miRNA Card

miRNA General Information
miRNA ID hsa-miR-4666a-5p
Description Homo sapiens miR-4666a stem-loop
Comment None
Experiment Illumina [1]
Sequence AUACAUGUCAGAUUGUAUGCC
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr11:18502486|18516164 hsa-miR-4666a-5p 1 1 1
chr5:139865549|139887511 hsa-miR-4666a-5p 1 1 1

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr7:100162781|100162925 hsa-miR-4666a-5p 0 1 0
chr2:95090398|95090502 hsa-miR-4666a-5p 0 1 0
chr8:86117777|86117900 hsa-miR-4666a-5p 0 1 0
chr1:179860867|179860958 hsa-miR-4666a-5p 0 1 0
chr8:10428630|10428785 hsa-miR-4666a-5p 0 1 0
chr19:40739853|40740013 hsa-miR-4666a-5p 0 1 0
chr11:125602816|125602930 hsa-miR-4666a-5p 1 0 0
chr9:74982039|74982142 hsa-miR-4666a-5p 0 1 0
chr20:1165036|1165245 hsa-miR-4666a-5p 0 1 0
chr19:6381554|6381755 hsa-miR-4666a-5p 0 1 0
chr16:1699696|1699885 hsa-miR-4666a-5p 0 1 0
chr8:17957309~17957631 hsa-miR-4666a-5p 0 1 0
chr21:46318785~46318961 hsa-miR-4666a-5p 0 1 0
chr3:16305704~16305807 hsa-miR-4666a-5p 0 1 0
chr22:40410599~40410772 hsa-miR-4666a-5p 0 1 0
chr7:92449665~92449782 hsa-miR-4666a-5p 0 1 0
chr22:36388489|36388735 hsa-miR-4666a-5p 1 0 0
chr1:161127551|161127693 hsa-miR-4666a-5p 0 1 0
chr10:791676|791807 hsa-miR-4666a-5p 0 1 0
chr12:32225222|32225357 hsa-miR-4666a-5p 0 1 0
chr17:7899016|7899137 hsa-miR-4666a-5p 0 1 0
chr4:106789254|106789450 hsa-miR-4666a-5p 0 1 0
chr7:6422786|6422988 hsa-miR-4666a-5p 0 1 0
chr8:66922329|66922515 hsa-miR-4666a-5p 0 1 0
chr8:141428832|141428946 hsa-miR-4666a-5p 0 1 0
chr6:110210777|110212216 hsa-miR-4666a-5p 0 1 0
chr8:47978033|47978153 hsa-miR-4666a-5p 0 1 0
chr5:180847662|180847927 hsa-miR-4666a-5p 0 1 0
chr3:18483337|18483487 hsa-miR-4666a-5p 0 1 0
chr1:155131352|155131473 hsa-miR-4666a-5p 0 1 0
chr2:190190090|190190226 hsa-miR-4666a-5p 0 1 0
chrX:110194266|110194437 hsa-miR-4666a-5p 0 1 0
chr5:43174774|43175070 hsa-miR-4666a-5p 0 1 0
chr11:65205906|65206071 hsa-miR-4666a-5p 0 1 0
chr19:45277923|45278615 hsa-miR-4666a-5p 0 1 0
chr3:49531120|49531230 hsa-miR-4666a-5p 0 1 0
chr12:51355806|51355949 hsa-miR-4666a-5p 0 1 0
chr19:42297141|42297275 hsa-miR-4666a-5p 0 1 0
chr17:59885292|59885478 hsa-miR-4666a-5p 0 1 0
chr8:55762351|55762502 hsa-miR-4666a-5p 0 1 0
chr19:42297066|42297335 hsa-miR-4666a-5p 0 1 0
chr7:30389790|30389981 hsa-miR-4666a-5p 0 1 0
chr11:77011963|77012173 hsa-miR-4666a-5p 0 1 0
chr11:125644189|125644268 hsa-miR-4666a-5p -15 1 0
chr5:38823320|38823414 hsa-miR-4666a-5p 0 1 0
chr8:80539395|80539696 hsa-miR-4666a-5p 0 1 0
chr15:40537509|40537640 hsa-miR-4666a-5p 0 1 0
chr7:92605231|92605353 hsa-miR-4666a-5p 1 0 0
chr3:58637165|58640173 hsa-miR-4666a-5p 0 1 0
chrX:110194223|110194437 hsa-miR-4666a-5p 0 1 0
chr3:49531106|49531279 hsa-miR-4666a-5p 0 1 0
chr11:63900562|63900678 hsa-miR-4666a-5p 0 1 0
chr16:66723444|66723543 hsa-miR-4666a-5p 0 1 0
chr19:6381554|6381850 hsa-miR-4666a-5p 0 1 0
chr8:144083057|144083440 hsa-miR-4666a-5p 0 1 0
chr3:49531111|49531279 hsa-miR-4666a-5p 0 1 0
chr2:240632295|240632518 hsa-miR-4666a-5p 0 1 0
chr11:124649664|124649787 hsa-miR-4666a-5p 0 1 0
chr2:240632297|240632488 hsa-miR-4666a-5p 0 1 0
chr2:240632325|240632422 hsa-miR-4666a-5p 0 1 0
chr19:6381697|6383330 hsa-miR-4666a-5p 0 1 0
chr3:58637162|58640153 hsa-miR-4666a-5p 0 1 0
chr5:77447847|77448039 hsa-miR-4666a-5p 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4666a-5p DDX4 DEAD-box helicase 4 HGNC:18700 details
hsa-miR-4666a-5p TSPAN6 tetraspanin 6 HGNC:11858 details
hsa-miR-4666a-5p DCAF15 DDB1 and CUL4 associated factor 15 HGNC:25095 details
hsa-miR-4666a-5p TRPV2 transient receptor potential cation channel subfamily V member 2 HGNC:18082 details
hsa-miR-4666a-5p RPS14 ribosomal protein S14 HGNC:10387 details
hsa-miR-4666a-5p CCND1 cyclin D1 HGNC:1582 details
hsa-miR-4666a-5p C2orf72 chromosome 2 open reading frame 72 HGNC:27418 details
hsa-miR-4666a-5p PATL1 PAT1 homolog 1, processing body mRNA decay factor HGNC:26721 details
hsa-miR-4666a-5p TMEM30B transmembrane protein 30B HGNC:27254 details
hsa-miR-4666a-5p TXNIP thioredoxin interacting protein HGNC:16952 details
hsa-miR-4666a-5p GPR158 G protein-coupled receptor 158 HGNC:23689 details
hsa-miR-4666a-5p ZNF85 zinc finger protein 85 HGNC:13160 details
hsa-miR-4666a-5p ZNF451 zinc finger protein 451 HGNC:21091 details
hsa-miR-4666a-5p MRPL17 mitochondrial ribosomal protein L17 HGNC:14053 details
hsa-miR-4666a-5p EIF1AX eukaryotic translation initiation factor 1A X-linked HGNC:3250 details
hsa-miR-4666a-5p GSG1 germ cell associated 1 HGNC:19716 details
hsa-miR-4666a-5p ELF4 E74 like ETS transcription factor 4 HGNC:3319 details
hsa-miR-4666a-5p STN1 STN1 subunit of CST complex HGNC:26200 details
hsa-miR-4666a-5p ENPP6 ectonucleotide pyrophosphatase/phosphodiesterase 6 HGNC:23409 details
hsa-miR-4666a-5p ZNF134 zinc finger protein 134 HGNC:12918 details
hsa-miR-4666a-5p IFNGR2 interferon gamma receptor 2 HGNC:5440 details
hsa-miR-4666a-5p MOGAT1 monoacylglycerol O-acyltransferase 1 HGNC:18210 details
hsa-miR-4666a-5p GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 HGNC:4129 details
hsa-miR-4666a-5p FKBP5 FKBP prolyl isomerase 5 HGNC:3721 details
hsa-miR-4666a-5p ARHGEF17 Rho guanine nucleotide exchange factor 17 HGNC:21726 details
hsa-miR-4666a-5p details
hsa-miR-4666a-5p MGAT4C MGAT4 family member C HGNC:30871 details
hsa-miR-4666a-5p USP25 ubiquitin specific peptidase 25 HGNC:12624 details
hsa-miR-4666a-5p CERCAM cerebral endothelial cell adhesion molecule HGNC:23723 details
hsa-miR-4666a-5p LINC00955 long intergenic non-protein coding RNA 955 HGNC:26644 details
hsa-miR-4666a-5p ADH4 alcohol dehydrogenase 4 (class II), pi polypeptide HGNC:252 details
hsa-miR-4666a-5p ENOX2 ecto-NOX disulfide-thiol exchanger 2 HGNC:2259 details
hsa-miR-4666a-5p UBE2A ubiquitin conjugating enzyme E2 A HGNC:12472 details
hsa-miR-4666a-5p SRSF10 serine and arginine rich splicing factor 10 HGNC:16713 details
hsa-miR-4666a-5p SMU1 SMU1 DNA replication regulator and spliceosomal factor HGNC:18247 details
hsa-miR-4666a-5p PROX1 prospero homeobox 1 HGNC:9459 details
hsa-miR-4666a-5p PAX5 paired box 5 HGNC:8619 details
hsa-miR-4666a-5p PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 HGNC:8575 details
hsa-miR-4666a-5p JAZF1 JAZF zinc finger 1 HGNC:28917 details
hsa-miR-4666a-5p DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 HGNC:14886 details
hsa-miR-4666a-5p CREBL2 cAMP responsive element binding protein like 2 HGNC:2350 details
hsa-miR-4666a-5p AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-4666a-5p details
hsa-miR-4666a-5p LANCL1 LanC like 1 HGNC:6508 details
hsa-miR-4666a-5p ORC4 origin recognition complex subunit 4 HGNC:8490 details
hsa-miR-4666a-5p FAM229B family with sequence similarity 229 member B HGNC:33858 details
hsa-miR-4666a-5p ALYREF Aly/REF export factor HGNC:19071 details
hsa-miR-4666a-5p TUBB2A tubulin beta 2A class IIa HGNC:12412 details
hsa-miR-4666a-5p TNRC6C trinucleotide repeat containing adaptor 6C HGNC:29318 details
hsa-miR-4666a-5p SEPHS1 selenophosphate synthetase 1 HGNC:19685 details
hsa-miR-4666a-5p BACH1 BTB domain and CNC homolog 1 HGNC:935 details
hsa-miR-4666a-5p ADO 2-aminoethanethiol dioxygenase HGNC:23506 details
hsa-miR-4666a-5p GOLGA4 golgin A4 HGNC:4427 details
hsa-miR-4666a-5p UNC5B unc-5 netrin receptor B HGNC:12568 details
hsa-miR-4666a-5p BDH1 3-hydroxybutyrate dehydrogenase 1 HGNC:1027 details
hsa-miR-4666a-5p PLXNA4 plexin A4 HGNC:9102 details
hsa-miR-4666a-5p GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 HGNC:20883 details
hsa-miR-4666a-5p P2RY1 purinergic receptor P2Y1 HGNC:8539 details
hsa-miR-4666a-5p FKBP9 FKBP prolyl isomerase 9 HGNC:3725 details
hsa-miR-4666a-5p ZDHHC15 zinc finger DHHC-type palmitoyltransferase 15 HGNC:20342 details
hsa-miR-4666a-5p WWC3 WWC family member 3 HGNC:29237 details
hsa-miR-4666a-5p RPH3A rabphilin 3A HGNC:17056 details
hsa-miR-4666a-5p PHAX phosphorylated adaptor for RNA export HGNC:10241 details
hsa-miR-4666a-5p GRIK3 glutamate ionotropic receptor kainate type subunit 3 HGNC:4581 details
hsa-miR-4666a-5p CERS4 ceramide synthase 4 HGNC:23747 details
hsa-miR-4666a-5p RBM3 RNA binding motif protein 3 HGNC:9900 details
hsa-miR-4666a-5p AZF1 azoospermia factor 1 HGNC:908 details
hsa-miR-4666a-5p PTPN12 protein tyrosine phosphatase non-receptor type 12 HGNC:9645 details
hsa-miR-4666a-5p C21orf58 chromosome 21 open reading frame 58 HGNC:1300 details
hsa-miR-4666a-5p FAM98B family with sequence similarity 98 member B HGNC:26773 details
hsa-miR-4666a-5p UHRF1BP1 UHRF1 binding protein 1 HGNC:21216 details
hsa-miR-4666a-5p TM9SF3 transmembrane 9 superfamily member 3 HGNC:21529 details
hsa-miR-4666a-5p SRSF2 serine and arginine rich splicing factor 2 HGNC:10783 details
hsa-miR-4666a-5p RNMT RNA guanine-7 methyltransferase HGNC:10075 details
hsa-miR-4666a-5p ADAM9 ADAM metallopeptidase domain 9 HGNC:216 details
hsa-miR-4666a-5p WDR17 WD repeat domain 17 HGNC:16661 details
hsa-miR-4666a-5p MMADHC metabolism of cobalamin associated D HGNC:25221 details
hsa-miR-4666a-5p KLHL23 kelch like family member 23 HGNC:27506 details
hsa-miR-4666a-5p TRIM27 tripartite motif containing 27 HGNC:9975 details
hsa-miR-4666a-5p RWDD2A RWD domain containing 2A HGNC:21385 details
hsa-miR-4666a-5p KCNK1 potassium two pore domain channel subfamily K member 1 HGNC:6272 details
hsa-miR-4666a-5p STYK1 serine/threonine/tyrosine kinase 1 HGNC:18889 details
hsa-miR-4666a-5p LIN54 lin-54 DREAM MuvB core complex component HGNC:25397 details
hsa-miR-4666a-5p AIRE autoimmune regulator HGNC:360 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab