miRNA Card

miRNA General Information
miRNA ID hsa-miR-4528
Description Homo sapiens miR-4528 stem-loop
Comment None
Experiment Illumina [1]
Sequence UCAUUAUAUGUAUGAUCUGGAC
miRNA Expression in different cancers


circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chrX:135362814|135362948 hsa-miR-4528 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr21:39345830|39345958 hsa-miR-4528 0 1 0
chr1:102961874|102962255 hsa-miR-4528 0 1 0
chr4:182802658|182802771 hsa-miR-4528 0 1 0
chr3:158600020|158600142 hsa-miR-4528 0 1 0
chr3:196049900|196050067 hsa-miR-4528 0 1 0
chr5:109335775|109335900 hsa-miR-4528 0 1 0
chr16:67197893|67198174 hsa-miR-4528 0 1 0
chr11:68157028|68157123 hsa-miR-4528 0 1 0
chr14:24415976|24416118 hsa-miR-4528 0 1 0
chr10:84152404|84152501 hsa-miR-4528 0 1 0
chr2:61547795|61547990 hsa-miR-4528 0 1 0
chr17:17229340|17229578 hsa-miR-4528 0 1 0
chr8:22082356|22082522 hsa-miR-4528 0 1 0
chr8:22082334~22082475 hsa-miR-4528 0 1 0
chr11:68157028~68157123 hsa-miR-4528 0 1 0
chr3:158600020~158600142 hsa-miR-4528 0 1 0
chr10:5765869~5766023 hsa-miR-4528 0 1 0
chr20:45897723~45898066 hsa-miR-4528 0 1 0
chr20:24932511~24932651 hsa-miR-4528 0 1 0
chr3:69054974|69055086 hsa-miR-4528 0 1 0
chr17:46132965|46133081 hsa-miR-4528 0 1 0
chr13:102640270|102643261 hsa-miR-4528 0 1 0
chr21:44081787|44081914 hsa-miR-4528 0 1 0
chr4:13402389|13402548 hsa-miR-4528 0 1 0
chr11:68786896|68787069 hsa-miR-4528 0 1 0
chr14:68051933|68052105 hsa-miR-4528 0 1 0
chr3:71347922|71348012 hsa-miR-4528 0 1 0
chr12:68827086|68827250 hsa-miR-4528 0 1 0
chr10:70202322|70202538 hsa-miR-4528 0 1 0
chr10:13137893|13138160 hsa-miR-4528 0 1 0
chr1:40515484|40515578 hsa-miR-4528 0 1 0
chr12:107733959|107734158 hsa-miR-4528 0 1 0
chr10:72885773|72885914 hsa-miR-4528 0 1 0
chr11:57796797|57796946 hsa-miR-4528 0 1 0
chr10:17704431|17705741 hsa-miR-4528 0 1 0
chr10:125706784|125706900 hsa-miR-4528 0 1 0
chr6:11190715|11190961 hsa-miR-4528 0 1 0
chrX:118393086|118393175 hsa-miR-4528 0 1 0
chr1:236217741|236217832 hsa-miR-4528 -9 1 0
chr17:40278559|40278702 hsa-miR-4528 1 0 0
chr17:2684127|2684247 hsa-miR-4528 0 1 0
chr15:69423223|69423303 hsa-miR-4528 0 1 0
chr16:67197867|67198108 hsa-miR-4528 0 1 0
chr1:39565106|39565350 hsa-miR-4528 0 1 0
chr17:31642935|31643113 hsa-miR-4528 0 1 0
chrX:118393086|118393178 hsa-miR-4528 0 1 0
chr2:207766130|207766323 hsa-miR-4528 0 1 0
chr2:207766130|207766358 hsa-miR-4528 0 1 0
chr10:5765859|5766004 hsa-miR-4528 0 1 0
chr11:83169571|83169750 hsa-miR-4528 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4528 LNPK lunapark, ER junction formation factor HGNC:21610 details
hsa-miR-4528 ENDOU endonuclease, poly(U) specific HGNC:14369 details
hsa-miR-4528 GMNC geminin coiled-coil domain containing HGNC:40049 details
hsa-miR-4528 ZNF426 zinc finger protein 426 HGNC:20725 details
hsa-miR-4528 TMBIM6 transmembrane BAX inhibitor motif containing 6 HGNC:11723 details
hsa-miR-4528 THBS1 thrombospondin 1 HGNC:11785 details
hsa-miR-4528 TNRC6A trinucleotide repeat containing adaptor 6A HGNC:11969 details
hsa-miR-4528 RMND5A required for meiotic nuclear division 5 homolog A HGNC:25850 details
hsa-miR-4528 NRBF2 nuclear receptor binding factor 2 HGNC:19692 details
hsa-miR-4528 KIAA1109 KIAA1109 HGNC:26953 details
hsa-miR-4528 SOX11 SRY-box transcription factor 11 HGNC:11191 details
hsa-miR-4528 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils HGNC:29383 details
hsa-miR-4528 FBXL3 F-box and leucine rich repeat protein 3 HGNC:13599 details
hsa-miR-4528 E2F8 E2F transcription factor 8 HGNC:24727 details
hsa-miR-4528 BVES blood vessel epicardial substance HGNC:1152 details
hsa-miR-4528 TACR3 tachykinin receptor 3 HGNC:11528 details
hsa-miR-4528 ZNF703 zinc finger protein 703 HGNC:25883 details
hsa-miR-4528 NDST1 N-deacetylase and N-sulfotransferase 1 HGNC:7680 details
hsa-miR-4528 MBNL3 muscleblind like splicing regulator 3 HGNC:20564 details
hsa-miR-4528 HMGXB4 HMG-box containing 4 HGNC:5003 details
hsa-miR-4528 WASL WASP like actin nucleation promoting factor HGNC:12735 details
