myelin transcription factor 1 like HGNC:7623 details
hsa-miR-4503 PDS5A PDS5 cohesin associated factor A HGNC:29088 details
hsa-miR-4503 HIGD2A HIG1 hypoxia inducible domain family member 2A HGNC:28311 details
hsa-miR-4503 TK1 thymidine kinase 1 HGNC:11830 details
hsa-miR-4503 CD274 CD274 molecule HGNC:17635 details
hsa-miR-4503 PTP4A1 protein tyrosine phosphatase 4A1 HGNC:9634 details
hsa-miR-4503 MAP3K2 mitogen-activated protein kinase kinase kinase 2 HGNC:6854 details
hsa-miR-4503 MPHOSPH8 M-phase phosphoprotein 8 HGNC:29810 details
hsa-miR-4503 RAB3IP RAB3A interacting protein HGNC:16508 details
hsa-miR-4503 TTC26 tetratricopeptide repeat domain 26 HGNC:21882 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab