CircNet

miRNA General Information

Basic
Network

miRNA ID	hsa-miR-4635
Description	Homo sapiens miR-4635 stem-loop
Comment	None
Experiment	Illumina [1]
Sequence	UCUUGAAGUCAGAACCCGCAA

miRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr15:41507215\|41507605	hsa-miR-4635	1	1
chr8:22420173\|22420276	hsa-miR-4635	1	1
chr8:22420170\|22420276	hsa-miR-4635	1	1
chr9:37860051\|37860193	hsa-miR-4635	1	1

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr12:132825784\|132825956	hsa-miR-4635	0	1
chr18:61809568\|61809684	hsa-miR-4635	0	1
chr2:70988343\|70988508	hsa-miR-4635	0	1
chr2:70988375\|70988501	hsa-miR-4635	0	1
chr1:156466940\|156467229	hsa-miR-4635	0	1
chr7:134565343\|134565488	hsa-miR-4635	0	1
chr2:218275068\|218275214	hsa-miR-4635	0	1
chr6:159679761\|159679946	hsa-miR-4635	0	1
chr19:11576441\|11576590	hsa-miR-4635	0	1
chrX:65741670\|65741830	hsa-miR-4635	0	1
chr1:241513603\|241517201	hsa-miR-4635	0	1
chr5:154458367\|154458520	hsa-miR-4635	0	1
chr1:25823700\|25826406	hsa-miR-4635	0	1
chr10:73249030\|73249166	hsa-miR-4635	0	1
chrX:67727782\|67728121	hsa-miR-4635	0	1
chr17:44206691\|44206809	hsa-miR-4635	0	1
chr4:184386910\|184387106	hsa-miR-4635	0	1
chr10:133281350\|133281433	hsa-miR-4635	0	1
chr21:46122885\|46124713	hsa-miR-4635	0	1
chrX:118793864\|118793984	hsa-miR-4635	0	1
chr8:28751000\|28751166	hsa-miR-4635	0	1
chr19:49687931\|49688279	hsa-miR-4635	0	1
chr20:3873236\|3873327	hsa-miR-4635	0	1
chr16:8796148\|8796249	hsa-miR-4635	1	0
chr8:102833108\|102833218	hsa-miR-4635	1	0
chr9:113290705\|113290946	hsa-miR-4635	1	0
chr5:176653659\|176653885	hsa-miR-4635	0	1
chr1:156466974\|156467185	hsa-miR-4635	0	1
chr2:24768117\|24768299	hsa-miR-4635	0	1
chr16:48354994\|48355246	hsa-miR-4635	0	1
chr10:17450598\|17450690	hsa-miR-4635	0	1
chr1:211271610\|211271835	hsa-miR-4635	0	1
chr12:132825812\|132825956	hsa-miR-4635	0	1
chr20:20033150\|20033366	hsa-miR-4635	0	1
chr6:31269000\|31269148	hsa-miR-4635	0	1
chr11:86945874\|86946008	hsa-miR-4635	0	1
chr5:177483895\|177484164	hsa-miR-4635	0	1
chr17:32480571\|32480804	hsa-miR-4635	0	1
chr16:30778644\|30778790	hsa-miR-4635	0	1
chr3:160431689\|160431812	hsa-miR-4635	0	1
chr8:127420829\|127420963	hsa-miR-4635	0	1
chr2:231795208\|231795481	hsa-miR-4635	0	1
chr17:1678846\|1679064	hsa-miR-4635	0	1
chr1:180197500\|180197667	hsa-miR-4635	0	1
chr12:132825809\|132825956	hsa-miR-4635	0	1
chr17:5558827\|5559073	hsa-miR-4635	0	1
chr15:57273113\|57273262	hsa-miR-4635	0	1
chr18:63310022\|63310156	hsa-miR-4635	0	1
chr6:21596219\|21596373	hsa-miR-4635	0	1
chr16:2759569\|2759661	hsa-miR-4635	0	1
chr15:41898477\|41898593	hsa-miR-4635	0	1
chr12:49128126\|49128312	hsa-miR-4635	0	1
chr3:42224341\|42224475	hsa-miR-4635	0	1
chr13:23337821\|23337924	hsa-miR-4635	0	1
chr1:147179111\|147179256	hsa-miR-4635	0	1
chr12:56132224\|56132438	hsa-miR-4635	0	1
chr9:124313968\|124321569	hsa-miR-4635	0	1
chr19:49098432\|49098693	hsa-miR-4635	0	1
chr6:75181003\|75181080	hsa-miR-4635	0	1
chr17:29575288\|29575447	hsa-miR-4635	0	1
chr12:109535384\|109535564	hsa-miR-4635	0	1
chr17:29575288\|29575462	hsa-miR-4635	0	1
chr15:98962692\|98962772	hsa-miR-4635	0	1
chr19:6686746\|6686874	hsa-miR-4635	0	1
chr19:4504030\|4504189	hsa-miR-4635	0	1
chr1:58782159\|58782320	hsa-miR-4635	0	1
chr14:64728996\|64730282	hsa-miR-4635	0	1
chr17:7501919\|7502040	hsa-miR-4635	0	1
chr1:11975042~11975265	hsa-miR-4635	0	1
chr1:203488878~203489080	hsa-miR-4635	0	1
chr8:27733821~27734057	hsa-miR-4635	0	1
chr14:37591476~37591610	hsa-miR-4635	0	1
chr22:37679614~37679782	hsa-miR-4635	0	1
chr8:96231774~96231911	hsa-miR-4635	0	1
chr1:206591813~206593679	hsa-miR-4635	0	1
chr14:23063488~23063556	hsa-miR-4635	0	1
chr6:36927902~36928007	hsa-miR-4635	0	1
chr11:67050002~67050145	hsa-miR-4635	0	1
chr1:241513603~241517201	hsa-miR-4635	0	1
chr5:75360748~75360915	hsa-miR-4635	0	1
chr1:151316344~151316474	hsa-miR-4635	0	1
chr12:82374070~82374190	hsa-miR-4635	0	1
chr2:70988375~70988501	hsa-miR-4635	0	1
chr6:159679761~159679946	hsa-miR-4635	0	1
chr19:39025212~39025314	hsa-miR-4635	0	1
chr14:102049831~102050128	hsa-miR-4635	0	1
chrX:65741670~65741830	hsa-miR-4635	0	1
chr2:219146680\|219147696	hsa-miR-4635	0	1
chr19:37363189~37363297	hsa-miR-4635	0	1
chr9:135098419~135106780	hsa-miR-4635	0	1
chr1:156466974~156467185	hsa-miR-4635	0	1
chr19:41286210\|41286320	hsa-miR-4635	0	1
chr19:54160986~54161255	hsa-miR-4635	0	1
chr1:181060287~181060431	hsa-miR-4635	0	1
chr10:73776455~73776578	hsa-miR-4635	0	1
chr11:66272189~66272408	hsa-miR-4635	0	1
chr14:24116105~24116256	hsa-miR-4635	0	1
chr10:73249030~73249166	hsa-miR-4635	0	1
chr17:82242963~82243065	hsa-miR-4635	0	1
chr1:150578608~150578749	hsa-miR-4635	0	1
chr6:106512922~106513012	hsa-miR-4635	0	1
chr12:49763986~49764188	hsa-miR-4635	0	1
chr5:141576784~141576869	hsa-miR-4635	0	1
chr7:87550246~87550549	hsa-miR-4635	0	1
chr3:185508334~185508488	hsa-miR-4635	0	1
chr11:72576385~72576517	hsa-miR-4635	0	1
chr1:150153339~150153482	hsa-miR-4635	0	1
chr17:45151767~45151887	hsa-miR-4635	0	1
chr4:70689832~70689976	hsa-miR-4635	0	1
chr16:89281198\|89281339	hsa-miR-4635	0	1
chr1:161001020\|161001326	hsa-miR-4635	0	1
chr1:20773953\|20774084	hsa-miR-4635	0	1
chr17:81460303\|81460673	hsa-miR-4635	0	1
chr7:65725275\|65725417	hsa-miR-4635	0	1
chr13:29830948\|29831121	hsa-miR-4635	0	1
chr3:160442842\|160442982	hsa-miR-4635	0	1
chrX:23784775\|23784911	hsa-miR-4635	0	1
chr1:181060287\|181060431	hsa-miR-4635	0	1
chr1:11786176\|11786321	hsa-miR-4635	0	1
chr7:2149152\|2149238	hsa-miR-4635	0	1
chr5:135350262\|135350415	hsa-miR-4635	0	1
chr11:67397548\|67397653	hsa-miR-4635	0	1
chr8:96231774\|96231911	hsa-miR-4635	0	1
chr2:85316017\|85316146	hsa-miR-4635	0	1
chr8:38789937\|38790069	hsa-miR-4635	1	0
chr19:3169414\|3169526	hsa-miR-4635	0	1
chrX:47626891\|47627227	hsa-miR-4635	0	1
chr19:8499547\|8499687	hsa-miR-4635	0	1
chr1:44468687\|44468780	hsa-miR-4635	0	1
chr17:78400735\|78401057	hsa-miR-4635	0	1
chr19:41924569\|41924705	hsa-miR-4635	0	1
chr6:20123571\|20123722	hsa-miR-4635	0	1
chr22:31481612\|31481820	hsa-miR-4635	0	1
chr12:82374070\|82374190	hsa-miR-4635	0	1
chr15:63532834\|63533013	hsa-miR-4635	0	1
chr8:37874839\|37875019	hsa-miR-4635	0	1
chr12:123753552\|123753701	hsa-miR-4635	0	1
chrX:101412475\|101412668	hsa-miR-4635	1	0
chr3:13618906\|13619017	hsa-miR-4635	1	0
chrX:101412475\|101412704	hsa-miR-4635	1	0
chr1:203308020\|203308148	hsa-miR-4635	1	0
chr12:122145645\|122145791	hsa-miR-4635	0	1
chr1:151048207\|151048385	hsa-miR-4635	0	1
chr9:123382412\|123382599	hsa-miR-4635	0	1
chr7:128801377\|128801509	hsa-miR-4635	0	1
chr11:34658628\|34658880	hsa-miR-4635	0	1
chr20:5119755\|5119873	hsa-miR-4635	0	1
chr9:19126034\|19126172	hsa-miR-4635	0	1
chr16:30778649\|30778757	hsa-miR-4635	0	1
chr4:70689845\|70690064	hsa-miR-4635	0	1
chr10:125816177\|125816465	hsa-miR-4635	0	1
chr2:218275088\|218275214	hsa-miR-4635	0	1
chr12:49764118\|49764272	hsa-miR-4635	0	1
chr16:31325351\|31325622	hsa-miR-4635	0	1
chr2:10912673\|10912792	hsa-miR-4635	0	1
chr1:58782159\|58782326	hsa-miR-4635	0	1
chr14:24440514\|24440691	hsa-miR-4635	0	1
chr1:58782159\|58782296	hsa-miR-4635	0	1
chr14:23063488\|23063556	hsa-miR-4635	0	1
chr11:66272189\|66272408	hsa-miR-4635	0	1
chr19:6686264\|6686892	hsa-miR-4635	0	1
chr1:151048240\|151048531	hsa-miR-4635	0	1
chr11:130143955\|130144169	hsa-miR-4635	0	1
chr17:29575288\|29575457	hsa-miR-4635	0	1
chr15:89785303\|89785423	hsa-miR-4635	0	1
chr4:24554725\|24554818	hsa-miR-4635	0	1
chr16:68370976\|68371113	hsa-miR-4635	0	1
chr8:102281497\|102285271	hsa-miR-4635	0	1
chr12:101801806\|101801981	hsa-miR-4635	0	1
chr2:241337084\|241337337	hsa-miR-4635	0	1
chr17:8161045\|8161203	hsa-miR-4635	0	1
chr15:52278632\|52278731	hsa-miR-4635	0	1
chr10:94534635\|94534826	hsa-miR-4635	0	1
chr19:35637163\|35637323	hsa-miR-4635	0	1
chr3:160431674\|160431812	hsa-miR-4635	0	1
chr19:6686264\|6686877	hsa-miR-4635	0	1
chr6:31354141\|31354270	hsa-miR-4635	0	1
chr17:82242824\|82243050	hsa-miR-4635	0	1
chr12:128794534\|128794677	hsa-miR-4635	0	1
chr20:58909749\|58910040	hsa-miR-4635	0	1
chr12:49272731\|49272952	hsa-miR-4635	0	1
chr1:58782159\|58782255	hsa-miR-4635	0	1
chr1:154924771\|154924911	hsa-miR-4635	0	1
chr17:78174850\|78175074	hsa-miR-4635	0	1
chr15:40853141\|40853245	hsa-miR-4635	0	1
chr16:410701\|411021	hsa-miR-4635	0	1
chr12:121249815\|121250016	hsa-miR-4635	0	1
chr5:172336844\|172336958	hsa-miR-4635	0	1
chr1:154924769\|154924911	hsa-miR-4635	0	1
chr1:214656974\|214657143	hsa-miR-4635	0	1
chr12:49763986\|49764188	hsa-miR-4635	0	1
chr16:29980037\|29980242	hsa-miR-4635	0	1
chr11:66272189\|66272411	hsa-miR-4635	0	1
chr19:10142019\|10142168	hsa-miR-4635	0	1
chr8:143691937\|143692037	hsa-miR-4635	0	1
chr9:135098419\|135106780	hsa-miR-4635	0	1
chr16:56943153\|56943361	hsa-miR-4635	0	1
chr17:75499608\|75499816	hsa-miR-4635	0	1
chr9:130886536\|130886905	hsa-miR-4635	0	1
chr7:104913239\|104913391	hsa-miR-4635	0	1
chr17:48562536\|48562673	hsa-miR-4635	0	1
chr11:34658542\|34658673	hsa-miR-4635	0	1
chr16:979167\|979313	hsa-miR-4635	0	1
chr17:7577569\|7577870	hsa-miR-4635	0	1
chr15:65577194\|65577284	hsa-miR-4635	0	1
chr12:12950734\|12950898	hsa-miR-4635	0	1
chr22:36266944\|36267225	hsa-miR-4635	0	1
chr17:63608126\|63608257	hsa-miR-4635	0	1
chr10:7220411\|7285954	hsa-miR-4635	0	1
chr10:7220411\|7227937	hsa-miR-4635	0	1
chr1:11975230\|11975452	hsa-miR-4635	0	1
chr6:24534103\|24534226	hsa-miR-4635	0	1
chr3:49021360\|49021485	hsa-miR-4635	0	1
chr19:40608313\|40608516	hsa-miR-4635	0	1
chr2:70988375\|70988508	hsa-miR-4635	0	1
chr17:4955204\|4955584	hsa-miR-4635	0	1
chr19:54160986\|54161263	hsa-miR-4635	0	1
chr15:40853124\|40853245	hsa-miR-4635	0	1
chr11:66272189\|66272401	hsa-miR-4635	0	1
chr17:39635928\|39636028	hsa-miR-4635	0	1
chr19:6686264\|6686874	hsa-miR-4635	0	1
chr17:48863138\|48863313	hsa-miR-4635	0	1
chr8:123204062\|123204217	hsa-miR-4635	0	1
chrX:65741563\|65741830	hsa-miR-4635	0	1
chr16:11548238\|11548408	hsa-miR-4635	0	1
chr11:72003017\|72003272	hsa-miR-4635	0	1
chr21:39213949\|39214093	hsa-miR-4635	0	1
chr1:151048240\|151048385	hsa-miR-4635	0	1
chr19:49497236\|49497357	hsa-miR-4635	0	1
chr15:90644958\|90645098	hsa-miR-4635	0	1
chr17:7577569\|7577892	hsa-miR-4635	0	1
chr22:36266944\|36267073	hsa-miR-4635	0	1
chr19:49688168\|49688351	hsa-miR-4635	0	1
chr22:38092638\|38092765	hsa-miR-4635	0	1
chr11:68166760\|68167004	hsa-miR-4635	0	1
chr14:24313875\|24314029	hsa-miR-4635	0	1
chr19:37363189\|37363297	hsa-miR-4635	0	1
chr6:21596228\|21596373	hsa-miR-4635	0	1
chr19:10142088\|10142204	hsa-miR-4635	0	1
chr7:6163104\|6163259	hsa-miR-4635	0	1
chr16:766440\|766911	hsa-miR-4635	0	1
chr1:1338099\|1338290	hsa-miR-4635	0	1
chr21:33554841\|33555007	hsa-miR-4635	0	1
chr6:7283666\|7283794	hsa-miR-4635	0	1
chr20:3873238\|3873327	hsa-miR-4635	0	1
chr1:161001084\|161021049	hsa-miR-4635	-10	1
chr9:121718750\|121718920	hsa-miR-4635	-5	1
chr19:55202056\|55205592	hsa-miR-4635	-5	1
chr12:122190633\|122190792	hsa-miR-4635	-10	1
chr6:163478780\|163478896	hsa-miR-4635	-9	1
chr1:11975149\|11975289	hsa-miR-4635	-7	1
chr1:203486939\|203487120	hsa-miR-4635	-5	1
chr4:663791\|664173	hsa-miR-4635	-4	1
chr1:150578608\|150578749	hsa-miR-4635	-7	1
chr22:44497063\|44497350	hsa-miR-4635	1	0
chrX:101412475\|101412641	hsa-miR-4635	1	0
chr1:58782159\|58782266	hsa-miR-4635	0	1
chr16:30778649\|30778755	hsa-miR-4635	0	1
chr11:57700691\|57700799	hsa-miR-4635	0	1
chr17:29575288\|29575455	hsa-miR-4635	0	1
chr5:58455733\|58456095	hsa-miR-4635	0	1
chr17:29575288\|29575369	hsa-miR-4635	0	1
chr19:52034014\|52034144	hsa-miR-4635	0	1
chr15:40853151\|40853251	hsa-miR-4635	0	1
chr2:24769836\|24770034	hsa-miR-4635	0	1
chr12:132825731\|132825956	hsa-miR-4635	0	1
chr17:17061202\|17061338	hsa-miR-4635	0	1
chr1:58782159\|58782392	hsa-miR-4635	0	1
chr17:82242963\|82243069	hsa-miR-4635	0	1
chr19:38801836\|38802069	hsa-miR-4635	0	1
chr3:51684494\|51684615	hsa-miR-4635	0	1
chr8:29336622\|29336792	hsa-miR-4635	0	1
chr16:30778649\|30778780	hsa-miR-4635	0	1
chr7:898880\|899099	hsa-miR-4635	0	1
chr20:46457675\|46457799	hsa-miR-4635	0	1
chr17:4558198\|4558332	hsa-miR-4635	0	1
chr1:160211573\|160211716	hsa-miR-4635	0	1
chr7:898830\|899060	hsa-miR-4635	0	1
chr11:57700678\|57700799	hsa-miR-4635	0	1
chr17:4558227\|4558351	hsa-miR-4635	0	1
chr8:29336622\|29336819	hsa-miR-4635	0	1
chr19:40608313\|40608574	hsa-miR-4635	0	1
chr17:1678831\|1679070	hsa-miR-4635	0	1
chr16:30778624\|30778805	hsa-miR-4635	0	1
chr12:49272727\|49272952	hsa-miR-4635	0	1
chr12:62644322\|62644479	hsa-miR-4635	0	1
chr17:81720769\|81720873	hsa-miR-4635	0	1
chr6:75703030\|75709630	hsa-miR-4635	0	1
chr22:30656271\|30656352	hsa-miR-4635	0	1
chr15:75360342\|75360459	hsa-miR-4635	0	1
chr1:52687232\|52687358	hsa-miR-4635	0	1
chr17:48863138\|48863294	hsa-miR-4635	0	1
chr17:29575288\|29575396	hsa-miR-4635	0	1
chr5:154458372\|154458520	hsa-miR-4635	0	1
chr16:2759368\|2759774	hsa-miR-4635	0	1
chr22:36266948\|36267097	hsa-miR-4635	0	1
chr12:49272664\|49272967	hsa-miR-4635	0	1
chr8:42549310\|42549595	hsa-miR-4635	0	1
chr20:2117208\|2117367	hsa-miR-4635	0	1
chr16:30778649\|30778764	hsa-miR-4635	0	1
chrX:65741673\|65741830	hsa-miR-4635	0	1
chr7:16792727\|16792905	hsa-miR-4635	0	1
chr17:43045131\|43045229	hsa-miR-4635	0	1
chr17:48725534\|48725618	hsa-miR-4635	0	1
chr2:218754263\|218754491	hsa-miR-4635	0	1
chr16:30778649\|30778805	hsa-miR-4635	0	1
chr7:898850\|899099	hsa-miR-4635	0	1
chr12:49764040\|49764195	hsa-miR-4635	0	1
chr11:71438963\|71439074	hsa-miR-4635	0	1
chr9:130887254\|130887414	hsa-miR-4635	0	1
chr14:24440514\|24440756	hsa-miR-4635	0	1
chr1:109751995\|109752173	hsa-miR-4635	0	1
chr1:50595972\|50596085	hsa-miR-4635	0	1
chr1:109751995\|109752150	hsa-miR-4635	0	1
chr12:118043209\|118043366	hsa-miR-4635	0	1
chr6:159679830\|159679987	hsa-miR-4635	0	1
chr7:100577127\|100577389	hsa-miR-4635	0	1
chr12:111840998\|111841136	hsa-miR-4635	0	1
chrX:101412482\|101412610	hsa-miR-4635	1	0
chr12:90824945\|90825113	hsa-miR-4635	1	0
chrX:101412482\|101412704	hsa-miR-4635	1	0
chrX:101412433\|101412704	hsa-miR-4635	1	0

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-miR-4635	EPOP	elongin BC and polycomb repressive complex 2 associated protein	HGNC:34493	details
hsa-miR-4635	PLCB3	phospholipase C beta 3	HGNC:9056	details
hsa-miR-4635	ZFP3	ZFP3 zinc finger protein	HGNC:12861	details
hsa-miR-4635	MFSD14C	major facilitator superfamily domain containing 14C	HGNC:23672	details
hsa-miR-4635	S1PR2	sphingosine-1-phosphate receptor 2	HGNC:3169	details
hsa-miR-4635	SYNM	synemin	HGNC:24466	details
hsa-miR-4635	TMPRSS4	transmembrane serine protease 4	HGNC:11878	details
hsa-miR-4635				details
hsa-miR-4635	TRIQK	triple QxxK/R motif containing	HGNC:27828	details
hsa-miR-4635	ATOX1	antioxidant 1 copper chaperone	HGNC:798	details
hsa-miR-4635				details
hsa-miR-4635	ABCG2	ATP binding cassette subfamily G member 2 (Junior blood group)	HGNC:74	details
hsa-miR-4635	CLCN3	chloride voltage-gated channel 3	HGNC:2021	details
hsa-miR-4635				details
hsa-miR-4635	WNT5A	Wnt family member 5A	HGNC:12784	details
hsa-miR-4635	UBN2	ubinuclein 2	HGNC:21931	details
hsa-miR-4635	CD200R1	CD200 receptor 1	HGNC:24235	details
hsa-miR-4635	WWTR1	WW domain containing transcription regulator 1	HGNC:24042	details
hsa-miR-4635	UBE2D3	ubiquitin conjugating enzyme E2 D3	HGNC:12476	details
hsa-miR-4635	NCOA4	nuclear receptor coactivator 4	HGNC:7671	details
hsa-miR-4635	CDKL2	cyclin dependent kinase like 2	HGNC:1782	details
hsa-miR-4635	ARHGEF28	Rho guanine nucleotide exchange factor 28	HGNC:30322	details
hsa-miR-4635	ECE1	endothelin converting enzyme 1	HGNC:3146	details
hsa-miR-4635	CSTF2	cleavage stimulation factor subunit 2	HGNC:2484	details
hsa-miR-4635	WDR26	WD repeat domain 26	HGNC:21208	details
hsa-miR-4635	CERKL	ceramide kinase like	HGNC:21699	details
hsa-miR-4635	POLR1B	RNA polymerase I subunit B	HGNC:20454	details
hsa-miR-4635	SAMD12	sterile alpha motif domain containing 12	HGNC:31750	details
hsa-miR-4635	PHF14	PHD finger protein 14	HGNC:22203	details
hsa-miR-4635	PSG11	pregnancy specific beta-1-glycoprotein 11	HGNC:9516	details
hsa-miR-4635	TMEM106B	transmembrane protein 106B	HGNC:22407	details
hsa-miR-4635	CXXC4	CXXC finger protein 4	HGNC:24593	details
hsa-miR-4635	ZKSCAN5	zinc finger with KRAB and SCAN domains 5	HGNC:12867	details
hsa-miR-4635	BOLL	boule homolog, RNA binding protein	HGNC:14273	details
hsa-miR-4635	FAXC	failed axon connections homolog, metaxin like GST domain containing	HGNC:20742	details
hsa-miR-4635	TMC5	transmembrane channel like 5	HGNC:22999	details
hsa-miR-4635	CWC27	CWC27 spliceosome associated cyclophilin	HGNC:10664	details
hsa-miR-4635	RREB1	ras responsive element binding protein 1	HGNC:10449	details
hsa-miR-4635	NDNF	neuron derived neurotrophic factor	HGNC:26256	details
hsa-miR-4635	PLXDC2	plexin domain containing 2	HGNC:21013	details
hsa-miR-4635	KIF1B	kinesin family member 1B	HGNC:16636	details
hsa-miR-4635	TBC1D8	TBC1 domain family member 8	HGNC:17791	details
hsa-miR-4635	RCC2	regulator of chromosome condensation 2	HGNC:30297	details
hsa-miR-4635	GLO1	glyoxalase I	HGNC:4323	details
hsa-miR-4635	KLF17	Kruppel like factor 17	HGNC:18830	details
hsa-miR-4635	MCTS1	MCTS1 re-initiation and release factor	HGNC:23357	details
hsa-miR-4635	FPGT	fucose-1-phosphate guanylyltransferase	HGNC:3825	details
hsa-miR-4635	LRRC1	leucine rich repeat containing 1	HGNC:14307	details
hsa-miR-4635	BRCC3	BRCA1/BRCA2-containing complex subunit 3	HGNC:24185	details
hsa-miR-4635	MAP3K7	mitogen-activated protein kinase kinase kinase 7	HGNC:6859	details
hsa-miR-4635	HEY2	hes related family bHLH transcription factor with YRPW motif 2	HGNC:4881	details
hsa-miR-4635	CDC73	cell division cycle 73	HGNC:16783	details
hsa-miR-4635	NEK7	NIMA related kinase 7	HGNC:13386	details
hsa-miR-4635	RCOR3	REST corepressor 3	HGNC:25594	details
hsa-miR-4635	ZNF548	zinc finger protein 548	HGNC:26561	details
hsa-miR-4635	C8A	complement C8 alpha chain	HGNC:1352	details
hsa-miR-4635	C17orf80	chromosome 17 open reading frame 80	HGNC:29601	details
hsa-miR-4635	HELZ	helicase with zinc finger	HGNC:16878	details
hsa-miR-4635	HHLA2	HERV-H LTR-associating 2	HGNC:4905	details
hsa-miR-4635	TBC1D8B	TBC1 domain family member 8B	HGNC:24715	details
hsa-miR-4635	GM2A	GM2 ganglioside activator	HGNC:4367	details
hsa-miR-4635	EFCAB6	EF-hand calcium binding domain 6	HGNC:24204	details
hsa-miR-4635	CYP20A1	cytochrome P450 family 20 subfamily A member 1	HGNC:20576	details
hsa-miR-4635	ZFAND4	zinc finger AN1-type containing 4	HGNC:23504	details
hsa-miR-4635	TMEM215	transmembrane protein 215	HGNC:33816	details
hsa-miR-4635	OAS2	2'-5'-oligoadenylate synthetase 2	HGNC:8087	details
hsa-miR-4635	TMEM167B	transmembrane protein 167B	HGNC:30187	details
hsa-miR-4635	FUT10	fucosyltransferase 10	HGNC:19234	details
hsa-miR-4635	PSG3	pregnancy specific beta-1-glycoprotein 3	HGNC:9520	details
hsa-miR-4635	MYEF2	myelin expression factor 2	HGNC:17940	details
hsa-miR-4635	KIF1C	kinesin family member 1C	HGNC:6317	details
hsa-miR-4635				details
hsa-miR-4635	STK17A	serine/threonine kinase 17a	HGNC:11395	details
hsa-miR-4635	RGS5	regulator of G protein signaling 5	HGNC:10001	details
hsa-miR-4635	NAXD	NAD(P)HX dehydratase	HGNC:25576	details
hsa-miR-4635	TMEM9B	TMEM9 domain family member B	HGNC:1168	details
hsa-miR-4635	RSF1	remodeling and spacing factor 1	HGNC:18118	details
hsa-miR-4635	STARD5	StAR related lipid transfer domain containing 5	HGNC:18065	details
hsa-miR-4635	SLFN5	schlafen family member 5	HGNC:28286	details
hsa-miR-4635	ADH5	alcohol dehydrogenase 5 (class III), chi polypeptide	HGNC:253	details
hsa-miR-4635	ZSCAN21	zinc finger and SCAN domain containing 21	HGNC:13104	details
hsa-miR-4635	RASA2	RAS p21 protein activator 2	HGNC:9872	details
hsa-miR-4635	FER	FER tyrosine kinase	HGNC:3655	details
hsa-miR-4635	ZC3H12C	zinc finger CCCH-type containing 12C	HGNC:29362	details
hsa-miR-4635	IFNK	interferon kappa	HGNC:21714	details
hsa-miR-4635	HMGCLL1	3-hydroxymethyl-3-methylglutaryl-CoA lyase like 1	HGNC:21359	details
hsa-miR-4635	MRPS5	mitochondrial ribosomal protein S5	HGNC:14498	details
hsa-miR-4635	LLPH	LLP homolog, long-term synaptic facilitation factor	HGNC:28229	details
hsa-miR-4635	MSH3	mutS homolog 3	HGNC:7326	details
hsa-miR-4635	CUL3	cullin 3	HGNC:2553	details
hsa-miR-4635	AGPS	alkylglycerone phosphate synthase	HGNC:327	details
hsa-miR-4635	DNAJC10	DnaJ heat shock protein family (Hsp40) member C10	HGNC:24637	details
hsa-miR-4635	IL7	interleukin 7	HGNC:6023	details
hsa-miR-4635	ZNF264	zinc finger protein 264	HGNC:13057	details
hsa-miR-4635	CREBBP	CREB binding protein	HGNC:2348	details
hsa-miR-4635	RPS6KA5	ribosomal protein S6 kinase A5	HGNC:10434	details
hsa-miR-4635	C12orf4	chromosome 12 open reading frame 4	HGNC:1184	details
hsa-miR-4635	TMCC3	transmembrane and coiled-coil domain family 3	HGNC:29199	details
hsa-miR-4635	EPC2	enhancer of polycomb homolog 2	HGNC:24543	details
hsa-miR-4635	TRNT1	tRNA nucleotidyl transferase 1	HGNC:17341	details
hsa-miR-4635	STRIP2	striatin interacting protein 2	HGNC:22209	details
hsa-miR-4635	CANX	calnexin	HGNC:1473	details
hsa-miR-4635				details
hsa-miR-4635	MSH6	mutS homolog 6	HGNC:7329	details
hsa-miR-4635	CDX1	caudal type homeobox 1	HGNC:1805	details
hsa-miR-4635	ENDOU	endonuclease, poly(U) specific	HGNC:14369	details
hsa-miR-4635	BRMS1L	BRMS1 like transcriptional repressor	HGNC:20512	details
hsa-miR-4635	SEMA4G	semaphorin 4G	HGNC:10735	details
hsa-miR-4635	CCDC80	coiled-coil domain containing 80	HGNC:30649	details
hsa-miR-4635	TRIP13	thyroid hormone receptor interactor 13	HGNC:12307	details
hsa-miR-4635	IL1RAP	interleukin 1 receptor accessory protein	HGNC:5995	details
hsa-miR-4635	B4GALT7	beta-1,4-galactosyltransferase 7	HGNC:930	details
hsa-miR-4635	AKAP11	A-kinase anchoring protein 11	HGNC:369	details
hsa-miR-4635	HS3ST1	heparan sulfate-glucosamine 3-sulfotransferase 1	HGNC:5194	details
hsa-miR-4635	ZNF704	zinc finger protein 704	HGNC:32291	details
hsa-miR-4635	UPF1	UPF1 RNA helicase and ATPase	HGNC:9962	details
hsa-miR-4635	TSR1	TSR1 ribosome maturation factor	HGNC:25542	details
hsa-miR-4635	TNRC6C	trinucleotide repeat containing adaptor 6C	HGNC:29318	details
hsa-miR-4635	TNFAIP3	TNF alpha induced protein 3	HGNC:11896	details
hsa-miR-4635	SLC45A4	solute carrier family 45 member 4	HGNC:29196	details
hsa-miR-4635	SH3GLB1	SH3 domain containing GRB2 like, endophilin B1	HGNC:10833	details
hsa-miR-4635	RMND5A	required for meiotic nuclear division 5 homolog A	HGNC:25850	details
hsa-miR-4635	PLCG1	phospholipase C gamma 1	HGNC:9065	details
hsa-miR-4635	ONECUT1	one cut homeobox 1	HGNC:8138	details
hsa-miR-4635	NCALD	neurocalcin delta	HGNC:7655	details
hsa-miR-4635	MAPK9	mitogen-activated protein kinase 9	HGNC:6886	details
hsa-miR-4635	LIPC	lipase C, hepatic type	HGNC:6619	details
hsa-miR-4635	KLHL20	kelch like family member 20	HGNC:25056	details
hsa-miR-4635	HINT1	histidine triad nucleotide binding protein 1	HGNC:4912	details
hsa-miR-4635	HDX	highly divergent homeobox	HGNC:26411	details
hsa-miR-4635	FEM1C	fem-1 homolog C	HGNC:16933	details
hsa-miR-4635	CLOCK	clock circadian regulator	HGNC:2082	details
hsa-miR-4635	CLCN6	chloride voltage-gated channel 6	HGNC:2024	details
hsa-miR-4635	CBX5	chromobox 5	HGNC:1555	details
hsa-miR-4635	AMER2	APC membrane recruitment protein 2	HGNC:26360	details
hsa-miR-4635	ADAMTS5	ADAM metallopeptidase with thrombospondin type 1 motif 5	HGNC:221	details
hsa-miR-4635	PHEX	phosphate regulating endopeptidase homolog X-linked	HGNC:8918	details
hsa-miR-4635	HACD4	3-hydroxyacyl-CoA dehydratase 4	HGNC:20920	details
hsa-miR-4635	RPP14	ribonuclease P/MRP subunit p14	HGNC:30327	details
hsa-miR-4635	SMIM19	small integral membrane protein 19	HGNC:25166	details
hsa-miR-4635	PARP3	poly(ADP-ribose) polymerase family member 3	HGNC:273	details
hsa-miR-4635	SELENOF	selenoprotein F	HGNC:17705	details
hsa-miR-4635	HAT1	histone acetyltransferase 1	HGNC:4821	details
hsa-miR-4635	TM6SF1	transmembrane 6 superfamily member 1	HGNC:11860	details
hsa-miR-4635	PCDH9	protocadherin 9	HGNC:8661	details
hsa-miR-4635	ZNF510	zinc finger protein 510	HGNC:29161	details
hsa-miR-4635	PCDHA6	protocadherin alpha 6	HGNC:8672	details
hsa-miR-4635	ELAVL4	ELAV like RNA binding protein 4	HGNC:3315	details
hsa-miR-4635	CC2D1B	coiled-coil and C2 domain containing 1B	HGNC:29386	details
hsa-miR-4635	PRKAA2	protein kinase AMP-activated catalytic subunit alpha 2	HGNC:9377	details
hsa-miR-4635	PCDHB16	protocadherin beta 16	HGNC:14546	details
hsa-miR-4635	CITED2	Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2	HGNC:1987	details
hsa-miR-4635	SERAC1	serine active site containing 1	HGNC:21061	details
hsa-miR-4635	TSC22D2	TSC22 domain family member 2	HGNC:29095	details
hsa-miR-4635	SULF2	sulfatase 2	HGNC:20392	details
hsa-miR-4635	FNBP1	formin binding protein 1	HGNC:17069	details
hsa-miR-4635	PLET1	placenta expressed transcript 1	HGNC:30053	details
hsa-miR-4635	HAX1	HCLS1 associated protein X-1	HGNC:16915	details
hsa-miR-4635	EHD3	EH domain containing 3	HGNC:3244	details
hsa-miR-4635	NHLH2	nescient helix-loop-helix 2	HGNC:7818	details
hsa-miR-4635	ARL4D	ADP ribosylation factor like GTPase 4D	HGNC:656	details
hsa-miR-4635	PFN4	profilin family member 4	HGNC:31103	details
hsa-miR-4635	ABHD15	abhydrolase domain containing 15	HGNC:26971	details
hsa-miR-4635	TRIM66	tripartite motif containing 66	HGNC:29005	details
hsa-miR-4635	F2RL2	coagulation factor II thrombin receptor like 2	HGNC:3539	details
hsa-miR-4635	ATXN7	ataxin 7	HGNC:10560	details
hsa-miR-4635	LHFPL3	LHFPL tetraspan subfamily member 3	HGNC:6589	details
hsa-miR-4635	SETD9	SET domain containing 9	HGNC:28508	details
hsa-miR-4635	RABGEF1	RAB guanine nucleotide exchange factor 1	HGNC:17676	details
hsa-miR-4635	CACNG8	calcium voltage-gated channel auxiliary subunit gamma 8	HGNC:13628	details
hsa-miR-4635	BCL2L14	BCL2 like 14	HGNC:16657	details
hsa-miR-4635	CAPZA1	capping actin protein of muscle Z-line subunit alpha 1	HGNC:1488	details
hsa-miR-4635	ZDHHC2	zinc finger DHHC-type palmitoyltransferase 2	HGNC:18469	details
hsa-miR-4635	ZNF654	zinc finger protein 654	HGNC:25612	details
hsa-miR-4635	TMEM70	transmembrane protein 70	HGNC:26050	details
hsa-miR-4635	RORA	RAR related orphan receptor A	HGNC:10258	details
hsa-miR-4635	RNF152	ring finger protein 152	HGNC:26811	details
hsa-miR-4635	RCOR1	REST corepressor 1	HGNC:17441	details
hsa-miR-4635	RAB11FIP2	RAB11 family interacting protein 2	HGNC:29152	details
hsa-miR-4635	LIFR	LIF receptor subunit alpha	HGNC:6597	details
hsa-miR-4635	GPR107	G protein-coupled receptor 107	HGNC:17830	details
hsa-miR-4635	GUF1	GTP binding elongation factor GUF1	HGNC:25799	details
hsa-miR-4635	PTCD3	pentatricopeptide repeat domain 3	HGNC:24717	details
hsa-miR-4635	DYRK3	dual specificity tyrosine phosphorylation regulated kinase 3	HGNC:3094	details
hsa-miR-4635	CSTF1	cleavage stimulation factor subunit 1	HGNC:2483	details
hsa-miR-4635	ERH	ERH mRNA splicing and mitosis factor	HGNC:3447	details
hsa-miR-4635	NKD2	NKD inhibitor of WNT signaling pathway 2	HGNC:17046	details
hsa-miR-4635	RNF213	ring finger protein 213	HGNC:14539	details
hsa-miR-4635	JRKL	JRK like	HGNC:6200	details
hsa-miR-4635	PRDM15	PR/SET domain 15	HGNC:13999	details
hsa-miR-4635	CDH7	cadherin 7	HGNC:1766	details
hsa-miR-4635	RGS17	regulator of G protein signaling 17	HGNC:14088	details
hsa-miR-4635	MTR	5-methyltetrahydrofolate-homocysteine methyltransferase	HGNC:7468	details
hsa-miR-4635	CCR6	C-C motif chemokine receptor 6	HGNC:1607	details
hsa-miR-4635				details
hsa-miR-4635	OXGR1	oxoglutarate receptor 1	HGNC:4531	details
hsa-miR-4635	COQ10B	coenzyme Q10B	HGNC:25819	details
hsa-miR-4635	PIK3C3	phosphatidylinositol 3-kinase catalytic subunit type 3	HGNC:8974	details
hsa-miR-4635	BTG1	BTG anti-proliferation factor 1	HGNC:1130	details
hsa-miR-4635	XBP1P1	X-box binding protein 1 pseudogene 1	HGNC:12802	details
hsa-miR-4635	TMED7	transmembrane p24 trafficking protein 7	HGNC:24253	details
hsa-miR-4635	KLHL3	kelch like family member 3	HGNC:6354	details
hsa-miR-4635	PRELID2	PRELI domain containing 2	HGNC:28306	details
hsa-miR-4635	KLHL11	kelch like family member 11	HGNC:19008	details
hsa-miR-4635	FNDC3A	fibronectin type III domain containing 3A	HGNC:20296	details
hsa-miR-4635	ZNF12	zinc finger protein 12	HGNC:12902	details
hsa-miR-4635	RAP2A	RAP2A, member of RAS oncogene family	HGNC:9861	details
hsa-miR-4635	CPEB4	cytoplasmic polyadenylation element binding protein 4	HGNC:21747	details
hsa-miR-4635	YWHAQ	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta	HGNC:12854	details
hsa-miR-4635	PTAFR	platelet activating factor receptor	HGNC:9582	details
hsa-miR-4635	MRPS16	mitochondrial ribosomal protein S16	HGNC:14048	details
hsa-miR-4635	ZNF8	zinc finger protein 8	HGNC:13154	details
hsa-miR-4635	YIPF4	Yip1 domain family member 4	HGNC:28145	details
hsa-miR-4635	TBRG1	transforming growth factor beta regulator 1	HGNC:29551	details
hsa-miR-4635	HAL	histidine ammonia-lyase	HGNC:4806	details
hsa-miR-4635	ALX1	ALX homeobox 1	HGNC:1494	details
hsa-miR-4635	NKIRAS2	NFKB inhibitor interacting Ras like 2	HGNC:17898	details
hsa-miR-4635	CLDN11	claudin 11	HGNC:8514	details
hsa-miR-4635	SMURF2	SMAD specific E3 ubiquitin protein ligase 2	HGNC:16809	details
hsa-miR-4635				details
hsa-miR-4635	INIP	INTS3 and NABP interacting protein	HGNC:24994	details
hsa-miR-4635				details
hsa-miR-4635	ERBIN	erbb2 interacting protein	HGNC:15842	details
hsa-miR-4635	CALN1	calneuron 1	HGNC:13248	details
hsa-miR-4635	PITPNC1	phosphatidylinositol transfer protein cytoplasmic 1	HGNC:21045	details
hsa-miR-4635	STAM	signal transducing adaptor molecule	HGNC:11357	details
hsa-miR-4635	TNFRSF21	TNF receptor superfamily member 21	HGNC:13469	details
hsa-miR-4635	TMEM138	transmembrane protein 138	HGNC:26944	details
hsa-miR-4635	DR1	down-regulator of transcription 1	HGNC:3017	details
hsa-miR-4635	DYNLL2	dynein light chain LC8-type 2	HGNC:24596	details
hsa-miR-4635	MDM2	MDM2 proto-oncogene	HGNC:6973	details
hsa-miR-4635				details
hsa-miR-4635	MAPKAPK5	MAPK activated protein kinase 5	HGNC:6889	details
hsa-miR-4635	ZNF106	zinc finger protein 106	HGNC:12886	details
hsa-miR-4635	FOXP4	forkhead box P4	HGNC:20842	details
hsa-miR-4635	ANP32E	acidic nuclear phosphoprotein 32 family member E	HGNC:16673	details
hsa-miR-4635	MBL2	mannose binding lectin 2	HGNC:6922	details
hsa-miR-4635	FAM43B	family with sequence similarity 43 member B	HGNC:31791	details
hsa-miR-4635	HARBI1	harbinger transposase derived 1	HGNC:26522	details
hsa-miR-4635	SEC63	SEC63 homolog, protein translocation regulator	HGNC:21082	details
hsa-miR-4635	LZIC	leucine zipper and CTNNBIP1 domain containing	HGNC:17497	details
hsa-miR-4635	CCDC149	coiled-coil domain containing 149	HGNC:25405	details
hsa-miR-4635	ZNF619	zinc finger protein 619	HGNC:26910	details
hsa-miR-4635	ZNF568	zinc finger protein 568	HGNC:25392	details
hsa-miR-4635	ZNF517	zinc finger protein 517	HGNC:27984	details
hsa-miR-4635	TPM3	tropomyosin 3	HGNC:12012	details
hsa-miR-4635	KCNJ13	potassium inwardly rectifying channel subfamily J member 13	HGNC:6259	details
hsa-miR-4635	CACNB2	calcium voltage-gated channel auxiliary subunit beta 2	HGNC:1402	details
hsa-miR-4635	IDE	insulin degrading enzyme	HGNC:5381	details
hsa-miR-4635	ZNF724	zinc finger protein 724	HGNC:32460	details
hsa-miR-4635	PLSCR1	phospholipid scramblase 1	HGNC:9092	details
hsa-miR-4635	OPA3	outer mitochondrial membrane lipid metabolism regulator OPA3	HGNC:8142	details
hsa-miR-4635	TIMM8A	translocase of inner mitochondrial membrane 8A	HGNC:11817	details
hsa-miR-4635	CYB5D1	cytochrome b5 domain containing 1	HGNC:26516	details
hsa-miR-4635	IVD	isovaleryl-CoA dehydrogenase	HGNC:6186	details
hsa-miR-4635	CLMP	CXADR like membrane protein	HGNC:24039	details
hsa-miR-4635	ABCC12	ATP binding cassette subfamily C member 12	HGNC:14640	details
hsa-miR-4635	PARG	poly(ADP-ribose) glycohydrolase	HGNC:8605	details
hsa-miR-4635	LPXN	leupaxin	HGNC:14061	details
hsa-miR-4635	HES2	hes family bHLH transcription factor 2	HGNC:16005	details
hsa-miR-4635	FLVCR1	FLVCR heme transporter 1	HGNC:24682	details
hsa-miR-4635	NCR3LG1	natural killer cell cytotoxicity receptor 3 ligand 1	HGNC:42400	details
hsa-miR-4635	C2orf68	chromosome 2 open reading frame 68	HGNC:34353	details
hsa-miR-4635	AP1M1	adaptor related protein complex 1 subunit mu 1	HGNC:13667	details
hsa-miR-4635	TERF2	telomeric repeat binding factor 2	HGNC:11729	details
hsa-miR-4635	RTN2	reticulon 2	HGNC:10468	details
hsa-miR-4635	ZNF225	zinc finger protein 225	HGNC:13018	details
hsa-miR-4635	NSD3	nuclear receptor binding SET domain protein 3	HGNC:12767	details
hsa-miR-4635	TPPP	tubulin polymerization promoting protein	HGNC:24164	details
hsa-miR-4635	TMEM33	transmembrane protein 33	HGNC:25541	details
hsa-miR-4635	FAM221B	family with sequence similarity 221 member B	HGNC:30762	details
hsa-miR-4635	CREG2	cellular repressor of E1A stimulated genes 2	HGNC:14272	details
hsa-miR-4635	MPPE1	metallophosphoesterase 1	HGNC:15988	details
hsa-miR-4635	LACTB	lactamase beta	HGNC:16468	details
hsa-miR-4635	ATP6V1G3	ATPase H+ transporting V1 subunit G3	HGNC:18265	details
hsa-miR-4635	LIMD1	LIM domain containing 1	HGNC:6612	details
hsa-miR-4635	RALY	RALY heterogeneous nuclear ribonucleoprotein	HGNC:15921	details
hsa-miR-4635	ZNF101	zinc finger protein 101	HGNC:12881	details
hsa-miR-4635	GAN	gigaxonin	HGNC:4137	details
hsa-miR-4635	GPR156	G protein-coupled receptor 156	HGNC:20844	details
hsa-miR-4635	RBBP4	RB binding protein 4, chromatin remodeling factor	HGNC:9887	details
hsa-miR-4635	EMP2	epithelial membrane protein 2	HGNC:3334	details
hsa-miR-4635	FXN	frataxin	HGNC:3951	details
hsa-miR-4635	KCNN3	potassium calcium-activated channel subfamily N member 3	HGNC:6292	details
hsa-miR-4635	MIOX	myo-inositol oxygenase	HGNC:14522	details
hsa-miR-4635	TIRAP	TIR domain containing adaptor protein	HGNC:17192	details
hsa-miR-4635	TRIM72	tripartite motif containing 72	HGNC:32671	details
hsa-miR-4635	NUBPL	nucleotide binding protein like	HGNC:20278	details
hsa-miR-4635	SEC24D	SEC24 homolog D, COPII coat complex component	HGNC:10706	details
hsa-miR-4635	RTL10	retrotransposon Gag like 10	HGNC:26112	details
hsa-miR-4635	AGO3	argonaute RISC catalytic component 3	HGNC:18421	details
hsa-miR-4635	GABPB1	GA binding protein transcription factor subunit beta 1	HGNC:4074	details
hsa-miR-4635	C15orf40	chromosome 15 open reading frame 40	HGNC:28443	details
hsa-miR-4635	PDLIM3	PDZ and LIM domain 3	HGNC:20767	details
hsa-miR-4635	TIMM50	translocase of inner mitochondrial membrane 50	HGNC:23656	details
hsa-miR-4635	EIF2A	eukaryotic translation initiation factor 2A	HGNC:3254	details
hsa-miR-4635	ATCAY	ATCAY kinesin light chain interacting caytaxin	HGNC:779	details
hsa-miR-4635	FBLIM1	filamin binding LIM protein 1	HGNC:24686	details
hsa-miR-4635	ANKRD36	ankyrin repeat domain 36	HGNC:24079	details
hsa-miR-4635	TRIP11	thyroid hormone receptor interactor 11	HGNC:12305	details
hsa-miR-4635	PDE6A	phosphodiesterase 6A	HGNC:8785	details
hsa-miR-4635	TMOD2	tropomodulin 2	HGNC:11872	details
hsa-miR-4635	DUSP19	dual specificity phosphatase 19	HGNC:18894	details
hsa-miR-4635	CBFA2T3	CBFA2/RUNX1 partner transcriptional co-repressor 3	HGNC:1537	details
hsa-miR-4635	RBM23	RNA binding motif protein 23	HGNC:20155	details
hsa-miR-4635	ZNF566	zinc finger protein 566	HGNC:25919	details
hsa-miR-4635	CRCP	CGRP receptor component	HGNC:17888	details
hsa-miR-4635				details
hsa-miR-4635	FLYWCH2	FLYWCH family member 2	HGNC:25178	details
hsa-miR-4635	SLC43A3	solute carrier family 43 member 3	HGNC:17466	details
hsa-miR-4635	SUSD1	sushi domain containing 1	HGNC:25413	details
hsa-miR-4635	MEAF6	MYST/Esa1 associated factor 6	HGNC:25674	details
hsa-miR-4635	TYRO3	TYRO3 protein tyrosine kinase	HGNC:12446	details
hsa-miR-4635	CORO7	coronin 7	HGNC:26161	details
hsa-miR-4635	SLCO3A1	solute carrier organic anion transporter family member 3A1	HGNC:10952	details
hsa-miR-4635	KLHL7	kelch like family member 7	HGNC:15646	details
hsa-miR-4635	KBTBD6	kelch repeat and BTB domain containing 6	HGNC:25340	details
hsa-miR-4635	FKBP14	FKBP prolyl isomerase 14	HGNC:18625	details
hsa-miR-4635	CBX2	chromobox 2	HGNC:1552	details
hsa-miR-4635	CACUL1	CDK2 associated cullin domain 1	HGNC:23727	details
hsa-miR-4635	A1CF	APOBEC1 complementation factor	HGNC:24086	details
hsa-miR-4635	DGKI	diacylglycerol kinase iota	HGNC:2855	details
hsa-miR-4635	DLGAP2	DLG associated protein 2	HGNC:2906	details
hsa-miR-4635	ZBTB8A	zinc finger and BTB domain containing 8A	HGNC:24172	details
hsa-miR-4635	CBLB	Cbl proto-oncogene B	HGNC:1542	details
hsa-miR-4635	SPDYE1	speedy/RINGO cell cycle regulator family member E1	HGNC:16408	details
hsa-miR-4635	NFATC2IP	nuclear factor of activated T cells 2 interacting protein	HGNC:25906	details
hsa-miR-4635	ANK1	ankyrin 1	HGNC:492	details
hsa-miR-4635	BFAR	bifunctional apoptosis regulator	HGNC:17613	details
hsa-miR-4635	NUGGC	nuclear GTPase, germinal center associated	HGNC:33550	details
hsa-miR-4635	ASAP1	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	HGNC:2720	details
hsa-miR-4635	C3	complement C3	HGNC:1318	details
hsa-miR-4635	CARD8	caspase recruitment domain family member 8	HGNC:17057	details
hsa-miR-4635	HCCS	holocytochrome c synthase	HGNC:4837	details
hsa-miR-4635	RPL14	ribosomal protein L14	HGNC:10305	details
hsa-miR-4635	SPTLC2	serine palmitoyltransferase long chain base subunit 2	HGNC:11278	details
hsa-miR-4635	SSTR2	somatostatin receptor 2	HGNC:11331	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)