miRNA Card

miRNA General Information
miRNA ID hsa-miR-450a-1-3p
Description Homo sapiens miR-450a-1 stem-loop
Comment Xie et al. [1] refer to this sequence by the internal identifier MIR238. The sequence is unrelated to C. elegans mir-238 (MIR:MI0000313).
Experiment Illumina [5]
Sequence AUUGGGAACAUUUUGCAUGUAU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr20:49281351|49281485 hsa-miR-450a-1-3p 1 0 0
chr10:18519352|18519551 hsa-miR-450a-1-3p 1 0 0
chr3:5218615|5218764 hsa-miR-450a-1-3p 1 0 0
chr2:47160427|47160514 hsa-miR-450a-1-3p 0 1 0
chr1:117225109|117225223 hsa-miR-450a-1-3p 0 1 0
chr6:44249470|44249583 hsa-miR-450a-1-3p 0 1 0
chr12:131733915|131734044 hsa-miR-450a-1-3p 0 1 0
chr5:10434849|10435024 hsa-miR-450a-1-3p 0 1 0
chr1:43990846|43991037 hsa-miR-450a-1-3p 0 1 0
chr6:33417106|33417310 hsa-miR-450a-1-3p 0 1 0
chr11:66685610|66685741 hsa-miR-450a-1-3p 0 1 0
chr1:151400147|151400542 hsa-miR-450a-1-3p 0 1 0
chr12:120149658|120150012 hsa-miR-450a-1-3p 0 1 0
chr4:108621989|108622204 hsa-miR-450a-1-3p 0 1 0
chr3:52752070|52752256 hsa-miR-450a-1-3p 0 1 0
chr16:52547650|52547749 hsa-miR-450a-1-3p 0 1 0
chr12:57105821|57105933 hsa-miR-450a-1-3p 0 1 0
chr1:9983858|9984027 hsa-miR-450a-1-3p 0 1 0
chr20:24963331|24963588 hsa-miR-450a-1-3p 0 1 0
chr11:3827322|3827542 hsa-miR-450a-1-3p 0 1 0
chr5:135571022|135571222 hsa-miR-450a-1-3p 0 1 0
chr22:50579974|50580201 hsa-miR-450a-1-3p 0 1 0
chr6:33206427|33206707 hsa-miR-450a-1-3p 0 1 0
chr11:3827322|3827477 hsa-miR-450a-1-3p 0 1 0
chr1:145995243|145995476 hsa-miR-450a-1-3p 0 1 0
chr19:58548156|58548374 hsa-miR-450a-1-3p 0 1 0
chr6:33417106|33417297 hsa-miR-450a-1-3p 0 1 0
chr3:9806624|9806762 hsa-miR-450a-1-3p 0 1 0
chr2:218254071|218254191 hsa-miR-450a-1-3p 0 1 0
chr16:72959222|72959413 hsa-miR-450a-1-3p 0 1 0
chr19:9648886|9649068 hsa-miR-450a-1-3p 0 1 0
chr1:145995255|145995476 hsa-miR-450a-1-3p 0 1 0
chr18:80194439|80194615 hsa-miR-450a-1-3p 0 1 0
chr11:32855480|32855616 hsa-miR-450a-1-3p 1 0 0
chr21:33575630|33575893 hsa-miR-450a-1-3p 1 0 0
chr20:49281379|49281503 hsa-miR-450a-1-3p 1 0 0
chr1:210245595|210245776 hsa-miR-450a-1-3p 1 0 0
chr10:119884861|119885015 hsa-miR-450a-1-3p 0 1 0
chr12:14620966|14621093 hsa-miR-450a-1-3p 0 1 0
chr19:1032563|1032696 hsa-miR-450a-1-3p 0 1 0
chr6:159779692|159779790 hsa-miR-450a-1-3p 0 1 0
chr11:3679554|3679635 hsa-miR-450a-1-3p 0 1 0
chr2:47160395|47160495 hsa-miR-450a-1-3p 0 1 0
chr16:19551946|19552018 hsa-miR-450a-1-3p 0 1 0
chr2:208236516|208236676 hsa-miR-450a-1-3p 0 1 0
chr5:179730388|179730442 hsa-miR-450a-1-3p 0 1 0
chr1:231000172|231000443 hsa-miR-450a-1-3p 0 1 0
chr5:179730388|179730478 hsa-miR-450a-1-3p 0 1 0
chr16:69743005|69743270 hsa-miR-450a-1-3p 0 1 0
chr12:115982384|115982553 hsa-miR-450a-1-3p 0 1 0
chr17:64499881|64499963 hsa-miR-450a-1-3p 0 1 0
chr9:134030808|134030896 hsa-miR-450a-1-3p 0 1 0
chr4:6302633|6302731 hsa-miR-450a-1-3p 0 1 0
chr2:218254047|218254191 hsa-miR-450a-1-3p 0 1 0
chr8:16155109|16164157 hsa-miR-450a-1-3p 0 1 0
chr6:33416758|33417310 hsa-miR-450a-1-3p 0 1 0
chr2:206767874|206768042 hsa-miR-450a-1-3p 0 1 0
chr11:75796346|75796475 hsa-miR-450a-1-3p 0 1 0
chr13:20403974|20404091 hsa-miR-450a-1-3p 0 1 0
chr1:169982702|169982840 hsa-miR-450a-1-3p 0 1 0
chr19:58548148|58548374 hsa-miR-450a-1-3p 0 1 0
chr1:145994972|145995426 hsa-miR-450a-1-3p 0 1 0
chr1:145995171|145995291 hsa-miR-450a-1-3p 0 1 0
chrX:17152364|17152491 hsa-miR-450a-1-3p 0 1 0
chr2:136114925~136115110 hsa-miR-450a-1-3p 0 1 0
chr7:98292152~98292331 hsa-miR-450a-1-3p 0 1 0
chr2:217801014~217801176 hsa-miR-450a-1-3p 0 1 0
chr2:47160427~47160514 hsa-miR-450a-1-3p 0 1 0
chr4:56453603~56453758 hsa-miR-450a-1-3p 0 1 0
chr9:124356622~124356748 hsa-miR-450a-1-3p 0 1 0
chr17:81251117~81251389 hsa-miR-450a-1-3p 0 1 0
chr1:243496648~243496821 hsa-miR-450a-1-3p 0 1 0
chr6:3114087~3114204 hsa-miR-450a-1-3p 0 1 0
chr6:42866813~42866964 hsa-miR-450a-1-3p 0 1 0
chr2:47074870~47075242 hsa-miR-450a-1-3p 0 1 0
chr11:59859077~59859189 hsa-miR-450a-1-3p 0 1 0
chr1:43990846~43991037 hsa-miR-450a-1-3p 0 1 0
chr2:218254045~218254193 hsa-miR-450a-1-3p 0 1 0
chr1:93552143~93552454 hsa-miR-450a-1-3p 0 1 0
chr15:40332771~40332983 hsa-miR-450a-1-3p 0 1 0
chr19:58548154~58548374 hsa-miR-450a-1-3p 0 1 0
chr3:155938715~155938860 hsa-miR-450a-1-3p 0 1 0
chr6:63697114|63697247 hsa-miR-450a-1-3p 1 0 0
chr4:56972459|56972586 hsa-miR-450a-1-3p 1 0 0
chr10:113021453|113021616 hsa-miR-450a-1-3p 0 1 0
chr3:69330886|69331113 hsa-miR-450a-1-3p 0 1 0
chr2:37105316|37105454 hsa-miR-450a-1-3p 0 1 0
chr20:60086443|60086615 hsa-miR-450a-1-3p 0 1 0
chr10:79088760|79088998 hsa-miR-450a-1-3p 0 1 0
chr1:39745414|39745663 hsa-miR-450a-1-3p 0 1 0
chr9:124356622|124356834 hsa-miR-450a-1-3p 0 1 0
chr10:27175556|27175779 hsa-miR-450a-1-3p 0 1 0
chr1:244659647|244659822 hsa-miR-450a-1-3p 0 1 0
chr12:95978295|95978412 hsa-miR-450a-1-3p 0 1 0
chr2:152068849|152069004 hsa-miR-450a-1-3p 0 1 0
chr2:70165092|70165177 hsa-miR-450a-1-3p 0 1 0
chr19:618007|618125 hsa-miR-450a-1-3p 0 1 0
chr16:29668726|29668828 hsa-miR-450a-1-3p 0 1 0
chr16:29668659|29668828 hsa-miR-450a-1-3p 0 1 0
chr12:52058852|52058995 hsa-miR-450a-1-3p 0 1 0
chr17:5433519|5433704 hsa-miR-450a-1-3p 0 1 0
chr14:73137574|73137714 hsa-miR-450a-1-3p 0 1 0
chr9:77902778|77902966 hsa-miR-450a-1-3p 0 1 0
chr1:27332380|27332487 hsa-miR-450a-1-3p 0 1 0
chr17:7502999|7503120 hsa-miR-450a-1-3p 0 1 0
chr10:132616391|132616610 hsa-miR-450a-1-3p 0 1 0
chr1:145995144|145995291 hsa-miR-450a-1-3p 0 1 0
chr4:142704221|142704363 hsa-miR-450a-1-3p 0 1 0
chr1:28940739|28940966 hsa-miR-450a-1-3p 0 1 0
chr2:61228281|61228402 hsa-miR-450a-1-3p 0 1 0
chr1:45614120|45614350 hsa-miR-450a-1-3p 0 1 0
chr3:107557064|107557196 hsa-miR-450a-1-3p 0 1 0
chr1:205626982|205627184 hsa-miR-450a-1-3p 0 1 0
chr6:159233472|159233594 hsa-miR-450a-1-3p 1 0 0
chr2:232135558|232135657 hsa-miR-450a-1-3p 1 0 0
chr7:127859067|127859155 hsa-miR-450a-1-3p 1 0 0
chr11:858573|858740 hsa-miR-450a-1-3p 1 0 0
chr14:65748904|65749012 hsa-miR-450a-1-3p 1 0 0
chr13:52664323|52664557 hsa-miR-450a-1-3p 1 0 0
chr1:230265284|230274467 hsa-miR-450a-1-3p 1 0 0
chr2:218254045|218254191 hsa-miR-450a-1-3p 0 1 0
chr1:155197518|155197901 hsa-miR-450a-1-3p 0 1 0
chr19:58548081|58548374 hsa-miR-450a-1-3p 0 1 0
chr11:33709737|33709901 hsa-miR-450a-1-3p 0 1 0
chr9:129288595|129288695 hsa-miR-450a-1-3p 0 1 0
chr1:15397659|15397886 hsa-miR-450a-1-3p 0 1 0
chr12:9659287|9659395 hsa-miR-450a-1-3p 0 1 0
chr4:6302638|6302729 hsa-miR-450a-1-3p 0 1 0
chr4:40809434|40809598 hsa-miR-450a-1-3p 0 1 0
chr9:120913412|120913510 hsa-miR-450a-1-3p 0 1 0
chr15:89196101|89196304 hsa-miR-450a-1-3p 0 1 0
chr5:134285260|134285470 hsa-miR-450a-1-3p 0 1 0
chr1:156722965|156723113 hsa-miR-450a-1-3p 0 1 0
chr19:58548103|58548374 hsa-miR-450a-1-3p 0 1 0
chr15:89196076|89196211 hsa-miR-450a-1-3p 0 1 0
chr16:89564208|89564363 hsa-miR-450a-1-3p 0 1 0
chr1:94000898|94001094 hsa-miR-450a-1-3p 0 1 0
chr19:58548151|58548374 hsa-miR-450a-1-3p 0 1 0
chr17:63694024|63694150 hsa-miR-450a-1-3p 0 1 0
chr2:217801110|217801268 hsa-miR-450a-1-3p 0 1 0
chr20:37404167|37404323 hsa-miR-450a-1-3p 0 1 0
chr7:135577796|135593192 hsa-miR-450a-1-3p 0 1 0
chr7:17845595|17850964 hsa-miR-450a-1-3p 0 1 0
chr21:33432177|33432871 hsa-miR-450a-1-3p 0 1 0
chr19:17209972|17210323 hsa-miR-450a-1-3p 0 1 0
chr16:2079312|2079422 hsa-miR-450a-1-3p 0 1 0
chr11:129886408|129888678 hsa-miR-450a-1-3p 0 1 0
chr10:97755196|97755346 hsa-miR-450a-1-3p 0 1 0
chr1:95143891|95173889 hsa-miR-450a-1-3p 0 1 0
chr1:45008256|45008577 hsa-miR-450a-1-3p 0 1 0
chr11:33709748|33709911 hsa-miR-450a-1-3p 0 1 0
chr1:169982066|169982824 hsa-miR-450a-1-3p 0 1 0
chr5:179730382|179730524 hsa-miR-450a-1-3p 0 1 0
chr1:231000185|231000443 hsa-miR-450a-1-3p 0 1 0
chr12:56102964|56103102 hsa-miR-450a-1-3p 0 1 0
chr8:11838450|11838562 hsa-miR-450a-1-3p 0 1 0
chr1:16124824|16124937 hsa-miR-450a-1-3p 0 1 0
chr1:45614123|45614350 hsa-miR-450a-1-3p 0 1 0
chr2:134454286|134454482 hsa-miR-450a-1-3p 0 1 0
chr2:71427379|71428651 hsa-miR-450a-1-3p 0 1 0
chr11:66685610|66685784 hsa-miR-450a-1-3p 0 1 0
chr13:20403987|20404091 hsa-miR-450a-1-3p 0 1 0
chr12:121423972|121424178 hsa-miR-450a-1-3p 0 1 0
chr1:11840927|11841127 hsa-miR-450a-1-3p 0 1 0
chr11:66685610|66685814 hsa-miR-450a-1-3p 0 1 0
chr20:56365087|56365262 hsa-miR-450a-1-3p 0 1 0
chr5:122826170|122827646 hsa-miR-450a-1-3p 0 1 0
chr7:155738219|155738302 hsa-miR-450a-1-3p 0 1 0
chr12:47968275|47968392 hsa-miR-450a-1-3p 0 1 0
chr6:33271691|33271814 hsa-miR-450a-1-3p 0 1 0
chr20:24963333|24963615 hsa-miR-450a-1-3p 0 1 0
chr20:60042357|60042547 hsa-miR-450a-1-3p 0 1 0
chr1:180198971|180199072 hsa-miR-450a-1-3p -6 1 0
chr17:7846151|7846297 hsa-miR-450a-1-3p -10 1 0
chr6:7904997|7905165 hsa-miR-450a-1-3p -7 1 0
chr17:79087927|79088084 hsa-miR-450a-1-3p -15 1 0
chr6:116277067|116277258 hsa-miR-450a-1-3p -11 1 0
chr1:16124728|16124926 hsa-miR-450a-1-3p 0 1 0
chr7:140455095|140455204 hsa-miR-450a-1-3p 1 0 0
chr2:232135545|232135629 hsa-miR-450a-1-3p 1 0 0
chr20:49281354|49281503 hsa-miR-450a-1-3p 1 0 0
chr9:38069876|38070027 hsa-miR-450a-1-3p 1 0 0
chr17:42403917|42404056 hsa-miR-450a-1-3p 1 0 0
chr6:44252200|44252311 hsa-miR-450a-1-3p 0 1 0
chr9:128826384|128826603 hsa-miR-450a-1-3p 0 1 0
chr1:156722748|156723120 hsa-miR-450a-1-3p 0 1 0
chr11:72022339|72023081 hsa-miR-450a-1-3p 0 1 0
chr3:52483501|52483598 hsa-miR-450a-1-3p 0 1 0
chr20:44430087|44430294 hsa-miR-450a-1-3p 0 1 0
chr8:11838409|11838562 hsa-miR-450a-1-3p 0 1 0
chr12:107733961|107734084 hsa-miR-450a-1-3p 0 1 0
chr4:128270686|128270832 hsa-miR-450a-1-3p 0 1 0
chr4:108621969|108622204 hsa-miR-450a-1-3p 0 1 0
chr3:9806669|9806824 hsa-miR-450a-1-3p 0 1 0
chr8:11838415|11838509 hsa-miR-450a-1-3p 0 1 0
chr7:151466193|151466370 hsa-miR-450a-1-3p 0 1 0
chr1:9983861|9983981 hsa-miR-450a-1-3p 0 1 0
chr20:44430179|44430294 hsa-miR-450a-1-3p 0 1 0
chr7:882358|882552 hsa-miR-450a-1-3p 0 1 0
chr7:44061236|44061445 hsa-miR-450a-1-3p 0 1 0
chr20:44430213|44430294 hsa-miR-450a-1-3p 0 1 0
chr1:231000229|231000443 hsa-miR-450a-1-3p 0 1 0
chr15:42000159|42000282 hsa-miR-450a-1-3p 0 1 0
chr1:45342460|45342588 hsa-miR-450a-1-3p 0 1 0
chr1:19656682|19656895 hsa-miR-450a-1-3p 0 1 0
chr5:7867316|7867452 hsa-miR-450a-1-3p 0 1 0
chr6:44249403|44249583 hsa-miR-450a-1-3p 0 1 0
chr5:9549877|9549995 hsa-miR-450a-1-3p 0 1 0
chr13:20403977|20404091 hsa-miR-450a-1-3p 0 1 0
chr21:38824656|38824761 hsa-miR-450a-1-3p 0 1 0
chr17:44162307|44162470 hsa-miR-450a-1-3p 0 1 0
chr6:32841027|32841735 hsa-miR-450a-1-3p 0 1 0
chr11:94546004|94546325 hsa-miR-450a-1-3p 0 1 0
chr20:24963333|24963683 hsa-miR-450a-1-3p 0 1 0
chr4:108621959|108622204 hsa-miR-450a-1-3p 0 1 0
chr19:58548112|58548374 hsa-miR-450a-1-3p 0 1 0
chrX:47651810|47652126 hsa-miR-450a-1-3p 0 1 0
chr1:6221629|6221747 hsa-miR-450a-1-3p 0 1 0
chr12:4700954|4701151 hsa-miR-450a-1-3p 0 1 0
chr7:98292152|98292309 hsa-miR-450a-1-3p 0 1 0
chr3:9806665|9806824 hsa-miR-450a-1-3p 0 1 0
chr15:78013083|78013250 hsa-miR-450a-1-3p 0 1 0
chr2:112830121|112830382 hsa-miR-450a-1-3p 1 0 0
chr15:67192336|67192525 hsa-miR-450a-1-3p 1 0 0
chr22:44168834|44168987 hsa-miR-450a-1-3p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-450a-1-3p BUB1 BUB1 mitotic checkpoint serine/threonine kinase HGNC:1148 details
hsa-miR-450a-1-3p KMT2A lysine methyltransferase 2A HGNC:7132 details
hsa-miR-450a-1-3p NPY4R neuropeptide Y receptor Y4 HGNC:9329 details
hsa-miR-450a-1-3p AQR aquarius intron-binding spliceosomal factor HGNC:29513 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p ZNF584 zinc finger protein 584 HGNC:27318 details
hsa-miR-450a-1-3p ZNF557 zinc finger protein 557 HGNC:28632 details
hsa-miR-450a-1-3p ADA2 adenosine deaminase 2 HGNC:1839 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p BAMBI BMP and activin membrane bound inhibitor HGNC:30251 details
hsa-miR-450a-1-3p SERAC1 serine active site containing 1 HGNC:21061 details
hsa-miR-450a-1-3p HAVCR2 hepatitis A virus cellular receptor 2 HGNC:18437 details
hsa-miR-450a-1-3p ACADL acyl-CoA dehydrogenase long chain HGNC:88 details
hsa-miR-450a-1-3p UBE2B ubiquitin conjugating enzyme E2 B HGNC:12473 details
hsa-miR-450a-1-3p TMBIM6 transmembrane BAX inhibitor motif containing 6 HGNC:11723 details
hsa-miR-450a-1-3p TBXA2R thromboxane A2 receptor HGNC:11608 details
hsa-miR-450a-1-3p SSRP1 structure specific recognition protein 1 HGNC:11327 details
hsa-miR-450a-1-3p PTGES2 prostaglandin E synthase 2 HGNC:17822 details
hsa-miR-450a-1-3p POU2F1 POU class 2 homeobox 1 HGNC:9212 details
hsa-miR-450a-1-3p POGK pogo transposable element derived with KRAB domain HGNC:18800 details
hsa-miR-450a-1-3p PHAX phosphorylated adaptor for RNA export HGNC:10241 details
hsa-miR-450a-1-3p NUP43 nucleoporin 43 HGNC:21182 details
hsa-miR-450a-1-3p NAA25 N-alpha-acetyltransferase 25, NatB auxiliary subunit HGNC:25783 details
hsa-miR-450a-1-3p MCFD2 multiple coagulation factor deficiency 2, ER cargo receptor complex subunit HGNC:18451 details
hsa-miR-450a-1-3p LYN LYN proto-oncogene, Src family tyrosine kinase HGNC:6735 details
hsa-miR-450a-1-3p LMBR1L limb development membrane protein 1 like HGNC:18268 details
hsa-miR-450a-1-3p BMP2 bone morphogenetic protein 2 HGNC:1069 details
hsa-miR-450a-1-3p TTLL1 tubulin tyrosine ligase like 1 HGNC:1312 details
hsa-miR-450a-1-3p HAUS3 HAUS augmin like complex subunit 3 HGNC:28719 details
hsa-miR-450a-1-3p TAB2 TGF-beta activated kinase 1 (MAP3K7) binding protein 2 HGNC:17075 details
hsa-miR-450a-1-3p KIF5B kinesin family member 5B HGNC:6324 details
hsa-miR-450a-1-3p FTO FTO alpha-ketoglutarate dependent dioxygenase HGNC:24678 details
hsa-miR-450a-1-3p METTL14 methyltransferase 14, N6-adenosine-methyltransferase subunit HGNC:29330 details
hsa-miR-450a-1-3p IRAK3 interleukin 1 receptor associated kinase 3 HGNC:17020 details
hsa-miR-450a-1-3p ZNF703 zinc finger protein 703 HGNC:25883 details
hsa-miR-450a-1-3p SF3B3 splicing factor 3b subunit 3 HGNC:10770 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p SCUBE1 signal peptide, CUB domain and EGF like domain containing 1 HGNC:13441 details
hsa-miR-450a-1-3p GHITM growth hormone inducible transmembrane protein HGNC:17281 details
hsa-miR-450a-1-3p RPAP2 RNA polymerase II associated protein 2 HGNC:25791 details
hsa-miR-450a-1-3p DNAH17 dynein axonemal heavy chain 17 HGNC:2946 details
hsa-miR-450a-1-3p SUMF2 sulfatase modifying factor 2 HGNC:20415 details
hsa-miR-450a-1-3p DUSP28 dual specificity phosphatase 28 HGNC:33237 details
hsa-miR-450a-1-3p RPP30 ribonuclease P/MRP subunit p30 HGNC:17688 details
hsa-miR-450a-1-3p ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 HGNC:220 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p MRRF mitochondrial ribosome recycling factor HGNC:7234 details
hsa-miR-450a-1-3p LSG1 large 60S subunit nuclear export GTPase 1 HGNC:25652 details
hsa-miR-450a-1-3p ZNF70 zinc finger protein 70 HGNC:13140 details
hsa-miR-450a-1-3p ZFAND4 zinc finger AN1-type containing 4 HGNC:23504 details
hsa-miR-450a-1-3p ZCCHC8 zinc finger CCHC-type containing 8 HGNC:25265 details
hsa-miR-450a-1-3p XIAP X-linked inhibitor of apoptosis HGNC:592 details
hsa-miR-450a-1-3p TMEM11 transmembrane protein 11 HGNC:16823 details
hsa-miR-450a-1-3p SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone HGNC:16987 details
hsa-miR-450a-1-3p MED28 mediator complex subunit 28 HGNC:24628 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p GNG4 G protein subunit gamma 4 HGNC:4407 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p FBXW2 F-box and WD repeat domain containing 2 HGNC:13608 details
hsa-miR-450a-1-3p ESCO2 establishment of sister chromatid cohesion N-acetyltransferase 2 HGNC:27230 details
hsa-miR-450a-1-3p ALG10B ALG10 alpha-1,2-glucosyltransferase B HGNC:31088 details
hsa-miR-450a-1-3p FRK fyn related Src family tyrosine kinase HGNC:3955 details
hsa-miR-450a-1-3p COL18A1 collagen type XVIII alpha 1 chain HGNC:2195 details
hsa-miR-450a-1-3p TDGF1P3 teratocarcinoma-derived growth factor 1 pseudogene 3 HGNC:11703 details
hsa-miR-450a-1-3p LDHD lactate dehydrogenase D HGNC:19708 details
hsa-miR-450a-1-3p RPS27A ribosomal protein S27a HGNC:10417 details
hsa-miR-450a-1-3p PPP1R15B protein phosphatase 1 regulatory subunit 15B HGNC:14951 details
hsa-miR-450a-1-3p CLOCK clock circadian regulator HGNC:2082 details
hsa-miR-450a-1-3p KLF8 Kruppel like factor 8 HGNC:6351 details
hsa-miR-450a-1-3p KLF17 Kruppel like factor 17 HGNC:18830 details
hsa-miR-450a-1-3p CD3D CD3d molecule HGNC:1673 details
hsa-miR-450a-1-3p SEPHS1 selenophosphate synthetase 1 HGNC:19685 details
hsa-miR-450a-1-3p TMEM33 transmembrane protein 33 HGNC:25541 details
hsa-miR-450a-1-3p LY6G5B lymphocyte antigen 6 family member G5B HGNC:13931 details
hsa-miR-450a-1-3p C18orf32 chromosome 18 open reading frame 32 HGNC:31690 details
hsa-miR-450a-1-3p TSPYL1 TSPY like 1 HGNC:12382 details
hsa-miR-450a-1-3p ZFP91 ZFP91 zinc finger protein, atypical E3 ubiquitin ligase HGNC:14983 details
hsa-miR-450a-1-3p DR1 down-regulator of transcription 1 HGNC:3017 details
hsa-miR-450a-1-3p TMEM245 transmembrane protein 245 HGNC:1363 details
hsa-miR-450a-1-3p SLC6A9 solute carrier family 6 member 9 HGNC:11056 details
hsa-miR-450a-1-3p ETV3 ETS variant transcription factor 3 HGNC:3492 details
hsa-miR-450a-1-3p NACC2 NACC family member 2 HGNC:23846 details
hsa-miR-450a-1-3p IGFBP5 insulin like growth factor binding protein 5 HGNC:5474 details
hsa-miR-450a-1-3p FOXC1 forkhead box C1 HGNC:3800 details
hsa-miR-450a-1-3p SUSD1 sushi domain containing 1 HGNC:25413 details
hsa-miR-450a-1-3p GOLGA4 golgin A4 HGNC:4427 details
hsa-miR-450a-1-3p FGF2 fibroblast growth factor 2 HGNC:3676 details
hsa-miR-450a-1-3p KIAA1210 KIAA1210 HGNC:29218 details
hsa-miR-450a-1-3p SIGLEC10 sialic acid binding Ig like lectin 10 HGNC:15620 details
hsa-miR-450a-1-3p RRAD RRAD, Ras related glycolysis inhibitor and calcium channel regulator HGNC:10446 details
hsa-miR-450a-1-3p MRPS16 mitochondrial ribosomal protein S16 HGNC:14048 details
hsa-miR-450a-1-3p IL12RB2 interleukin 12 receptor subunit beta 2 HGNC:5972 details
hsa-miR-450a-1-3p NUDT19 nudix hydrolase 19 HGNC:32036 details
hsa-miR-450a-1-3p PRRG4 proline rich and Gla domain 4 HGNC:30799 details
hsa-miR-450a-1-3p LZIC leucine zipper and CTNNBIP1 domain containing HGNC:17497 details
hsa-miR-450a-1-3p AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 HGNC:23463 details
hsa-miR-450a-1-3p RMDN1 regulator of microtubule dynamics 1 HGNC:24285 details
hsa-miR-450a-1-3p ACAA2 acetyl-CoA acyltransferase 2 HGNC:83 details
hsa-miR-450a-1-3p ZNF701 zinc finger protein 701 HGNC:25597 details
hsa-miR-450a-1-3p TMEM251 transmembrane protein 251 HGNC:20218 details
hsa-miR-450a-1-3p SLC25A34 solute carrier family 25 member 34 HGNC:27653 details
hsa-miR-450a-1-3p IGSF6 immunoglobulin superfamily member 6 HGNC:5953 details
hsa-miR-450a-1-3p UBE2D4 ubiquitin conjugating enzyme E2 D4 (putative) HGNC:21647 details
hsa-miR-450a-1-3p OSBPL10 oxysterol binding protein like 10 HGNC:16395 details
hsa-miR-450a-1-3p KIF1C kinesin family member 1C HGNC:6317 details
hsa-miR-450a-1-3p FAM186A family with sequence similarity 186 member A HGNC:26980 details
hsa-miR-450a-1-3p FAHD1 fumarylacetoacetate hydrolase domain containing 1 HGNC:14169 details
hsa-miR-450a-1-3p CLEC17A C-type lectin domain containing 17A HGNC:34520 details
hsa-miR-450a-1-3p WIZ WIZ zinc finger HGNC:30917 details
hsa-miR-450a-1-3p TMEM239 transmembrane protein 239 HGNC:40044 details
hsa-miR-450a-1-3p XKR4 XK related 4 HGNC:29394 details
hsa-miR-450a-1-3p SCD5 stearoyl-CoA desaturase 5 HGNC:21088 details
hsa-miR-450a-1-3p ACOX1 acyl-CoA oxidase 1 HGNC:119 details
hsa-miR-450a-1-3p SPATA5 spermatogenesis associated 5 HGNC:18119 details
hsa-miR-450a-1-3p GLP2R glucagon like peptide 2 receptor HGNC:4325 details
hsa-miR-450a-1-3p TESMIN testis expressed metallothionein like protein HGNC:7446 details
hsa-miR-450a-1-3p TLN1 talin 1 HGNC:11845 details
hsa-miR-450a-1-3p PAQR5 progestin and adipoQ receptor family member 5 HGNC:29645 details
hsa-miR-450a-1-3p NCKIPSD NCK interacting protein with SH3 domain HGNC:15486 details
hsa-miR-450a-1-3p MYH9 myosin heavy chain 9 HGNC:7579 details
hsa-miR-450a-1-3p CDC73 cell division cycle 73 HGNC:16783 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p SYNJ2 synaptojanin 2 HGNC:11504 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p KLHL21 kelch like family member 21 HGNC:29041 details
hsa-miR-450a-1-3p TRAF3IP2 TRAF3 interacting protein 2 HGNC:1343 details
hsa-miR-450a-1-3p PCDHB11 protocadherin beta 11 HGNC:8682 details
hsa-miR-450a-1-3p SSR1 signal sequence receptor subunit 1 HGNC:11323 details
hsa-miR-450a-1-3p MLH1 mutL homolog 1 HGNC:7127 details
hsa-miR-450a-1-3p CCL22 C-C motif chemokine ligand 22 HGNC:10621 details
hsa-miR-450a-1-3p SGTB small glutamine rich tetratricopeptide repeat co-chaperone beta HGNC:23567 details
hsa-miR-450a-1-3p NAV1 neuron navigator 1 HGNC:15989 details
hsa-miR-450a-1-3p MTMR10 myotubularin related protein 10 HGNC:25999 details
hsa-miR-450a-1-3p MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils HGNC:29383 details
hsa-miR-450a-1-3p IGF1 insulin like growth factor 1 HGNC:5464 details
hsa-miR-450a-1-3p FRRS1 ferric chelate reductase 1 HGNC:27622 details
hsa-miR-450a-1-3p DNAL1 dynein axonemal light chain 1 HGNC:23247 details
hsa-miR-450a-1-3p FBXW8 F-box and WD repeat domain containing 8 HGNC:13597 details
hsa-miR-450a-1-3p KLLN killin, p53 regulated DNA replication inhibitor HGNC:37212 details
hsa-miR-450a-1-3p BPNT1 3'(2'), 5'-bisphosphate nucleotidase 1 HGNC:1096 details
hsa-miR-450a-1-3p WHAMM WASP homolog associated with actin, golgi membranes and microtubules HGNC:30493 details
hsa-miR-450a-1-3p ATP6V1A ATPase H+ transporting V1 subunit A HGNC:851 details
hsa-miR-450a-1-3p UBE2F ubiquitin conjugating enzyme E2 F (putative) HGNC:12480 details
hsa-miR-450a-1-3p DNAH9 dynein axonemal heavy chain 9 HGNC:2953 details
hsa-miR-450a-1-3p NUP155 nucleoporin 155 HGNC:8063 details
hsa-miR-450a-1-3p LRIG2 leucine rich repeats and immunoglobulin like domains 2 HGNC:20889 details
hsa-miR-450a-1-3p DSEL dermatan sulfate epimerase like HGNC:18144 details
hsa-miR-450a-1-3p MORN4 MORN repeat containing 4 HGNC:24001 details
hsa-miR-450a-1-3p WWTR1 WW domain containing transcription regulator 1 HGNC:24042 details
hsa-miR-450a-1-3p NHLRC2 NHL repeat containing 2 HGNC:24731 details
hsa-miR-450a-1-3p TTC9C tetratricopeptide repeat domain 9C HGNC:28432 details
hsa-miR-450a-1-3p DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 HGNC:24637 details
hsa-miR-450a-1-3p ZSCAN29 zinc finger and SCAN domain containing 29 HGNC:26673 details
hsa-miR-450a-1-3p ZNF280C zinc finger protein 280C HGNC:25955 details
hsa-miR-450a-1-3p PI4K2B phosphatidylinositol 4-kinase type 2 beta HGNC:18215 details
hsa-miR-450a-1-3p ARSK arylsulfatase family member K HGNC:25239 details
hsa-miR-450a-1-3p ZNF324B zinc finger protein 324B HGNC:33107 details
hsa-miR-450a-1-3p PLD6 phospholipase D family member 6 HGNC:30447 details
hsa-miR-450a-1-3p PPM1D protein phosphatase, Mg2+/Mn2+ dependent 1D HGNC:9277 details
hsa-miR-450a-1-3p SLC19A3 solute carrier family 19 member 3 HGNC:16266 details
hsa-miR-450a-1-3p HINT1 histidine triad nucleotide binding protein 1 HGNC:4912 details
hsa-miR-450a-1-3p CEP97 centrosomal protein 97 HGNC:26244 details
hsa-miR-450a-1-3p POLR2J3 RNA polymerase II subunit J3 HGNC:33853 details
hsa-miR-450a-1-3p UQCRQ ubiquinol-cytochrome c reductase complex III subunit VII HGNC:29594 details
hsa-miR-450a-1-3p TRIM14 tripartite motif containing 14 HGNC:16283 details
hsa-miR-450a-1-3p UPK3BL1 uroplakin 3B like 1 HGNC:37278 details
hsa-miR-450a-1-3p PPP1R16B protein phosphatase 1 regulatory subunit 16B HGNC:15850 details
hsa-miR-450a-1-3p SLC1A2 solute carrier family 1 member 2 HGNC:10940 details
hsa-miR-450a-1-3p SLFN12L schlafen family member 12 like HGNC:33920 details
hsa-miR-450a-1-3p TTC39B tetratricopeptide repeat domain 39B HGNC:23704 details
hsa-miR-450a-1-3p TRUB2 TruB pseudouridine synthase family member 2 HGNC:17170 details
hsa-miR-450a-1-3p PRICKLE1 prickle planar cell polarity protein 1 HGNC:17019 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 HGNC:19873 details
hsa-miR-450a-1-3p CSTF1 cleavage stimulation factor subunit 1 HGNC:2483 details
hsa-miR-450a-1-3p ANKFY1 ankyrin repeat and FYVE domain containing 1 HGNC:20763 details
hsa-miR-450a-1-3p CPM carboxypeptidase M HGNC:2311 details
hsa-miR-450a-1-3p DYRK4 dual specificity tyrosine phosphorylation regulated kinase 4 HGNC:3095 details
hsa-miR-450a-1-3p CHMP1B charged multivesicular body protein 1B HGNC:24287 details
hsa-miR-450a-1-3p ZNF623 zinc finger protein 623 HGNC:29084 details
hsa-miR-450a-1-3p EBNA1BP2 EBNA1 binding protein 2 HGNC:15531 details
hsa-miR-450a-1-3p ZNF284 zinc finger protein 284 HGNC:13078 details
hsa-miR-450a-1-3p ANGPT4 angiopoietin 4 HGNC:487 details
hsa-miR-450a-1-3p LRRC47 leucine rich repeat containing 47 HGNC:29207 details
hsa-miR-450a-1-3p MSRB2 methionine sulfoxide reductase B2 HGNC:17061 details
hsa-miR-450a-1-3p PCDHA6 protocadherin alpha 6 HGNC:8672 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p ZNF770 zinc finger protein 770 HGNC:26061 details
hsa-miR-450a-1-3p WDR75 WD repeat domain 75 HGNC:25725 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p APOBEC3F apolipoprotein B mRNA editing enzyme catalytic subunit 3F HGNC:17356 details
hsa-miR-450a-1-3p HUS1 HUS1 checkpoint clamp component HGNC:5309 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p CRIPT CXXC repeat containing interactor of PDZ3 domain HGNC:14312 details
hsa-miR-450a-1-3p WDR55 WD repeat domain 55 HGNC:25971 details
hsa-miR-450a-1-3p TBC1D19 TBC1 domain family member 19 HGNC:25624 details
hsa-miR-450a-1-3p SLC38A7 solute carrier family 38 member 7 HGNC:25582 details
hsa-miR-450a-1-3p PPTC7 protein phosphatase targeting COQ7 HGNC:30695 details
hsa-miR-450a-1-3p MOB1B MOB kinase activator 1B HGNC:29801 details
hsa-miR-450a-1-3p HECTD3 HECT domain E3 ubiquitin protein ligase 3 HGNC:26117 details
hsa-miR-450a-1-3p GCNT4 glucosaminyl (N-acetyl) transferase 4 HGNC:17973 details
hsa-miR-450a-1-3p FAT3 FAT atypical cadherin 3 HGNC:23112 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p CCNF cyclin F HGNC:1591 details
hsa-miR-450a-1-3p BCL10 BCL10 immune signaling adaptor HGNC:989 details
hsa-miR-450a-1-3p ATL3 atlastin GTPase 3 HGNC:24526 details
hsa-miR-450a-1-3p SSR3 signal sequence receptor subunit 3 HGNC:11325 details
hsa-miR-450a-1-3p BZW1 basic leucine zipper and W2 domains 1 HGNC:18380 details
hsa-miR-450a-1-3p SLC29A4 solute carrier family 29 member 4 HGNC:23097 details
hsa-miR-450a-1-3p CBY3 chibby family member 3 HGNC:33278 details
hsa-miR-450a-1-3p LLGL1 LLGL scribble cell polarity complex component 1 HGNC:6628 details
hsa-miR-450a-1-3p TRIM66 tripartite motif containing 66 HGNC:29005 details
hsa-miR-450a-1-3p SFT2D2 SFT2 domain containing 2 HGNC:25140 details
hsa-miR-450a-1-3p DESI1 desumoylating isopeptidase 1 HGNC:24577 details
hsa-miR-450a-1-3p MAPKAPK5 MAPK activated protein kinase 5 HGNC:6889 details
hsa-miR-450a-1-3p CLSTN1 calsyntenin 1 HGNC:17447 details
hsa-miR-450a-1-3p TMPPE transmembrane protein with metallophosphoesterase domain HGNC:33865 details
hsa-miR-450a-1-3p ERCC6L2 ERCC excision repair 6 like 2 HGNC:26922 details
hsa-miR-450a-1-3p TOX4 TOX high mobility group box family member 4 HGNC:20161 details
hsa-miR-450a-1-3p FOSL2 FOS like 2, AP-1 transcription factor subunit HGNC:3798 details
hsa-miR-450a-1-3p PMPCA peptidase, mitochondrial processing subunit alpha HGNC:18667 details
hsa-miR-450a-1-3p MOB3A MOB kinase activator 3A HGNC:29802 details
hsa-miR-450a-1-3p SMTNL2 smoothelin like 2 HGNC:24764 details
hsa-miR-450a-1-3p PLEKHH1 pleckstrin homology, MyTH4 and FERM domain containing H1 HGNC:17733 details
hsa-miR-450a-1-3p ZNF490 zinc finger protein 490 HGNC:23705 details
hsa-miR-450a-1-3p SLC10A6 solute carrier family 10 member 6 HGNC:30603 details
hsa-miR-450a-1-3p GGCX gamma-glutamyl carboxylase HGNC:4247 details
hsa-miR-450a-1-3p RNF24 ring finger protein 24 HGNC:13779 details
hsa-miR-450a-1-3p PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L HGNC:16381 details
hsa-miR-450a-1-3p RBBP4 RB binding protein 4, chromatin remodeling factor HGNC:9887 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p ZNF124 zinc finger protein 124 HGNC:12907 details
hsa-miR-450a-1-3p MCF2L2 MCF.2 cell line derived transforming sequence-like 2 HGNC:30319 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p CAPN7 calpain 7 HGNC:1484 details
hsa-miR-450a-1-3p PLEKHA1 pleckstrin homology domain containing A1 HGNC:14335 details
hsa-miR-450a-1-3p RPL7L1 ribosomal protein L7 like 1 HGNC:21370 details
hsa-miR-450a-1-3p GJD3 gap junction protein delta 3 HGNC:19147 details
hsa-miR-450a-1-3p THAP5 THAP domain containing 5 HGNC:23188 details
hsa-miR-450a-1-3p NKRF NFKB repressing factor HGNC:19374 details
hsa-miR-450a-1-3p NPR1 natriuretic peptide receptor 1 HGNC:7943 details
hsa-miR-450a-1-3p RASSF9 Ras association domain family member 9 HGNC:15739 details
hsa-miR-450a-1-3p TRPM6 transient receptor potential cation channel subfamily M member 6 HGNC:17995 details
hsa-miR-450a-1-3p SNX1 sorting nexin 1 HGNC:11172 details
hsa-miR-450a-1-3p KLHL26 kelch like family member 26 HGNC:25623 details
hsa-miR-450a-1-3p EHD2 EH domain containing 2 HGNC:3243 details
hsa-miR-450a-1-3p AHR aryl hydrocarbon receptor HGNC:348 details
hsa-miR-450a-1-3p TMEM91 transmembrane protein 91 HGNC:32393 details
hsa-miR-450a-1-3p MRO maestro HGNC:24121 details
hsa-miR-450a-1-3p ZNF451 zinc finger protein 451 HGNC:21091 details
hsa-miR-450a-1-3p CPSF2 cleavage and polyadenylation specific factor 2 HGNC:2325 details
hsa-miR-450a-1-3p PCNP PEST proteolytic signal containing nuclear protein HGNC:30023 details
hsa-miR-450a-1-3p TOR1AIP2 torsin 1A interacting protein 2 HGNC:24055 details
hsa-miR-450a-1-3p ABI2 abl interactor 2 HGNC:24011 details
hsa-miR-450a-1-3p ITGB3 integrin subunit beta 3 HGNC:6156 details
hsa-miR-450a-1-3p CRCP CGRP receptor component HGNC:17888 details
hsa-miR-450a-1-3p PTRH2 peptidyl-tRNA hydrolase 2 HGNC:24265 details
hsa-miR-450a-1-3p SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 HGNC:13655 details
hsa-miR-450a-1-3p LINC00598 long intergenic non-protein coding RNA 598 HGNC:42770 details
hsa-miR-450a-1-3p RHOF ras homolog family member F, filopodia associated HGNC:15703 details
hsa-miR-450a-1-3p RBMS2 RNA binding motif single stranded interacting protein 2 HGNC:9909 details
hsa-miR-450a-1-3p ZKSCAN3 zinc finger with KRAB and SCAN domains 3 HGNC:13853 details
hsa-miR-450a-1-3p OSBPL2 oxysterol binding protein like 2 HGNC:15761 details
hsa-miR-450a-1-3p ZDHHC20 zinc finger DHHC-type palmitoyltransferase 20 HGNC:20749 details
hsa-miR-450a-1-3p NDUFA7 NADH:ubiquinone oxidoreductase subunit A7 HGNC:7691 details
hsa-miR-450a-1-3p AKIP1 A-kinase interacting protein 1 HGNC:1170 details
hsa-miR-450a-1-3p SLC11A2 solute carrier family 11 member 2 HGNC:10908 details
hsa-miR-450a-1-3p ITGA3 integrin subunit alpha 3 HGNC:6139 details
hsa-miR-450a-1-3p ZNF749 zinc finger protein 749 HGNC:32783 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p SNRPD1 small nuclear ribonucleoprotein D1 polypeptide HGNC:11158 details
hsa-miR-450a-1-3p TNFRSF13C TNF receptor superfamily member 13C HGNC:17755 details
hsa-miR-450a-1-3p TMEM120B transmembrane protein 120B HGNC:32008 details
hsa-miR-450a-1-3p TANGO2 transport and golgi organization 2 homolog HGNC:25439 details
hsa-miR-450a-1-3p QPCTL glutaminyl-peptide cyclotransferase like HGNC:25952 details
hsa-miR-450a-1-3p KIAA1328 KIAA1328 HGNC:29248 details
hsa-miR-450a-1-3p CDH7 cadherin 7 HGNC:1766 details
hsa-miR-450a-1-3p ATXN3 ataxin 3 HGNC:7106 details
hsa-miR-450a-1-3p NUDT7 nudix hydrolase 7 HGNC:8054 details
hsa-miR-450a-1-3p TMPRSS12 transmembrane serine protease 12 HGNC:28779 details
hsa-miR-450a-1-3p MANSC1 MANSC domain containing 1 HGNC:25505 details
hsa-miR-450a-1-3p PNMA2 PNMA family member 2 HGNC:9159 details
hsa-miR-450a-1-3p MRNIP MRN complex interacting protein HGNC:30817 details
hsa-miR-450a-1-3p RPL24 ribosomal protein L24 HGNC:10325 details
hsa-miR-450a-1-3p FAM71F2 family with sequence similarity 71 member F2 HGNC:27998 details
hsa-miR-450a-1-3p DSN1 DSN1 component of MIS12 kinetochore complex HGNC:16165 details
hsa-miR-450a-1-3p FUT2 fucosyltransferase 2 HGNC:4013 details
hsa-miR-450a-1-3p ADIPOQ adiponectin, C1Q and collagen domain containing HGNC:13633 details
hsa-miR-450a-1-3p PJVK pejvakin HGNC:29502 details
hsa-miR-450a-1-3p GP5 glycoprotein V platelet HGNC:4443 details
hsa-miR-450a-1-3p CEP104 centrosomal protein 104 HGNC:24866 details
hsa-miR-450a-1-3p AGTRAP angiotensin II receptor associated protein HGNC:13539 details
hsa-miR-450a-1-3p SCNM1 sodium channel modifier 1 HGNC:23136 details
hsa-miR-450a-1-3p ZNF708 zinc finger protein 708 HGNC:12945 details
hsa-miR-450a-1-3p PIGR polymeric immunoglobulin receptor HGNC:8968 details
hsa-miR-450a-1-3p ZNF17 zinc finger protein 17 HGNC:12958 details
hsa-miR-450a-1-3p COX18 cytochrome c oxidase assembly factor COX18 HGNC:26801 details
hsa-miR-450a-1-3p TACO1 translational activator of cytochrome c oxidase I HGNC:24316 details
hsa-miR-450a-1-3p TTC21B tetratricopeptide repeat domain 21B HGNC:25660 details
hsa-miR-450a-1-3p AGXT2 alanine--glyoxylate aminotransferase 2 HGNC:14412 details
hsa-miR-450a-1-3p PLLP plasmolipin HGNC:18553 details
hsa-miR-450a-1-3p CCDC80 coiled-coil domain containing 80 HGNC:30649 details
hsa-miR-450a-1-3p INMT indolethylamine N-methyltransferase HGNC:6069 details
hsa-miR-450a-1-3p ZYG11A zyg-11 family member A, cell cycle regulator HGNC:32058 details
hsa-miR-450a-1-3p ZNF641 zinc finger protein 641 HGNC:31834 details
hsa-miR-450a-1-3p ZNF286B zinc finger protein 286B (pseudogene) HGNC:33241 details
hsa-miR-450a-1-3p YME1L1 YME1 like 1 ATPase HGNC:12843 details
hsa-miR-450a-1-3p TFDP2 transcription factor Dp-2 HGNC:11751 details
hsa-miR-450a-1-3p TES testin LIM domain protein HGNC:14620 details
hsa-miR-450a-1-3p STK4 serine/threonine kinase 4 HGNC:11408 details
hsa-miR-450a-1-3p SPTBN2 spectrin beta, non-erythrocytic 2 HGNC:11276 details
hsa-miR-450a-1-3p SNRPD3 small nuclear ribonucleoprotein D3 polypeptide HGNC:11160 details
hsa-miR-450a-1-3p SLC1A5 solute carrier family 1 member 5 HGNC:10943 details
hsa-miR-450a-1-3p SIT1 signaling threshold regulating transmembrane adaptor 1 HGNC:17710 details
hsa-miR-450a-1-3p RREB1 ras responsive element binding protein 1 HGNC:10449 details
hsa-miR-450a-1-3p RAB4A RAB4A, member RAS oncogene family HGNC:9781 details
hsa-miR-450a-1-3p PARP2 poly(ADP-ribose) polymerase 2 HGNC:272 details
hsa-miR-450a-1-3p OCRL OCRL inositol polyphosphate-5-phosphatase HGNC:8108 details
hsa-miR-450a-1-3p GPBP1 GC-rich promoter binding protein 1 HGNC:29520 details
hsa-miR-450a-1-3p GOLGA3 golgin A3 HGNC:4426 details
hsa-miR-450a-1-3p FYTTD1 forty-two-three domain containing 1 HGNC:25407 details
hsa-miR-450a-1-3p FNDC3B fibronectin type III domain containing 3B HGNC:24670 details
hsa-miR-450a-1-3p FBXO45 F-box protein 45 HGNC:29148 details
hsa-miR-450a-1-3p RETREG2 reticulophagy regulator family member 2 HGNC:28450 details
hsa-miR-450a-1-3p EVI5 ecotropic viral integration site 5 HGNC:3501 details
hsa-miR-450a-1-3p DHDDS dehydrodolichyl diphosphate synthase subunit HGNC:20603 details
hsa-miR-450a-1-3p CD46 CD46 molecule HGNC:6953 details
hsa-miR-450a-1-3p C11orf58 chromosome 11 open reading frame 58 HGNC:16990 details
hsa-miR-450a-1-3p ASXL2 ASXL transcriptional regulator 2 HGNC:23805 details
hsa-miR-450a-1-3p PGPEP1 pyroglutamyl-peptidase I HGNC:13568 details
hsa-miR-450a-1-3p PRKAB2 protein kinase AMP-activated non-catalytic subunit beta 2 HGNC:9379 details
hsa-miR-450a-1-3p RBM48 RNA binding motif protein 48 HGNC:21785 details
hsa-miR-450a-1-3p APBA1 amyloid beta precursor protein binding family A member 1 HGNC:578 details
hsa-miR-450a-1-3p ISY1 ISY1 splicing factor homolog HGNC:29201 details
hsa-miR-450a-1-3p MPEG1 macrophage expressed 1 HGNC:29619 details
hsa-miR-450a-1-3p GNL3L G protein nucleolar 3 like HGNC:25553 details
hsa-miR-450a-1-3p AKT1S1 AKT1 substrate 1 HGNC:28426 details
hsa-miR-450a-1-3p CDCP1 CUB domain containing protein 1 HGNC:24357 details
hsa-miR-450a-1-3p CNTLN centlein HGNC:23432 details
hsa-miR-450a-1-3p COL1A1 collagen type I alpha 1 chain HGNC:2197 details
hsa-miR-450a-1-3p EIF1AD eukaryotic translation initiation factor 1A domain containing HGNC:28147 details
hsa-miR-450a-1-3p GPR61 G protein-coupled receptor 61 HGNC:13300 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p KDM2A lysine demethylase 2A HGNC:13606 details
hsa-miR-450a-1-3p LMNB2 lamin B2 HGNC:6638 details
hsa-miR-450a-1-3p RNF40 ring finger protein 40 HGNC:16867 details
hsa-miR-450a-1-3p SETD5 SET domain containing 5 HGNC:25566 details
hsa-miR-450a-1-3p UBC ubiquitin C HGNC:12468 details
hsa-miR-450a-1-3p CD180 CD180 molecule HGNC:6726 details
hsa-miR-450a-1-3p CGNL1 cingulin like 1 HGNC:25931 details
hsa-miR-450a-1-3p CLPB caseinolytic mitochondrial matrix peptidase chaperone subunit B HGNC:30664 details
hsa-miR-450a-1-3p CNBP CCHC-type zinc finger nucleic acid binding protein HGNC:13164 details
hsa-miR-450a-1-3p CYP51A1 cytochrome P450 family 51 subfamily A member 1 HGNC:2649 details
hsa-miR-450a-1-3p FAM151B family with sequence similarity 151 member B HGNC:33716 details
hsa-miR-450a-1-3p FOXA2 forkhead box A2 HGNC:5022 details
hsa-miR-450a-1-3p GAPVD1 GTPase activating protein and VPS9 domains 1 HGNC:23375 details
hsa-miR-450a-1-3p GINM1 glycoprotein integral membrane 1 HGNC:21074 details
hsa-miR-450a-1-3p GNAI3 G protein subunit alpha i3 HGNC:4387 details
hsa-miR-450a-1-3p HEXA hexosaminidase subunit alpha HGNC:4878 details
hsa-miR-450a-1-3p INTS13 integrator complex subunit 13 HGNC:20174 details
hsa-miR-450a-1-3p details
hsa-miR-450a-1-3p LRRC3C leucine rich repeat containing 3C HGNC:40034 details
hsa-miR-450a-1-3p MYOM2 myomesin 2 HGNC:7614 details
hsa-miR-450a-1-3p NDUFAF3 NADH:ubiquinone oxidoreductase complex assembly factor 3 HGNC:29918 details
hsa-miR-450a-1-3p PPFIBP1 PPFIA binding protein 1 HGNC:9249 details
hsa-miR-450a-1-3p RAB5B RAB5B, member RAS oncogene family HGNC:9784 details
hsa-miR-450a-1-3p REEP3 receptor accessory protein 3 HGNC:23711 details
hsa-miR-450a-1-3p S1PR2 sphingosine-1-phosphate receptor 2 HGNC:3169 details
hsa-miR-450a-1-3p SERTAD1 SERTA domain containing 1 HGNC:17932 details
hsa-miR-450a-1-3p TCF23 transcription factor 23 HGNC:18602 details
hsa-miR-450a-1-3p TMED10 transmembrane p24 trafficking protein 10 HGNC:16998 details
hsa-miR-450a-1-3p TMEM41B transmembrane protein 41B HGNC:28948 details
hsa-miR-450a-1-3p TRAPPC2B trafficking protein particle complex subunit 2B HGNC:10710 details
hsa-miR-450a-1-3p TXNDC16 thioredoxin domain containing 16 HGNC:19965 details
hsa-miR-450a-1-3p TYRO3 TYRO3 protein tyrosine kinase HGNC:12446 details
hsa-miR-450a-1-3p USP6NL USP6 N-terminal like HGNC:16858 details
hsa-miR-450a-1-3p YES1 YES proto-oncogene 1, Src family tyrosine kinase HGNC:12841 details
hsa-miR-450a-1-3p ZNF329 zinc finger protein 329 HGNC:14209 details
hsa-miR-450a-1-3p ZNF713 zinc finger protein 713 HGNC:22043 details
hsa-miR-450a-1-3p ZNF790 zinc finger protein 790 HGNC:33114 details
hsa-miR-450a-1-3p ARL5C ADP ribosylation factor like GTPase 5C HGNC:31111 details
hsa-miR-450a-1-3p GRIK2 glutamate ionotropic receptor kainate type subunit 2 HGNC:4580 details
hsa-miR-450a-1-3p MATN3 matrilin 3 HGNC:6909 details
hsa-miR-450a-1-3p MDM4 MDM4 regulator of p53 HGNC:6974 details
hsa-miR-450a-1-3p NRIP3 nuclear receptor interacting protein 3 HGNC:1167 details
hsa-miR-450a-1-3p OR1E1 olfactory receptor family 1 subfamily E member 1 HGNC:8189 details
hsa-miR-450a-1-3p PDE3A phosphodiesterase 3A HGNC:8778 details
hsa-miR-450a-1-3p RBM43 RNA binding motif protein 43 HGNC:24790 details
hsa-miR-450a-1-3p SCYL3 SCY1 like pseudokinase 3 HGNC:19285 details
hsa-miR-450a-1-3p SHISA2 shisa family member 2 HGNC:20366 details
hsa-miR-450a-1-3p SOX6 SRY-box transcription factor 6 HGNC:16421 details
hsa-miR-450a-1-3p TVP23C trans-golgi network vesicle protein 23 homolog C HGNC:30453 details
hsa-miR-450a-1-3p YY1 YY1 transcription factor HGNC:12856 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab