CircNet

miRNA General Information

Basic
Network

miRNA ID	hsa-miR-4643
Description	Homo sapiens miR-4643 stem-loop
Comment	None
Experiment	Illumina [1]
Sequence	GACACAUGACCAUAAAUGCUAA

miRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr20:49248645\|49248793	hsa-miR-4643	1	0
chr5:138468663\|138468853	hsa-miR-4643	0	1
chr14:105770481\|105771169	hsa-miR-4643	0	1
chr17:44350507\|44350751	hsa-miR-4643	0	1
chr1:16231392\|16231477	hsa-miR-4643	0	1
chr7:74872546\|74872730	hsa-miR-4643	0	1
chr14:105742140\|105742807	hsa-miR-4643	0	1
chr14:105742140\|105742383	hsa-miR-4643	0	1
chr14:105742128\|105742383	hsa-miR-4643	0	1
chr19:17582867\|17582996	hsa-miR-4643	0	1
chr10:5894804\|5894948	hsa-miR-4643	0	1
chr12:49759227\|49761761	hsa-miR-4643	0	1
chr11:119048310\|119048538	hsa-miR-4643	0	1
chr15:68190175\|68190289	hsa-miR-4643	0	1
chr17:77499637\|77499779	hsa-miR-4643	0	1
chr8:10724573\|10724681	hsa-miR-4643	0	1
chr1:151806694\|151806803	hsa-miR-4643	0	1
chr15:90083905\|90084085	hsa-miR-4643	0	1
chr14:105742098\|105742383	hsa-miR-4643	0	1
chr9:120845679\|120845790	hsa-miR-4643	0	1
chr10:73793379\|73793534	hsa-miR-4643	0	1
chr9:116698006\|116698228	hsa-miR-4643	0	1
chr19:49343249~49343361	hsa-miR-4643	0	1
chr19:18784913~18785027	hsa-miR-4643	0	1
chr3:149369139~149369258	hsa-miR-4643	0	1
chr3:43349715~43349960	hsa-miR-4643	0	1
chr5:134602586~134602800	hsa-miR-4643	0	1
chr14:105770669~105770796	hsa-miR-4643	0	1
chr14:105742125~105742383	hsa-miR-4643	0	1
chr2:9490046~9490122	hsa-miR-4643	0	1
chrX:53396464~53396614	hsa-miR-4643	0	1
chr17:77499637~77499779	hsa-miR-4643	0	1
chr1:168696023~168696156	hsa-miR-4643	0	1
chr1:2307081~2307253	hsa-miR-4643	0	1
chr1:151806694~151806922	hsa-miR-4643	0	1
chr17:77499637~77499712	hsa-miR-4643	0	1
chr14:105742098~105742383	hsa-miR-4643	0	1
chr20:62945341~62945502	hsa-miR-4643	0	1
chr17:77499637~77499781	hsa-miR-4643	0	1
chr14:105742341\|105742802	hsa-miR-4643	0	1
chrX:53396356~53396614	hsa-miR-4643	0	1
chr10:6112639~6112755	hsa-miR-4643	0	1
chr8:18529329~18529473	hsa-miR-4643	0	1
chr21:44860525\|44860635	hsa-miR-4643	0	1
chr15:68190179\|68190294	hsa-miR-4643	0	1
chr2:177234304\|177234538	hsa-miR-4643	0	1
chr16:18836210\|18836363	hsa-miR-4643	0	1
chr14:105741948\|105742981	hsa-miR-4643	0	1
chr12:89597092\|89597289	hsa-miR-4643	0	1
chr17:44350496\|44351435	hsa-miR-4643	0	1
chr17:44350496\|44350761	hsa-miR-4643	0	1
chr13:29238838\|29238976	hsa-miR-4643	0	1
chr21:44311308\|44311489	hsa-miR-4643	0	1
chr6:18171756\|18171969	hsa-miR-4643	0	1
chr22:20064953\|20065101	hsa-miR-4643	0	1
chr14:105742341\|105742834	hsa-miR-4643	0	1
chr3:52510283\|52510406	hsa-miR-4643	0	1
chr14:105742341\|105742928	hsa-miR-4643	0	1
chr17:60623685\|60633871	hsa-miR-4643	1	0
chr2:39497004\|39497159	hsa-miR-4643	1	0
chr20:51597992\|51598162	hsa-miR-4643	0	1
chr19:49343249\|49343361	hsa-miR-4643	0	1
chr16:68231296\|68231532	hsa-miR-4643	0	1
chr14:105742125\|105742385	hsa-miR-4643	0	1
chr21:38824304\|38824471	hsa-miR-4643	0	1
chr14:105742098\|105742385	hsa-miR-4643	0	1
chr19:15227126\|15227264	hsa-miR-4643	0	1
chr14:105742125\|105742383	hsa-miR-4643	0	1
chr14:105742119\|105742383	hsa-miR-4643	0	1
chr20:1169119\|1169250	hsa-miR-4643	0	1
chr19:18671095\|18671268	hsa-miR-4643	0	1
chr13:113455395\|113455553	hsa-miR-4643	0	1
chr1:168695963\|168696180	hsa-miR-4643	0	1
chr1:151806447\|151806678	hsa-miR-4643	0	1
chr1:39968837\|39969024	hsa-miR-4643	0	1
chr10:37800260\|37800447	hsa-miR-4643	0	1
chr16:4880867\|4881111	hsa-miR-4643	0	1
chr2:73273379\|73273559	hsa-miR-4643	0	1
chr9:136718289\|136718480	hsa-miR-4643	0	1
chr17:17843539\|17843827	hsa-miR-4643	0	1
chr20:45252355\|45253095	hsa-miR-4643	0	1
chrX:53396356\|53396614	hsa-miR-4643	0	1
chr17:44350531\|44350738	hsa-miR-4643	0	1
chr17:77216610\|77216804	hsa-miR-4643	0	1
chr19:49343270\|49343375	hsa-miR-4643	0	1
chr19:15227144\|15227260	hsa-miR-4643	0	1
chr21:38301947\|38302120	hsa-miR-4643	0	1
chr21:38824285\|38824428	hsa-miR-4643	0	1
chr19:41304262\|41304413	hsa-miR-4643	0	1
chr2:61882349\|61882503	hsa-miR-4643	0	1
chr7:94665069\|94665224	hsa-miR-4643	0	1
chr19:55388000\|55388287	hsa-miR-4643	0	1
chr1:168695938\|168696180	hsa-miR-4643	0	1
chr1:44654327\|44654468	hsa-miR-4643	0	1
chr7:95405173\|95405253	hsa-miR-4643	0	1
chr14:105742119\|105742385	hsa-miR-4643	0	1
chr14:105742093\|105742383	hsa-miR-4643	0	1
chr10:79946485\|79946621	hsa-miR-4643	0	1
chr1:156211333\|156211441	hsa-miR-4643	0	1
chr17:77499637\|77499788	hsa-miR-4643	0	1
chr19:15227144\|15227256	hsa-miR-4643	0	1
chr10:3156237\|3156318	hsa-miR-4643	0	1
chr8:43200895\|43201096	hsa-miR-4643	0	1
chr14:105770481\|105770719	hsa-miR-4643	0	1
chr5:80079099\|80079241	hsa-miR-4643	0	1
chr17:77499637\|77499771	hsa-miR-4643	0	1
chr20:58995508\|58995598	hsa-miR-4643	0	1
chr2:66572209\|66572397	hsa-miR-4643	0	1
chr20:58995382\|58995637	hsa-miR-4643	0	1
chr17:77499637\|77499781	hsa-miR-4643	0	1
chr2:24918569\|24918720	hsa-miR-4643	0	1
chr14:105742341\|105742850	hsa-miR-4643	0	1
chr11:102229828\|102230015	hsa-miR-4643	-3	1
chr5:38823320\|38823414	hsa-miR-4643	0	1
chr6:31864660\|31864734	hsa-miR-4643	0	1
chr2:74428631\|74428895	hsa-miR-4643	0	1
chr20:62945341\|62945502	hsa-miR-4643	0	1
chr20:62945341\|62945540	hsa-miR-4643	0	1
chr14:105742201\|105742834	hsa-miR-4643	0	1
chr5:146128978\|146129033	hsa-miR-4643	0	1
chr10:100526404\|100526499	hsa-miR-4643	0	1
chr19:55387930\|55388048	hsa-miR-4643	0	1
chr10:29426415\|29426544	hsa-miR-4643	0	1
chrX:53396356\|53396617	hsa-miR-4643	0	1
chr11:119048302\|119048522	hsa-miR-4643	0	1
chr3:57626243\|57626442	hsa-miR-4643	0	1
chr9:95468980\|95469116	hsa-miR-4643	0	1
chr5:80079114\|80079241	hsa-miR-4643	0	1
chr12:120577164\|120577398	hsa-miR-4643	0	1
chr17:44350507\|44350781	hsa-miR-4643	0	1
chr6:79701081\|79701214	hsa-miR-4643	0	1
chr14:21394299\|21394468	hsa-miR-4643	0	1

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-miR-4643	ZFYVE9	zinc finger FYVE-type containing 9	HGNC:6775	details
hsa-miR-4643	PSMA7	proteasome 20S subunit alpha 7	HGNC:9536	details
hsa-miR-4643	SF3B3	splicing factor 3b subunit 3	HGNC:10770	details
hsa-miR-4643	RNF168	ring finger protein 168	HGNC:26661	details
hsa-miR-4643	PTP4A1	protein tyrosine phosphatase 4A1	HGNC:9634	details
hsa-miR-4643	PPP1CC	protein phosphatase 1 catalytic subunit gamma	HGNC:9283	details
hsa-miR-4643				details
hsa-miR-4643	TNPO1	transportin 1	HGNC:6401	details
hsa-miR-4643	IGF1R	insulin like growth factor 1 receptor	HGNC:5465	details
hsa-miR-4643	COPS8	COP9 signalosome subunit 8	HGNC:24335	details
hsa-miR-4643	TUBA1B	tubulin alpha 1b	HGNC:18809	details
hsa-miR-4643	DNAAF2	dynein axonemal assembly factor 2	HGNC:20188	details
hsa-miR-4643	VAMP4	vesicle associated membrane protein 4	HGNC:12645	details
hsa-miR-4643	PRR14L	proline rich 14 like	HGNC:28738	details
hsa-miR-4643	PLEKHA3	pleckstrin homology domain containing A3	HGNC:14338	details
hsa-miR-4643	MTHFD2	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase	HGNC:7434	details
hsa-miR-4643	MON1B	MON1 homolog B, secretory trafficking associated	HGNC:25020	details
hsa-miR-4643	PCLAF	PCNA clamp associated factor	HGNC:28961	details
hsa-miR-4643	ZNF850	zinc finger protein 850	HGNC:27994	details
hsa-miR-4643	CREB1	cAMP responsive element binding protein 1	HGNC:2345	details
hsa-miR-4643	ENTHD1	ENTH domain containing 1	HGNC:26352	details
hsa-miR-4643	CERCAM	cerebral endothelial cell adhesion molecule	HGNC:23723	details
hsa-miR-4643	INTU	inturned planar cell polarity protein	HGNC:29239	details
hsa-miR-4643	HHIP	hedgehog interacting protein	HGNC:14866	details
hsa-miR-4643	AGPS	alkylglycerone phosphate synthase	HGNC:327	details
hsa-miR-4643	USP8	ubiquitin specific peptidase 8	HGNC:12631	details
hsa-miR-4643	PIK3R1	phosphoinositide-3-kinase regulatory subunit 1	HGNC:8979	details
hsa-miR-4643	NDST1	N-deacetylase and N-sulfotransferase 1	HGNC:7680	details
hsa-miR-4643	HOXC11	homeobox C11	HGNC:5123	details
hsa-miR-4643	SLC35E3	solute carrier family 35 member E3	HGNC:20864	details
hsa-miR-4643	CDKL1	cyclin dependent kinase like 1	HGNC:1781	details
hsa-miR-4643	TECRL	trans-2,3-enoyl-CoA reductase like	HGNC:27365	details
hsa-miR-4643	PIP4P1	phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1	HGNC:19299	details
hsa-miR-4643	SLC16A10	solute carrier family 16 member 10	HGNC:17027	details
hsa-miR-4643	PURG	purine rich element binding protein G	HGNC:17930	details
hsa-miR-4643	NR2C2	nuclear receptor subfamily 2 group C member 2	HGNC:7972	details
hsa-miR-4643	CHRM3	cholinergic receptor muscarinic 3	HGNC:1952	details
hsa-miR-4643	BRIX1	biogenesis of ribosomes BRX1	HGNC:24170	details
hsa-miR-4643	BACH1	BTB domain and CNC homolog 1	HGNC:935	details
hsa-miR-4643	NSFL1C	NSFL1 cofactor	HGNC:15912	details
hsa-miR-4643	SULT1B1	sulfotransferase family 1B member 1	HGNC:17845	details
hsa-miR-4643	PPIL3	peptidylprolyl isomerase like 3	HGNC:9262	details
hsa-miR-4643	SLC2A9	solute carrier family 2 member 9	HGNC:13446	details
hsa-miR-4643	ART4	ADP-ribosyltransferase 4 (inactive) (Dombrock blood group)	HGNC:726	details
hsa-miR-4643	HOXA13	homeobox A13	HGNC:5102	details
hsa-miR-4643	ZNF827	zinc finger protein 827	HGNC:27193	details
hsa-miR-4643	TRPC5	transient receptor potential cation channel subfamily C member 5	HGNC:12337	details
hsa-miR-4643	FGF5	fibroblast growth factor 5	HGNC:3683	details
hsa-miR-4643	FGF2	fibroblast growth factor 2	HGNC:3676	details
hsa-miR-4643	BMP2K	BMP2 inducible kinase	HGNC:18041	details
hsa-miR-4643	AFF4	AF4/FMR2 family member 4	HGNC:17869	details
hsa-miR-4643	CRISPLD2	cysteine rich secretory protein LCCL domain containing 2	HGNC:25248	details
hsa-miR-4643	PLAG1	PLAG1 zinc finger	HGNC:9045	details
hsa-miR-4643	PELP1	proline, glutamate and leucine rich protein 1	HGNC:30134	details
hsa-miR-4643	NPTXR	neuronal pentraxin receptor	HGNC:7954	details
hsa-miR-4643	GTF2H1	general transcription factor IIH subunit 1	HGNC:4655	details
hsa-miR-4643	HSBP1	heat shock factor binding protein 1	HGNC:5203	details
hsa-miR-4643	ZNF543	zinc finger protein 543	HGNC:25281	details
hsa-miR-4643	UGT2B4	UDP glucuronosyltransferase family 2 member B4	HGNC:12553	details
hsa-miR-4643	HDGFL3	HDGF like 3	HGNC:24937	details
hsa-miR-4643	DGKH	diacylglycerol kinase eta	HGNC:2854	details
hsa-miR-4643	RTN4	reticulon 4	HGNC:14085	details
hsa-miR-4643	CCND1	cyclin D1	HGNC:1582	details
hsa-miR-4643	RHCG	Rh family C glycoprotein	HGNC:18140	details
hsa-miR-4643	TMEM106C	transmembrane protein 106C	HGNC:28775	details
hsa-miR-4643	PLCXD1	phosphatidylinositol specific phospholipase C X domain containing 1	HGNC:23148	details
hsa-miR-4643	ZNF562	zinc finger protein 562	HGNC:25950	details
hsa-miR-4643	YY1	YY1 transcription factor	HGNC:12856	details
hsa-miR-4643	VKORC1L1	vitamin K epoxide reductase complex subunit 1 like 1	HGNC:21492	details
hsa-miR-4643	TIMM10	translocase of inner mitochondrial membrane 10	HGNC:11814	details
hsa-miR-4643	TAOK1	TAO kinase 1	HGNC:29259	details
hsa-miR-4643	MAPK6	mitogen-activated protein kinase 6	HGNC:6879	details
hsa-miR-4643	BAG4	BAG cochaperone 4	HGNC:940	details
hsa-miR-4643	ARF6	ADP ribosylation factor 6	HGNC:659	details
hsa-miR-4643	CPEB2	cytoplasmic polyadenylation element binding protein 2	HGNC:21745	details
hsa-miR-4643	ZSWIM1	zinc finger SWIM-type containing 1	HGNC:16155	details
hsa-miR-4643	C5orf24	chromosome 5 open reading frame 24	HGNC:26746	details
hsa-miR-4643	XIAP	X-linked inhibitor of apoptosis	HGNC:592	details
hsa-miR-4643	WDR45B	WD repeat domain 45B	HGNC:25072	details
hsa-miR-4643	PURA	purine rich element binding protein A	HGNC:9701	details
hsa-miR-4643	HNRNPA0	heterogeneous nuclear ribonucleoprotein A0	HGNC:5030	details
hsa-miR-4643	EIF1AX	eukaryotic translation initiation factor 1A X-linked	HGNC:3250	details
hsa-miR-4643	LYN	LYN proto-oncogene, Src family tyrosine kinase	HGNC:6735	details
hsa-miR-4643	ADCY2	adenylate cyclase 2	HGNC:233	details
hsa-miR-4643	C9orf78	chromosome 9 open reading frame 78	HGNC:24932	details
hsa-miR-4643	HNRNPA1L2	heterogeneous nuclear ribonucleoprotein A1 like 2	HGNC:27067	details
hsa-miR-4643	HNRNPA1	heterogeneous nuclear ribonucleoprotein A1	HGNC:5031	details
hsa-miR-4643	CPSF6	cleavage and polyadenylation specific factor 6	HGNC:13871	details
hsa-miR-4643	MAP4	microtubule associated protein 4	HGNC:6862	details
hsa-miR-4643	RGS4	regulator of G protein signaling 4	HGNC:10000	details
hsa-miR-4643	SMCO4	single-pass membrane protein with coiled-coil domains 4	HGNC:24810	details
hsa-miR-4643	MED28	mediator complex subunit 28	HGNC:24628	details
hsa-miR-4643	CADPS	calcium dependent secretion activator	HGNC:1426	details
hsa-miR-4643	PARP15	poly(ADP-ribose) polymerase family member 15	HGNC:26876	details
hsa-miR-4643	SYK	spleen associated tyrosine kinase	HGNC:11491	details
hsa-miR-4643	MATN1	matrilin 1	HGNC:6907	details
hsa-miR-4643	ZNF670	zinc finger protein 670	HGNC:28167	details
hsa-miR-4643	STX1B	syntaxin 1B	HGNC:18539	details
hsa-miR-4643	CDK6	cyclin dependent kinase 6	HGNC:1777	details
hsa-miR-4643	ZNF415	zinc finger protein 415	HGNC:20636	details
hsa-miR-4643	CD19	CD19 molecule	HGNC:1633	details
hsa-miR-4643	LPAR3	lysophosphatidic acid receptor 3	HGNC:14298	details
hsa-miR-4643	MLXIPL	MLX interacting protein like	HGNC:12744	details
hsa-miR-4643	ZDHHC17	zinc finger DHHC-type palmitoyltransferase 17	HGNC:18412	details
hsa-miR-4643	MACC1	MET transcriptional regulator MACC1	HGNC:30215	details
hsa-miR-4643	SPTLC3	serine palmitoyltransferase long chain base subunit 3	HGNC:16253	details
hsa-miR-4643	SPATA13	spermatogenesis associated 13	HGNC:23222	details
hsa-miR-4643				details
hsa-miR-4643	CADM3	cell adhesion molecule 3	HGNC:17601	details
hsa-miR-4643	TNRC6B	trinucleotide repeat containing adaptor 6B	HGNC:29190	details
hsa-miR-4643	USH1G	USH1 protein network component sans	HGNC:16356	details
hsa-miR-4643	CLEC4D	C-type lectin domain family 4 member D	HGNC:14554	details
hsa-miR-4643	GSK3B	glycogen synthase kinase 3 beta	HGNC:4617	details
hsa-miR-4643	TNRC6C	trinucleotide repeat containing adaptor 6C	HGNC:29318	details
hsa-miR-4643	SPAG7	sperm associated antigen 7	HGNC:11216	details
hsa-miR-4643	SLITRK4	SLIT and NTRK like family member 4	HGNC:23502	details
hsa-miR-4643	MLLT6	MLLT6, PHD finger containing	HGNC:7138	details
hsa-miR-4643	CRY2	cryptochrome circadian regulator 2	HGNC:2385	details
hsa-miR-4643	METTL16	methyltransferase 16, N6-methyladenosine	HGNC:28484	details
hsa-miR-4643	SLC1A4	solute carrier family 1 member 4	HGNC:10942	details
hsa-miR-4643	HLF	HLF transcription factor, PAR bZIP family member	HGNC:4977	details
hsa-miR-4643	CYP24A1	cytochrome P450 family 24 subfamily A member 1	HGNC:2602	details
hsa-miR-4643	SOCS7	suppressor of cytokine signaling 7	HGNC:29846	details
hsa-miR-4643	SEMA4C	semaphorin 4C	HGNC:10731	details
hsa-miR-4643	ETS1	ETS proto-oncogene 1, transcription factor	HGNC:3488	details
hsa-miR-4643	PTDSS1	phosphatidylserine synthase 1	HGNC:9587	details
hsa-miR-4643	IL21R	interleukin 21 receptor	HGNC:6006	details
hsa-miR-4643	FLVCR2	FLVCR heme transporter 2	HGNC:20105	details
hsa-miR-4643	WTIP	WT1 interacting protein	HGNC:20964	details
hsa-miR-4643	SPOCK2	SPARC (osteonectin), cwcv and kazal like domains proteoglycan 2	HGNC:13564	details
hsa-miR-4643	SH3PXD2A	SH3 and PX domains 2A	HGNC:23664	details
hsa-miR-4643	RSF1	remodeling and spacing factor 1	HGNC:18118	details
hsa-miR-4643	SYT5	synaptotagmin 5	HGNC:11513	details
hsa-miR-4643	LONRF2	LON peptidase N-terminal domain and ring finger 2	HGNC:24788	details
hsa-miR-4643	PADI2	peptidyl arginine deiminase 2	HGNC:18341	details
hsa-miR-4643	PKP1	plakophilin 1	HGNC:9023	details
hsa-miR-4643	PNMA8A	PNMA family member 8A	HGNC:25578	details
hsa-miR-4643	AQP3	aquaporin 3 (Gill blood group)	HGNC:636	details
hsa-miR-4643	TXNL4B	thioredoxin like 4B	HGNC:26041	details
hsa-miR-4643				details
hsa-miR-4643	ZNF226	zinc finger protein 226	HGNC:13019	details
hsa-miR-4643	WDR3	WD repeat domain 3	HGNC:12755	details
hsa-miR-4643	FOXL1	forkhead box L1	HGNC:3817	details
hsa-miR-4643	SYTL4	synaptotagmin like 4	HGNC:15588	details
hsa-miR-4643	ICAM1	intercellular adhesion molecule 1	HGNC:5344	details
hsa-miR-4643	FSIP2	fibrous sheath interacting protein 2	HGNC:21675	details
hsa-miR-4643	KRTAP4-9	keratin associated protein 4-9	HGNC:18910	details
hsa-miR-4643	CCDC149	coiled-coil domain containing 149	HGNC:25405	details
hsa-miR-4643	GLI2	GLI family zinc finger 2	HGNC:4318	details
hsa-miR-4643	C1orf50	chromosome 1 open reading frame 50	HGNC:28795	details
hsa-miR-4643	GPX6	glutathione peroxidase 6	HGNC:4558	details
hsa-miR-4643	AGAP1	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	HGNC:16922	details
hsa-miR-4643	AGO2	argonaute RISC catalytic component 2	HGNC:3263	details
hsa-miR-4643	SLBP	stem-loop binding protein	HGNC:10904	details
hsa-miR-4643	UBE2H	ubiquitin conjugating enzyme E2 H	HGNC:12484	details
hsa-miR-4643	BHLHE40	basic helix-loop-helix family member e40	HGNC:1046	details
hsa-miR-4643	FOLR1	folate receptor alpha	HGNC:3791	details
hsa-miR-4643	STX16	syntaxin 16	HGNC:11431	details
hsa-miR-4643	SUSD1	sushi domain containing 1	HGNC:25413	details
hsa-miR-4643	TGFBR1	transforming growth factor beta receptor 1	HGNC:11772	details
hsa-miR-4643	SOS1	SOS Ras/Rac guanine nucleotide exchange factor 1	HGNC:11187	details
hsa-miR-4643	CEP135	centrosomal protein 135	HGNC:29086	details
hsa-miR-4643	MMS22L	MMS22 like, DNA repair protein	HGNC:21475	details
hsa-miR-4643	CNTNAP5	contactin associated protein family member 5	HGNC:18748	details
hsa-miR-4643	WDR17	WD repeat domain 17	HGNC:16661	details
hsa-miR-4643	SIK3	SIK family kinase 3	HGNC:29165	details
hsa-miR-4643	UNK	unk zinc finger	HGNC:29369	details
hsa-miR-4643	RSBN1L	round spermatid basic protein 1 like	HGNC:24765	details
hsa-miR-4643	KLHL23	kelch like family member 23	HGNC:27506	details
hsa-miR-4643	C18orf32	chromosome 18 open reading frame 32	HGNC:31690	details
hsa-miR-4643	KCTD16	potassium channel tetramerization domain containing 16	HGNC:29244	details
hsa-miR-4643	ZNF343	zinc finger protein 343	HGNC:16017	details
hsa-miR-4643	MAPK1	mitogen-activated protein kinase 1	HGNC:6871	details
hsa-miR-4643	BZW1	basic leucine zipper and W2 domains 1	HGNC:18380	details
hsa-miR-4643	CDKN1A	cyclin dependent kinase inhibitor 1A	HGNC:1784	details
hsa-miR-4643	STUM	stum, mechanosensory transduction mediator homolog	HGNC:30491	details
hsa-miR-4643	YRDC	yrdC N6-threonylcarbamoyltransferase domain containing	HGNC:28905	details
hsa-miR-4643	RORA	RAR related orphan receptor A	HGNC:10258	details
hsa-miR-4643	BTBD9	BTB domain containing 9	HGNC:21228	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)