hsa-miR-4528 NPM3 nucleophosmin/nucleoplasmin 3 HGNC:7931 details
hsa-miR-4528 PUM1 pumilio RNA binding family member 1 HGNC:14957 details
hsa-miR-4528 CENPK centromere protein K HGNC:29479 details
hsa-miR-4528 KIAA1210 KIAA1210 HGNC:29218 details
hsa-miR-4528 YES1 YES proto-oncogene 1, Src family tyrosine kinase HGNC:12841 details
hsa-miR-4528 MTA3 metastasis associated 1 family member 3 HGNC:23784 details
hsa-miR-4528 MFAP3L microfibril associated protein 3 like HGNC:29083 details
hsa-miR-4528 KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-4528 KCTD10 potassium channel tetramerization domain containing 10 HGNC:23236 details
hsa-miR-4528 GP5 glycoprotein V platelet HGNC:4443 details
hsa-miR-4528 WEE1 WEE1 G2 checkpoint kinase HGNC:12761 details
hsa-miR-4528 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 HGNC:9108 details
hsa-miR-4528 PBRM1 polybromo 1 HGNC:30064 details
hsa-miR-4528 HOXA9 homeobox A9 HGNC:5109 details
hsa-miR-4528 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 HGNC:7700 details
hsa-miR-4528 ZCCHC2 zinc finger CCHC-type containing 2 HGNC:22916 details
hsa-miR-4528 TSPAN3 tetraspanin 3 HGNC:17752 details
hsa-miR-4528 TACC1 transforming acidic coiled-coil containing protein 1 HGNC:11522 details
hsa-miR-4528 PCTP phosphatidylcholine transfer protein HGNC:8752 details
hsa-miR-4528 DUSP8 dual specificity phosphatase 8 HGNC:3074 details
hsa-miR-4528 DUSP14 dual specificity phosphatase 14 HGNC:17007 details
hsa-miR-4528 AGO3 argonaute RISC catalytic component 3 HGNC:18421 details
hsa-miR-4528 ATXN3 ataxin 3 HGNC:7106 details
hsa-miR-4528 RPS21 ribosomal protein S21 HGNC:10409 details
hsa-miR-4528 PRPF4B pre-mRNA processing factor 4B HGNC:17346 details
hsa-miR-4528 details
hsa-miR-4528 ASB1 ankyrin repeat and SOCS box containing 1 HGNC:16011 details
hsa-miR-4528 SNX18 sorting nexin 18 HGNC:19245 details
hsa-miR-4528 SMAD4 SMAD family member 4 HGNC:6770 details
hsa-miR-4528 NR3C1 nuclear receptor subfamily 3 group C member 1 HGNC:7978 details
hsa-miR-4528 LEPROT leptin receptor overlapping transcript HGNC:29477 details
hsa-miR-4528 CLDND1 claudin domain containing 1 HGNC:1322 details
hsa-miR-4528 FNBP1 formin binding protein 1 HGNC:17069 details
hsa-miR-4528 details
hsa-miR-4528 SEC63 SEC63 homolog, protein translocation regulator HGNC:21082 details
hsa-miR-4528 MIA3 MIA SH3 domain ER export factor 3 HGNC:24008 details
hsa-miR-4528 KANSL1 KAT8 regulatory NSL complex subunit 1 HGNC:24565 details
hsa-miR-4528 XRCC5 X-ray repair cross complementing 5 HGNC:12833 details
hsa-miR-4528 HRK harakiri, BCL2 interacting protein HGNC:5185 details
hsa-miR-4528 CYLD CYLD lysine 63 deubiquitinase HGNC:2584 details
hsa-miR-4528 RASSF6 Ras association domain family member 6 HGNC:20796 details
hsa-miR-4528 ZBTB25 zinc finger and BTB domain containing 25 HGNC:13112 details
hsa-miR-4528 WDR35 WD repeat domain 35 HGNC:29250 details
hsa-miR-4528 UHMK1 U2AF homology motif kinase 1 HGNC:19683 details
hsa-miR-4528 TM4SF1 transmembrane 4 L six family member 1 HGNC:11853 details
hsa-miR-4528 SPPL2A signal peptide peptidase like 2A HGNC:30227 details
hsa-miR-4528 SESTD1 SEC14 and spectrin domain containing 1 HGNC:18379 details
hsa-miR-4528 SERINC3 serine incorporator 3 HGNC:11699 details
hsa-miR-4528 PELP1 proline, glutamate and leucine rich protein 1 HGNC:30134 details
hsa-miR-4528 RRP36 ribosomal RNA processing 36 HGNC:21374 details
hsa-miR-4528 NEGR1 neuronal growth regulator 1 HGNC:17302 details
hsa-miR-4528 details
hsa-miR-4528 DNMT3A DNA methyltransferase 3 alpha HGNC:2978 details
hsa-miR-4528 ACTN4 actinin alpha 4 HGNC:166 details
hsa-miR-4528 EREG epiregulin HGNC:3443 details
hsa-miR-4528 S100A16 S100 calcium binding protein A16 HGNC:20441 details
hsa-miR-4528 C5orf46 chromosome 5 open reading frame 46 HGNC:33768 details
hsa-miR-4528 GABRA4 gamma-aminobutyric acid type A receptor subunit alpha4 HGNC:4078 details
hsa-miR-4528 SMIM21 small integral membrane protein 21 HGNC:27598 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab