miRNA Card

miRNA General Information
miRNA ID hsa-miR-4662a-5p
Description Homo sapiens miR-4662a stem-loop
Comment None
Experiment Illumina [1,3]
Sequence UUAGCCAAUUGUCCAUCUUUAG
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr20:36890949|36891078 hsa-miR-4662a-5p 0 1 0
chr13:27432672|27432857 hsa-miR-4662a-5p 0 1 0
chr3:51945911|51946261 hsa-miR-4662a-5p 0 1 0
chr12:111809633|111809772 hsa-miR-4662a-5p 0 1 0
chr1:42177501|42177682 hsa-miR-4662a-5p 0 1 0
chr17:48058769|48058918 hsa-miR-4662a-5p 0 1 0
chr16:31131526|31131827 hsa-miR-4662a-5p 0 1 0
chr10:37232702|37232956 hsa-miR-4662a-5p 0 1 0
chr11:73927785|73927934 hsa-miR-4662a-5p 0 1 0
chr19:3123371|3123581 hsa-miR-4662a-5p 0 1 0
chr1:182384543|182384710 hsa-miR-4662a-5p 0 1 0
chr19:29615457|29615649 hsa-miR-4662a-5p 1 0 0
chr11:116858429|116858659 hsa-miR-4662a-5p 1 0 0
chr16:30353399|30353554 hsa-miR-4662a-5p 0 1 0
chr11:43343913|43344085 hsa-miR-4662a-5p 0 1 0
chr1:168200024|168200208 hsa-miR-4662a-5p 0 1 0
chr7:74195183|74195340 hsa-miR-4662a-5p 0 1 0
chr1:153634172|153634329 hsa-miR-4662a-5p 0 1 0
chr1:42177501|42177632 hsa-miR-4662a-5p 0 1 0
chr1:182384524|182384653 hsa-miR-4662a-5p 0 1 0
chr22:30334190|30334294 hsa-miR-4662a-5p 0 1 0
chr2:216674395|216674512 hsa-miR-4662a-5p 0 1 0
chr20:36891017|36891095 hsa-miR-4662a-5p 0 1 0
chr12:119677861|119678065 hsa-miR-4662a-5p 0 1 0
chr7:64832774|64832941 hsa-miR-4662a-5p 0 1 0
chr21:45225628|45225754 hsa-miR-4662a-5p 0 1 0
chr12:48830386|48830569 hsa-miR-4662a-5p 0 1 0
chr9:99959917|99960155 hsa-miR-4662a-5p 0 1 0
chr12:120504895|120504983 hsa-miR-4662a-5p 0 1 0
chr11:111720554|111720762 hsa-miR-4662a-5p 0 1 0
chr9:128178797~128179014 hsa-miR-4662a-5p 0 1 0
chr1:203307726~203308014 hsa-miR-4662a-5p 0 1 0
chr12:122865977~122866131 hsa-miR-4662a-5p 0 1 0
chr9:128178851~128178946 hsa-miR-4662a-5p 0 1 0
chr9:33853267~33853409 hsa-miR-4662a-5p 0 1 0
chr9:135810390|135810592 hsa-miR-4662a-5p 0 1 0
chr7:158629095~158629351 hsa-miR-4662a-5p 0 1 0
chr16:30353399~30353521 hsa-miR-4662a-5p 0 1 0
chr7:151078649~151078949 hsa-miR-4662a-5p 0 1 0
chr12:122865977~122866166 hsa-miR-4662a-5p 0 1 0
chr4:8306642|8306799 hsa-miR-4662a-5p 0 1 0
chr17:2334641|2334844 hsa-miR-4662a-5p 0 1 0
chr2:10048346|10048492 hsa-miR-4662a-5p 0 1 0
chr12:112019228|112019347 hsa-miR-4662a-5p 0 1 0
chr6:30677068|30677288 hsa-miR-4662a-5p 0 1 0
chr3:183733744|183733828 hsa-miR-4662a-5p 0 1 0
chr16:58560212|58560362 hsa-miR-4662a-5p 1 0 0
chr3:5129263|5129391 hsa-miR-4662a-5p 0 1 0
chr18:26302457|26302617 hsa-miR-4662a-5p 0 1 0
chr20:3218909|3219010 hsa-miR-4662a-5p 0 1 0
chr14:20956084|20956396 hsa-miR-4662a-5p 0 1 0
chr11:6682861|6683040 hsa-miR-4662a-5p 0 1 0
chr6:52274202|52274349 hsa-miR-4662a-5p 0 1 0
chr5:178389290|178389455 hsa-miR-4662a-5p 0 1 0
chr11:116858429|116858626 hsa-miR-4662a-5p 1 0 0
chr16:58559804|58560362 hsa-miR-4662a-5p 1 0 0
chr9:128917139|128917457 hsa-miR-4662a-5p 0 1 0
chr17:74261290|74261380 hsa-miR-4662a-5p 0 1 0
chr19:55591431|55591573 hsa-miR-4662a-5p 0 1 0
chr16:70371937|70372090 hsa-miR-4662a-5p 0 1 0
chr3:101985800|101985944 hsa-miR-4662a-5p 0 1 0
chr9:123757703|123769563 hsa-miR-4662a-5p 0 1 0
chr8:94509813|94509932 hsa-miR-4662a-5p 0 1 0
chr14:76154442|76154777 hsa-miR-4662a-5p 0 1 0
chr1:207123946|207124247 hsa-miR-4662a-5p 0 1 0
chr13:101735094|101735244 hsa-miR-4662a-5p 0 1 0
chr8:93717073|93717197 hsa-miR-4662a-5p 0 1 0
chr16:31131526|31131761 hsa-miR-4662a-5p 0 1 0
chr8:123502186|123502268 hsa-miR-4662a-5p 0 1 0
chr7:55997917|55998052 hsa-miR-4662a-5p 0 1 0
chr12:120694141|120694244 hsa-miR-4662a-5p 0 1 0
chr15:64681723|64681854 hsa-miR-4662a-5p 0 1 0
chr2:10048458|10048595 hsa-miR-4662a-5p 0 1 0
chr11:111514810|111514929 hsa-miR-4662a-5p 0 1 0
chr16:31131526|31131768 hsa-miR-4662a-5p 0 1 0
chr7:100210556|100210707 hsa-miR-4662a-5p 0 1 0
chr4:152411303|152412529 hsa-miR-4662a-5p 0 1 0
chr2:226996304|226996476 hsa-miR-4662a-5p 0 1 0
chr20:36239840|36240009 hsa-miR-4662a-5p 0 1 0
chr8:103298349|103298504 hsa-miR-4662a-5p 0 1 0
chr2:241235948|241236083 hsa-miR-4662a-5p 0 1 0
chr7:44121834|44122027 hsa-miR-4662a-5p 0 1 0
chr20:57169458|57169560 hsa-miR-4662a-5p 0 1 0
chr2:6884332|6884600 hsa-miR-4662a-5p 0 1 0
chr11:64805635|64805745 hsa-miR-4662a-5p 0 1 0
chr1:153634117|153634257 hsa-miR-4662a-5p 0 1 0
chr1:42177472|42177580 hsa-miR-4662a-5p 0 1 0
chr7:152138278|152138428 hsa-miR-4662a-5p 0 1 0
chr15:90998850|90998979 hsa-miR-4662a-5p 0 1 0
chr11:86306245|86306482 hsa-miR-4662a-5p 0 1 0
chr17:68127385|68127541 hsa-miR-4662a-5p 0 1 0
chr5:172690852|172691022 hsa-miR-4662a-5p 0 1 0
chrX:150988266|150988402 hsa-miR-4662a-5p 0 1 0
chr1:43437492|43437902 hsa-miR-4662a-5p 0 1 0
chr17:48058745|48058918 hsa-miR-4662a-5p -3 1 0
chr7:6023881|6023977 hsa-miR-4662a-5p -11 1 0
chr6:24174126|24174337 hsa-miR-4662a-5p -6 1 0
chr19:29615452|29615649 hsa-miR-4662a-5p 1 0 0
chr9:128178797|128178916 hsa-miR-4662a-5p 0 1 0
chr6:31761541|31761934 hsa-miR-4662a-5p 0 1 0
chr12:21317|21437 hsa-miR-4662a-5p 0 1 0
chr9:128178851|128179198 hsa-miR-4662a-5p 0 1 0
chr22:29687538|29687679 hsa-miR-4662a-5p 0 1 0
chr19:52905135|52905224 hsa-miR-4662a-5p 0 1 0
chr16:30713347|30713652 hsa-miR-4662a-5p 0 1 0
chr19:4543233|4543352 hsa-miR-4662a-5p 0 1 0
chr17:40877380|40878340 hsa-miR-4662a-5p 0 1 0
chr15:64681694|64681865 hsa-miR-4662a-5p 0 1 0
chr19:3123377|3123512 hsa-miR-4662a-5p 0 1 0
chr1:153634138|153634267 hsa-miR-4662a-5p 0 1 0
chr20:2864987|2865240 hsa-miR-4662a-5p 0 1 0
chr12:123621417|123621619 hsa-miR-4662a-5p 0 1 0
chr17:72646378|72646559 hsa-miR-4662a-5p 0 1 0
chrX:53562831|53562919 hsa-miR-4662a-5p 0 1 0
chr18:80047711|80047835 hsa-miR-4662a-5p 0 1 0
chrX:154421112|154421394 hsa-miR-4662a-5p 0 1 0
chr1:42177501|42177676 hsa-miR-4662a-5p 0 1 0
chr12:111809638|111809772 hsa-miR-4662a-5p 0 1 0
chr17:40877380|40878338 hsa-miR-4662a-5p 0 1 0
chr1:42177488|42177682 hsa-miR-4662a-5p 0 1 0
chr15:51407781|51407908 hsa-miR-4662a-5p 0 1 0
chr7:74195171|74195340 hsa-miR-4662a-5p 0 1 0
chrX:154421182|154421424 hsa-miR-4662a-5p 0 1 0
chr2:241235904|241236051 hsa-miR-4662a-5p 0 1 0
chr5:172690702|172690875 hsa-miR-4662a-5p 0 1 0
chr1:16396919|16397078 hsa-miR-4662a-5p 0 1 0
chr11:46673871|46674068 hsa-miR-4662a-5p 0 1 0
chr1:43451190|43451306 hsa-miR-4662a-5p 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4662a-5p PAPOLA poly(A) polymerase alpha HGNC:14981 details
hsa-miR-4662a-5p MTX3 metaxin 3 HGNC:24812 details
hsa-miR-4662a-5p SPART spartin HGNC:18514 details
hsa-miR-4662a-5p ZBTB10 zinc finger and BTB domain containing 10 HGNC:30953 details
hsa-miR-4662a-5p LMOD3 leiomodin 3 HGNC:6649 details
hsa-miR-4662a-5p ROCK1 Rho associated coiled-coil containing protein kinase 1 HGNC:10251 details
hsa-miR-4662a-5p KDM5A lysine demethylase 5A HGNC:9886 details
hsa-miR-4662a-5p ZIC4 Zic family member 4 HGNC:20393 details
hsa-miR-4662a-5p FGF9 fibroblast growth factor 9 HGNC:3687 details
hsa-miR-4662a-5p TMEM245 transmembrane protein 245 HGNC:1363 details
hsa-miR-4662a-5p TXN thioredoxin HGNC:12435 details
hsa-miR-4662a-5p ACADSB acyl-CoA dehydrogenase short/branched chain HGNC:91 details
hsa-miR-4662a-5p BACE2 beta-secretase 2 HGNC:934 details
hsa-miR-4662a-5p KPNA1 karyopherin subunit alpha 1 HGNC:6394 details
hsa-miR-4662a-5p ZNF70 zinc finger protein 70 HGNC:13140 details
hsa-miR-4662a-5p SEC62 SEC62 homolog, preprotein translocation factor HGNC:11846 details
hsa-miR-4662a-5p KLHDC10 kelch domain containing 10 HGNC:22194 details
hsa-miR-4662a-5p INTS6 integrator complex subunit 6 HGNC:14879 details
hsa-miR-4662a-5p HOOK3 hook microtubule tethering protein 3 HGNC:23576 details
hsa-miR-4662a-5p SPRED1 sprouty related EVH1 domain containing 1 HGNC:20249 details
hsa-miR-4662a-5p CFAP65 cilia and flagella associated protein 65 HGNC:25325 details
hsa-miR-4662a-5p OLA1 Obg like ATPase 1 HGNC:28833 details
hsa-miR-4662a-5p NAMPT nicotinamide phosphoribosyltransferase HGNC:30092 details
hsa-miR-4662a-5p GLRA2 glycine receptor alpha 2 HGNC:4327 details
hsa-miR-4662a-5p KLHL20 kelch like family member 20 HGNC:25056 details
hsa-miR-4662a-5p HCN1 hyperpolarization activated cyclic nucleotide gated potassium channel 1 HGNC:4845 details
hsa-miR-4662a-5p SCARF1 scavenger receptor class F member 1 HGNC:16820 details
hsa-miR-4662a-5p SOD2 superoxide dismutase 2 HGNC:11180 details
hsa-miR-4662a-5p TFDP2 transcription factor Dp-2 HGNC:11751 details
hsa-miR-4662a-5p RWDD1 RWD domain containing 1 HGNC:20993 details
hsa-miR-4662a-5p CA5B carbonic anhydrase 5B HGNC:1378 details
hsa-miR-4662a-5p C21orf91 chromosome 21 open reading frame 91 HGNC:16459 details
hsa-miR-4662a-5p ZDHHC21 zinc finger DHHC-type palmitoyltransferase 21 HGNC:20750 details
hsa-miR-4662a-5p PPIC peptidylprolyl isomerase C HGNC:9256 details
hsa-miR-4662a-5p details
hsa-miR-4662a-5p VAT1L vesicle amine transport 1 like HGNC:29315 details
hsa-miR-4662a-5p STS steroid sulfatase HGNC:11425 details
hsa-miR-4662a-5p DDTL D-dopachrome tautomerase like HGNC:33446 details
hsa-miR-4662a-5p BANK1 B cell scaffold protein with ankyrin repeats 1 HGNC:18233 details
hsa-miR-4662a-5p TRIP4 thyroid hormone receptor interactor 4 HGNC:12310 details
hsa-miR-4662a-5p VPS36 vacuolar protein sorting 36 homolog HGNC:20312 details
hsa-miR-4662a-5p TAOK1 TAO kinase 1 HGNC:29259 details
hsa-miR-4662a-5p TAGLN2 transgelin 2 HGNC:11554 details
hsa-miR-4662a-5p PTPRF protein tyrosine phosphatase receptor type F HGNC:9670 details
hsa-miR-4662a-5p LSP1 lymphocyte specific protein 1 HGNC:6707 details
hsa-miR-4662a-5p TEX261 testis expressed 261 HGNC:30712 details
hsa-miR-4662a-5p PAQR7 progestin and adipoQ receptor family member 7 HGNC:23146 details
hsa-miR-4662a-5p SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 HGNC:19751 details
hsa-miR-4662a-5p details
hsa-miR-4662a-5p INO80B INO80 complex subunit B HGNC:13324 details
hsa-miR-4662a-5p CISD1 CDGSH iron sulfur domain 1 HGNC:30880 details
hsa-miR-4662a-5p ABHD17B abhydrolase domain containing 17B, depalmitoylase HGNC:24278 details
hsa-miR-4662a-5p GTF2A1 general transcription factor IIA subunit 1 HGNC:4646 details
hsa-miR-4662a-5p ZNF620 zinc finger protein 620 HGNC:28742 details
hsa-miR-4662a-5p FEM1B fem-1 homolog B HGNC:3649 details
hsa-miR-4662a-5p DHX33 DEAH-box helicase 33 HGNC:16718 details
hsa-miR-4662a-5p SYNPO2L synaptopodin 2 like HGNC:23532 details
hsa-miR-4662a-5p details
hsa-miR-4662a-5p PPWD1 peptidylprolyl isomerase domain and WD repeat containing 1 HGNC:28954 details
hsa-miR-4662a-5p SREK1IP1 SREK1 interacting protein 1 HGNC:26716 details
hsa-miR-4662a-5p ITPRIPL2 ITPRIP like 2 HGNC:27257 details
hsa-miR-4662a-5p OSBPL3 oxysterol binding protein like 3 HGNC:16370 details
hsa-miR-4662a-5p CRCP CGRP receptor component HGNC:17888 details
hsa-miR-4662a-5p TRAF3IP2 TRAF3 interacting protein 2 HGNC:1343 details
hsa-miR-4662a-5p UBXN2A UBX domain protein 2A HGNC:27265 details
hsa-miR-4662a-5p SHROOM4 shroom family member 4 HGNC:29215 details
hsa-miR-4662a-5p ORAI2 ORAI calcium release-activated calcium modulator 2 HGNC:21667 details
hsa-miR-4662a-5p IPO9 importin 9 HGNC:19425 details
hsa-miR-4662a-5p CNKSR3 CNKSR family member 3 HGNC:23034 details
hsa-miR-4662a-5p FRK fyn related Src family tyrosine kinase HGNC:3955 details
hsa-miR-4662a-5p ZNF329 zinc finger protein 329 HGNC:14209 details
hsa-miR-4662a-5p TTC22 tetratricopeptide repeat domain 22 HGNC:26067 details
hsa-miR-4662a-5p AKNA AT-hook transcription factor HGNC:24108 details
hsa-miR-4662a-5p TRIM56 tripartite motif containing 56 HGNC:19028 details
hsa-miR-4662a-5p TMED3 transmembrane p24 trafficking protein 3 HGNC:28889 details
hsa-miR-4662a-5p NEURL1B neuralized E3 ubiquitin protein ligase 1B HGNC:35422 details
hsa-miR-4662a-5p HIF1A hypoxia inducible factor 1 subunit alpha HGNC:4910 details
hsa-miR-4662a-5p CSNK2A1 casein kinase 2 alpha 1 HGNC:2457 details
hsa-miR-4662a-5p C6orf89 chromosome 6 open reading frame 89 HGNC:21114 details
hsa-miR-4662a-5p FN3KRP fructosamine 3 kinase related protein HGNC:25700 details
hsa-miR-4662a-5p GNAT1 G protein subunit alpha transducin 1 HGNC:4393 details
hsa-miR-4662a-5p C5orf51 chromosome 5 open reading frame 51 HGNC:27750 details
hsa-miR-4662a-5p CLPP caseinolytic mitochondrial matrix peptidase proteolytic subunit HGNC:2084 details
hsa-miR-4662a-5p MAVS mitochondrial antiviral signaling protein HGNC:29233 details
hsa-miR-4662a-5p RNF138 ring finger protein 138 HGNC:17765 details
hsa-miR-4662a-5p PPP4R2 protein phosphatase 4 regulatory subunit 2 HGNC:18296 details
hsa-miR-4662a-5p ZRANB3 zinc finger RANBP2-type containing 3 HGNC:25249 details
hsa-miR-4662a-5p HCFC1 host cell factor C1 HGNC:4839 details
hsa-miR-4662a-5p PDXP pyridoxal phosphatase HGNC:30259 details
hsa-miR-4662a-5p ZNF703 zinc finger protein 703 HGNC:25883 details
hsa-miR-4662a-5p TMED4 transmembrane p24 trafficking protein 4 HGNC:22301 details
hsa-miR-4662a-5p JADE3 jade family PHD finger 3 HGNC:22982 details
hsa-miR-4662a-5p APLN apelin HGNC:16665 details
hsa-miR-4662a-5p ZNF677 zinc finger protein 677 HGNC:28730 details
hsa-miR-4662a-5p API5 apoptosis inhibitor 5 HGNC:594 details
hsa-miR-4662a-5p CCS copper chaperone for superoxide dismutase HGNC:1613 details
hsa-miR-4662a-5p MACC1 MET transcriptional regulator MACC1 HGNC:30215 details
hsa-miR-4662a-5p NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 HGNC:23373 details
hsa-miR-4662a-5p KIR3DX1 killer cell immunoglobulin like receptor, three Ig domains X1 (pseudogene) HGNC:25043 details
hsa-miR-4662a-5p SLC39A11 solute carrier family 39 member 11 HGNC:14463 details
hsa-miR-4662a-5p RNF19B ring finger protein 19B HGNC:26886 details
hsa-miR-4662a-5p RBMS1 RNA binding motif single stranded interacting protein 1 HGNC:9907 details
hsa-miR-4662a-5p KREMEN1 kringle containing transmembrane protein 1 HGNC:17550 details
hsa-miR-4662a-5p ZNF25 zinc finger protein 25 HGNC:13043 details
hsa-miR-4662a-5p WDR37 WD repeat domain 37 HGNC:31406 details
hsa-miR-4662a-5p IGF2 insulin like growth factor 2 HGNC:5466 details
hsa-miR-4662a-5p ICA1L islet cell autoantigen 1 like HGNC:14442 details
hsa-miR-4662a-5p CCDC69 coiled-coil domain containing 69 HGNC:24487 details
hsa-miR-4662a-5p VHL von Hippel-Lindau tumor suppressor HGNC:12687 details
hsa-miR-4662a-5p UEVLD UEV and lactate/malate dehyrogenase domains HGNC:30866 details
hsa-miR-4662a-5p MLF2 myeloid leukemia factor 2 HGNC:7126 details
hsa-miR-4662a-5p NDNF neuron derived neurotrophic factor HGNC:26256 details
hsa-miR-4662a-5p MSRB3 methionine sulfoxide reductase B3 HGNC:27375 details
hsa-miR-4662a-5p FCHSD2 FCH and double SH3 domains 2 HGNC:29114 details
hsa-miR-4662a-5p FAHD1 fumarylacetoacetate hydrolase domain containing 1 HGNC:14169 details
hsa-miR-4662a-5p details
hsa-miR-4662a-5p C20orf144 chromosome 20 open reading frame 144 HGNC:16137 details
hsa-miR-4662a-5p ZNF786 zinc finger protein 786 HGNC:21806 details
hsa-miR-4662a-5p UBN2 ubinuclein 2 HGNC:21931 details
hsa-miR-4662a-5p XIAP X-linked inhibitor of apoptosis HGNC:592 details
hsa-miR-4662a-5p PPP1R3B protein phosphatase 1 regulatory subunit 3B HGNC:14942 details
hsa-miR-4662a-5p TIMM29 translocase of inner mitochondrial membrane 29 HGNC:25152 details
hsa-miR-4662a-5p GLP2R glucagon like peptide 2 receptor HGNC:4325 details
hsa-miR-4662a-5p SMIM12 small integral membrane protein 12 HGNC:25154 details
hsa-miR-4662a-5p QPCTL glutaminyl-peptide cyclotransferase like HGNC:25952 details
hsa-miR-4662a-5p FAM234B family with sequence similarity 234 member B HGNC:29288 details
hsa-miR-4662a-5p DUSP2 dual specificity phosphatase 2 HGNC:3068 details
hsa-miR-4662a-5p CD300LG CD300 molecule like family member g HGNC:30455 details
hsa-miR-4662a-5p WDR41 WD repeat domain 41 HGNC:25601 details
hsa-miR-4662a-5p ALG1 ALG1 chitobiosyldiphosphodolichol beta-mannosyltransferase HGNC:18294 details
hsa-miR-4662a-5p SMU1 SMU1 DNA replication regulator and spliceosomal factor HGNC:18247 details
hsa-miR-4662a-5p IFNLR1 interferon lambda receptor 1 HGNC:18584 details
hsa-miR-4662a-5p DST dystonin HGNC:1090 details
hsa-miR-4662a-5p DENND5B DENN domain containing 5B HGNC:28338 details
hsa-miR-4662a-5p FAM118A family with sequence similarity 118 member A HGNC:1313 details
hsa-miR-4662a-5p LIX1L limb and CNS expressed 1 like HGNC:28715 details
hsa-miR-4662a-5p BEND3 BEN domain containing 3 HGNC:23040 details
hsa-miR-4662a-5p GPR26 G protein-coupled receptor 26 HGNC:4481 details
hsa-miR-4662a-5p ZNF609 zinc finger protein 609 HGNC:29003 details
hsa-miR-4662a-5p FAT3 FAT atypical cadherin 3 HGNC:23112 details
hsa-miR-4662a-5p GRK4 G protein-coupled receptor kinase 4 HGNC:4543 details
hsa-miR-4662a-5p MAN1A2 mannosidase alpha class 1A member 2 HGNC:6822 details
hsa-miR-4662a-5p MED29 mediator complex subunit 29 HGNC:23074 details
hsa-miR-4662a-5p NCBP3 nuclear cap binding subunit 3 HGNC:24612 details
hsa-miR-4662a-5p PGAP1 post-GPI attachment to proteins inositol deacylase 1 HGNC:25712 details
hsa-miR-4662a-5p PSD4 pleckstrin and Sec7 domain containing 4 HGNC:19096 details
hsa-miR-4662a-5p RMDN1 regulator of microtubule dynamics 1 HGNC:24285 details
hsa-miR-4662a-5p SURF4 surfeit 4 HGNC:11476 details
hsa-miR-4662a-5p ZMAT2 zinc finger matrin-type 2 HGNC:26433 details
hsa-miR-4662a-5p ARMT1 acidic residue methyltransferase 1 HGNC:17872 details
hsa-miR-4662a-5p REEP3 receptor accessory protein 3 HGNC:23711 details
hsa-miR-4662a-5p ZYG11B zyg-11 family member B, cell cycle regulator HGNC:25820 details
hsa-miR-4662a-5p details
hsa-miR-4662a-5p SLC2A6 solute carrier family 2 member 6 HGNC:11011 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab