miRNA Card

miRNA General Information
miRNA ID hsa-miR-4668-5p
Description Homo sapiens miR-4668 stem-loop
Comment None
Experiment Illumina [1]
Sequence AGGGAAAAAAAAAAGGAUUUGUC
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr14:50475077|50486194 hsa-miR-4668-5p 1 1 1
chr14:34754827|34771659 hsa-miR-4668-5p 1 1 1

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr1:153981874|153982053 hsa-miR-4668-5p 1 0 0
chr1:153981874|153982025 hsa-miR-4668-5p 1 0 0
chr9:114311173|114311376 hsa-miR-4668-5p 0 1 0
chr6:21596057|21596219 hsa-miR-4668-5p 0 1 0
chr14:94382592|94382709 hsa-miR-4668-5p 0 1 0
chr3:160501262|160501374 hsa-miR-4668-5p 0 1 0
chr10:100363070|100363413 hsa-miR-4668-5p 0 1 0
chr12:7095595|7095665 hsa-miR-4668-5p 0 1 0
chr12:53479897|53479999 hsa-miR-4668-5p 0 1 0
chr4:140392219|140392309 hsa-miR-4668-5p 0 1 0
chr8:80523532|80523652 hsa-miR-4668-5p 0 1 0
chr13:53051166|53051274 hsa-miR-4668-5p 0 1 0
chr3:33142442|33142613 hsa-miR-4668-5p 0 1 0
chr8:99642183|99642292 hsa-miR-4668-5p 0 1 0
chr19:45936621|45936743 hsa-miR-4668-5p 0 1 0
chr3:52458672|52458763 hsa-miR-4668-5p 0 1 0
chr11:62596032|62596310 hsa-miR-4668-5p 0 1 0
chr19:11549769|11549894 hsa-miR-4668-5p 0 1 0
chr17:50745848|50745973 hsa-miR-4668-5p 0 1 0
chr11:208250|208405 hsa-miR-4668-5p 0 1 0
chrX:49069380|49069486 hsa-miR-4668-5p 0 1 0
chr20:63931771|63931949 hsa-miR-4668-5p 0 1 0
chr2:36555088|36555210 hsa-miR-4668-5p 1 0 0
chr1:23761367|23761524 hsa-miR-4668-5p 1 0 0
chr12:1772842|1772961 hsa-miR-4668-5p 1 0 0
chr20:59028689|59028806 hsa-miR-4668-5p 1 0 0
chr18:9525720|9525851 hsa-miR-4668-5p 1 0 0
chr19:11549760|11549894 hsa-miR-4668-5p 0 1 0
chr9:133763111|133763255 hsa-miR-4668-5p 0 1 0
chr2:135784304|135784405 hsa-miR-4668-5p 0 1 0
chr4:75049590|75049692 hsa-miR-4668-5p 0 1 0
chr6:109367602|109367858 hsa-miR-4668-5p 0 1 0
chr15:41527212|41527515 hsa-miR-4668-5p 0 1 0
chr12:121239987|121240197 hsa-miR-4668-5p 0 1 0
chr2:60794855|60795155 hsa-miR-4668-5p 0 1 0
chr2:42764737|42764852 hsa-miR-4668-5p 0 1 0
chr4:39312768|39312859 hsa-miR-4668-5p 0 1 0
chr2:161161316|161161412 hsa-miR-4668-5p 0 1 0
chr8:37861056|37861153 hsa-miR-4668-5p 0 1 0
chr20:32167026|32167128 hsa-miR-4668-5p 0 1 0
chr17:35502561|35502873 hsa-miR-4668-5p 0 1 0
chr1:54099642|54099837 hsa-miR-4668-5p 0 1 0
chr4:140392219|140392302 hsa-miR-4668-5p 0 1 0
chr9:94459542|94459698 hsa-miR-4668-5p 0 1 0
chr7:131504154|131504262 hsa-miR-4668-5p 0 1 0
chr11:128968646|128968808 hsa-miR-4668-5p 0 1 0
chr6:158766634|158766759 hsa-miR-4668-5p 0 1 0
chr17:7484447|7484623 hsa-miR-4668-5p 0 1 0
chr19:48961127|48961328 hsa-miR-4668-5p 0 1 0
chr15:74054500|74054666 hsa-miR-4668-5p 0 1 0
chr4:101027170|101027374 hsa-miR-4668-5p 0 1 0
chr7:138750227|138750321 hsa-miR-4668-5p 0 1 0
chr14:94381080|94382676 hsa-miR-4668-5p 0 1 0
chrX:71574554|71574683 hsa-miR-4668-5p 0 1 0
chr6:18236452|18258405 hsa-miR-4668-5p 0 1 0
chr1:16685822|16685965 hsa-miR-4668-5p 0 1 0
chr22:41520567|41520866 hsa-miR-4668-5p 0 1 0
chr6:21596046|21596219 hsa-miR-4668-5p 0 1 0
chr12:121239987|121240163 hsa-miR-4668-5p 0 1 0
chr6:158634996|158635085 hsa-miR-4668-5p 0 1 0
chr3:52256767~52256835 hsa-miR-4668-5p 0 1 0
chr12:121239987~121240197 hsa-miR-4668-5p 0 1 0
chr7:75886202~75886373 hsa-miR-4668-5p 0 1 0
chr1:52020249~52020492 hsa-miR-4668-5p 0 1 0
chr18:63329052~63329204 hsa-miR-4668-5p 0 1 0
chr4:103020245~103020342 hsa-miR-4668-5p 0 1 0
chr14:94382592~94382709 hsa-miR-4668-5p 0 1 0
chr4:41100639~41100750 hsa-miR-4668-5p 0 1 0
chr1:153947949~153948035 hsa-miR-4668-5p 0 1 0
chr6:89658651~89658773 hsa-miR-4668-5p 0 1 0
chr1:179076171~179076271 hsa-miR-4668-5p 0 1 0
chr20:49124417~49124511 hsa-miR-4668-5p 0 1 0
chrX:2488424~2488509 hsa-miR-4668-5p 0 1 0
chr3:52434085~52434149 hsa-miR-4668-5p 0 1 0
chr1:23761367~23761524 hsa-miR-4668-5p 0 1 0
chr20:32167026~32167128 hsa-miR-4668-5p 0 1 0
chr12:1772842~1772961 hsa-miR-4668-5p 0 1 0
chr14:94376832~94376927 hsa-miR-4668-5p 0 1 0
chr14:94382650|94382709 hsa-miR-4668-5p 0 1 0
chr10:100363040~100363268 hsa-miR-4668-5p 0 1 0
chr3:33142454~33142613 hsa-miR-4668-5p 0 1 0
chr17:7484464~7484623 hsa-miR-4668-5p 0 1 0
chr6:2854558~2854758 hsa-miR-4668-5p 0 1 0
chr3:107808973~107809128 hsa-miR-4668-5p 0 1 0
chr15:92617759~92617893 hsa-miR-4668-5p 0 1 0
chr20:59028689~59028806 hsa-miR-4668-5p 0 1 0
chr6:24718540~24718823 hsa-miR-4668-5p 0 1 0
chr2:161161312~161161412 hsa-miR-4668-5p 0 1 0
chrX:2485871|2486011 hsa-miR-4668-5p 1 0 0
chr1:8539380|8539487 hsa-miR-4668-5p 0 1 0
chr6:17691624|17691855 hsa-miR-4668-5p 0 1 0
chr19:39343139|39343278 hsa-miR-4668-5p 0 1 0
chr18:13035221|13035353 hsa-miR-4668-5p 0 1 0
chr1:117402186|117405645 hsa-miR-4668-5p 0 1 0
chr1:117402186|117420649 hsa-miR-4668-5p 0 1 0
chr19:18498343|18498558 hsa-miR-4668-5p 0 1 0
chr12:120317150|120317267 hsa-miR-4668-5p 0 1 0
chr10:102109109|102109457 hsa-miR-4668-5p 0 1 0
chr5:138202113|138202233 hsa-miR-4668-5p 0 1 0
chr13:78599651|78599817 hsa-miR-4668-5p 0 1 0
chr2:241262827|241262926 hsa-miR-4668-5p 0 1 0
chr12:66236495|66236611 hsa-miR-4668-5p 0 1 0
chr1:117402186|117414831 hsa-miR-4668-5p 0 1 0
chr6:70798657|70798737 hsa-miR-4668-5p 0 1 0
chrX:37812422|37812551 hsa-miR-4668-5p 0 1 0
chr4:38055286|38055379 hsa-miR-4668-5p 0 1 0
chr9:71899054|71899208 hsa-miR-4668-5p 0 1 0
chr19:21372197|21372405 hsa-miR-4668-5p 0 1 0
chr18:44786123|44786255 hsa-miR-4668-5p 0 1 0
chr16:29668726|29668828 hsa-miR-4668-5p 0 1 0
chr9:109039805|109039889 hsa-miR-4668-5p 0 1 0
chr3:132434538|132434618 hsa-miR-4668-5p 0 1 0
chr16:29668659|29668828 hsa-miR-4668-5p 0 1 0
chr3:123248753|123248885 hsa-miR-4668-5p 0 1 0
chrX:37812405|37812551 hsa-miR-4668-5p 0 1 0
chr4:79973390|79973518 hsa-miR-4668-5p 0 1 0
chr6:18256361|18258405 hsa-miR-4668-5p 0 1 0
chr9:35737564|35737685 hsa-miR-4668-5p 0 1 0
chr9:100183727|100183836 hsa-miR-4668-5p 0 1 0
chr17:76381234|76381386 hsa-miR-4668-5p 0 1 0
chr2:98486936|98487025 hsa-miR-4668-5p 0 1 0
chr5:133087855|133088027 hsa-miR-4668-5p 0 1 0
chr9:129151374|129151539 hsa-miR-4668-5p 0 1 0
chr4:88071406|88071528 hsa-miR-4668-5p 0 1 0
chr6:21594044|21594262 hsa-miR-4668-5p 1 0 0
chr9:110169578|110169765 hsa-miR-4668-5p 1 0 0
chrX:74532078|74532261 hsa-miR-4668-5p 1 0 0
chr18:9524594|9525851 hsa-miR-4668-5p 1 0 0
chr2:85662029|85663390 hsa-miR-4668-5p 0 1 0
chr6:18258304|18263885 hsa-miR-4668-5p 0 1 0
chr6:21596040|21596219 hsa-miR-4668-5p 0 1 0
chr10:3776839|3776958 hsa-miR-4668-5p 0 1 0
chr11:62596032|62596339 hsa-miR-4668-5p 0 1 0
chr17:7389435|7389712 hsa-miR-4668-5p 0 1 0
chr1:28281253|28281404 hsa-miR-4668-5p 0 1 0
chr14:94381119|94382709 hsa-miR-4668-5p 0 1 0
chr15:85747736|85747869 hsa-miR-4668-5p 0 1 0
chr6:31533858|31534004 hsa-miR-4668-5p 0 1 0
chr18:36126219|36126333 hsa-miR-4668-5p 0 1 0
chrX:150990484|150990586 hsa-miR-4668-5p 0 1 0
chr1:162523479|162523786 hsa-miR-4668-5p 0 1 0
chr11:111783410|111783522 hsa-miR-4668-5p 0 1 0
chr12:121239987|121240169 hsa-miR-4668-5p 0 1 0
chr1:214038500|214038676 hsa-miR-4668-5p 0 1 0
chr19:11549763|11549894 hsa-miR-4668-5p 0 1 0
chr11:117168579|117168724 hsa-miR-4668-5p 0 1 0
chr8:33554385|33554776 hsa-miR-4668-5p 0 1 0
chr9:27327385|27327532 hsa-miR-4668-5p 0 1 0
chr2:85662029|85663423 hsa-miR-4668-5p 0 1 0
chr11:62825055|62825443 hsa-miR-4668-5p 0 1 0
chr2:190964394|190964583 hsa-miR-4668-5p 0 1 0
chr22:35739400|35739613 hsa-miR-4668-5p 0 1 0
chr15:84802313|84802487 hsa-miR-4668-5p 0 1 0
chr4:119271805|119272011 hsa-miR-4668-5p 0 1 0
chr14:80770236|80770368 hsa-miR-4668-5p 0 1 0
chr2:85661454|85663378 hsa-miR-4668-5p 0 1 0
chr11:10798992|10799243 hsa-miR-4668-5p 0 1 0
chr20:59028696|59028806 hsa-miR-4668-5p 0 1 0
chr13:94403303|94403433 hsa-miR-4668-5p 0 1 0
chr12:70242647|70242786 hsa-miR-4668-5p 0 1 0
chr11:111783410|111783481 hsa-miR-4668-5p 0 1 0
chr6:89658332|89658687 hsa-miR-4668-5p 0 1 0
chr1:162523601|162523822 hsa-miR-4668-5p 0 1 0
chr22:38075418|38075538 hsa-miR-4668-5p 0 1 0
chr19:11549773|11549894 hsa-miR-4668-5p 0 1 0
chr4:105145571|105145807 hsa-miR-4668-5p 0 1 0
chr14:32091898|32092025 hsa-miR-4668-5p 0 1 0
chr17:50745853|50746003 hsa-miR-4668-5p 0 1 0
chr9:128272872|128273009 hsa-miR-4668-5p 0 1 0
chr20:63931644|63931873 hsa-miR-4668-5p 0 1 0
chr7:1472550|1472803 hsa-miR-4668-5p 0 1 0
chr2:100275714|100276023 hsa-miR-4668-5p 0 1 0
chr12:128812860|128812975 hsa-miR-4668-5p 0 1 0
chr8:60794986|60801593 hsa-miR-4668-5p 0 1 0
chr1:52020711|52020828 hsa-miR-4668-5p 0 1 0
chr2:241262711|241262905 hsa-miR-4668-5p 0 1 0
chr6:42603588|42606651 hsa-miR-4668-5p 0 1 0
chr6:42603588|42612291 hsa-miR-4668-5p 0 1 0
chr9:86305192|86310017 hsa-miR-4668-5p 0 1 0
chr1:179076095|179076271 hsa-miR-4668-5p 0 1 0
chrX:70432915|70433212 hsa-miR-4668-5p 0 1 0
chr9:110172078|110172286 hsa-miR-4668-5p 0 1 0
chr1:154986923|154987102 hsa-miR-4668-5p 0 1 0
chr4:16165159|16165237 hsa-miR-4668-5p 0 1 0
chr6:21596055|21596219 hsa-miR-4668-5p 0 1 0
chr14:94382592|94382711 hsa-miR-4668-5p 0 1 0
chr1:153693134|153693410 hsa-miR-4668-5p 0 1 0
chr11:45214195|45214338 hsa-miR-4668-5p 0 1 0
chr13:75858108|75858266 hsa-miR-4668-5p 0 1 0
chr1:179076095|179076278 hsa-miR-4668-5p 0 1 0
chr2:85661454|85663423 hsa-miR-4668-5p 0 1 0
chr6:109367602|109367714 hsa-miR-4668-5p 0 1 0
chr17:7853709|7853834 hsa-miR-4668-5p 0 1 0
chr18:36126219|36126320 hsa-miR-4668-5p 0 1 0
chr12:7095546|7095665 hsa-miR-4668-5p 0 1 0
chr14:94381065|94382711 hsa-miR-4668-5p 0 1 0
chr22:38484577|38484777 hsa-miR-4668-5p 0 1 0
chr2:173221501|173221666 hsa-miR-4668-5p 0 1 0
chr17:50745788|50745903 hsa-miR-4668-5p 0 1 0
chr22:49922389|49922657 hsa-miR-4668-5p 0 1 0
chr19:896974|897114 hsa-miR-4668-5p 0 1 0
chr12:57234467|57234624 hsa-miR-4668-5p 0 1 0
chr19:39476471|39476606 hsa-miR-4668-5p 0 1 0
chr17:7484464|7484623 hsa-miR-4668-5p 0 1 0
chr3:33142442|33142637 hsa-miR-4668-5p 0 1 0
chr3:30650286|30650460 hsa-miR-4668-5p 0 1 0
chr17:7484487|7484698 hsa-miR-4668-5p 0 1 0
chr19:52114934|52115185 hsa-miR-4668-5p 0 1 0
chr11:65426906|65427180 hsa-miR-4668-5p 0 1 0
chr19:34354656|34354877 hsa-miR-4668-5p 0 1 0
chr2:27696996|27697165 hsa-miR-4668-5p 0 1 0
chr4:155730345|155730490 hsa-miR-4668-5p 0 1 0
chr19:4653927|4654121 hsa-miR-4668-5p 0 1 0
chr14:32091945|32092025 hsa-miR-4668-5p -10 1 0
chr17:32480823|32481091 hsa-miR-4668-5p -9 1 0
chr15:70048582|70048751 hsa-miR-4668-5p -9 1 0
chr9:110169594|110169765 hsa-miR-4668-5p 1 0 0
chr10:100363192|100363291 hsa-miR-4668-5p 0 1 0
chr19:11549695|11549903 hsa-miR-4668-5p 0 1 0
chr6:135185922|135186020 hsa-miR-4668-5p 0 1 0
chr20:59028689|59028828 hsa-miR-4668-5p 0 1 0
chr19:46610238|46610468 hsa-miR-4668-5p 0 1 0
chrX:23783970|23784108 hsa-miR-4668-5p 0 1 0
chr6:32181025|32181129 hsa-miR-4668-5p 0 1 0
chr19:11549763|11549917 hsa-miR-4668-5p 0 1 0
chr19:11549706|11549894 hsa-miR-4668-5p 0 1 0
chr15:43328263|43328486 hsa-miR-4668-5p 0 1 0
chr11:62825072|62825461 hsa-miR-4668-5p 0 1 0
chr16:25216985|25217271 hsa-miR-4668-5p 0 1 0
chr8:9140624|9140712 hsa-miR-4668-5p 0 1 0
chr6:89658610|89658854 hsa-miR-4668-5p 0 1 0
chr2:84881927|84882036 hsa-miR-4668-5p 0 1 0
chr11:130872341|130872565 hsa-miR-4668-5p 0 1 0
chr9:128518084|128518314 hsa-miR-4668-5p 0 1 0
chr14:23325306|23325475 hsa-miR-4668-5p 0 1 0
chr22:30655229|30655373 hsa-miR-4668-5p 0 1 0
chr6:18258304|18258379 hsa-miR-4668-5p 0 1 0
chr1:52020298|52020454 hsa-miR-4668-5p 0 1 0
chrX:153948386|153948546 hsa-miR-4668-5p 0 1 0
chr11:117168568|117168724 hsa-miR-4668-5p 0 1 0
chr1:179076167|179076271 hsa-miR-4668-5p 0 1 0
chr7:5528974|5529144 hsa-miR-4668-5p 0 1 0
chr6:89658332|89658699 hsa-miR-4668-5p 0 1 0
chr19:52114934|52115101 hsa-miR-4668-5p 0 1 0
chr7:107946166|107946322 hsa-miR-4668-5p 0 1 0
chr17:7484487|7484623 hsa-miR-4668-5p 0 1 0
chr17:48604480|48604600 hsa-miR-4668-5p 0 1 0
chr12:74541048|74541199 hsa-miR-4668-5p 0 1 0
chr9:125236371|125236547 hsa-miR-4668-5p 0 1 0
chr3:196239582|196239714 hsa-miR-4668-5p 0 1 0
chr19:42511878|42511981 hsa-miR-4668-5p 0 1 0
chr6:7289471|7289827 hsa-miR-4668-5p 0 1 0
chr9:125236410|125236547 hsa-miR-4668-5p 0 1 0
chr17:65529227|65529379 hsa-miR-4668-5p 0 1 0
chr11:65667068|65667192 hsa-miR-4668-5p 0 1 0
chr12:121240474|121240593 hsa-miR-4668-5p 0 1 0
chr14:94381065|94382676 hsa-miR-4668-5p 0 1 0
chr18:26600022|26600185 hsa-miR-4668-5p 0 1 0
chr1:52020668|52020828 hsa-miR-4668-5p 0 1 0
chr1:88805594|88805921 hsa-miR-4668-5p 0 1 0
chr19:11549775|11549894 hsa-miR-4668-5p 0 1 0
chr3:50325045|50325158 hsa-miR-4668-5p 0 1 0
chr19:804137|804389 hsa-miR-4668-5p 0 1 0
chr12:74541020|74541199 hsa-miR-4668-5p 0 1 0
chr3:33816062|33816183 hsa-miR-4668-5p 0 1 0
chr9:124877282|124877465 hsa-miR-4668-5p 0 1 0
chr22:38075412|38075532 hsa-miR-4668-5p 0 1 0
chr6:31658680|31658913 hsa-miR-4668-5p 0 1 0
chr6:30546785|30547157 hsa-miR-4668-5p 0 1 0
chr2:241262756|241262905 hsa-miR-4668-5p 0 1 0
chr19:42511878|42511956 hsa-miR-4668-5p 0 1 0
chr12:57234519|57234594 hsa-miR-4668-5p 0 1 0
chr19:11549766|11549903 hsa-miR-4668-5p 0 1 0
chr1:204373758|204373885 hsa-miR-4668-5p 0 1 0
chr8:9140561|9140717 hsa-miR-4668-5p 0 1 0
chr13:53051125|53051318 hsa-miR-4668-5p 0 1 0
chr13:24453147|24453368 hsa-miR-4668-5p 0 1 0
chr14:39181078|39181175 hsa-miR-4668-5p 0 1 0
chr19:11549763|11549903 hsa-miR-4668-5p 0 1 0
chr6:43634144|43634378 hsa-miR-4668-5p 0 1 0
chr1:26781457|26781626 hsa-miR-4668-5p 0 1 0
chr19:1257291|1257490 hsa-miR-4668-5p 0 1 0
chr6:158634988|158635072 hsa-miR-4668-5p 0 1 0
chr11:57817045|57817413 hsa-miR-4668-5p 0 1 0
chr6:158634948|158635072 hsa-miR-4668-5p 0 1 0
chr17:56997724|56997891 hsa-miR-4668-5p 1 0 0
chr9:110169594|110169741 hsa-miR-4668-5p 1 0 0
chr19:16575222|16575293 hsa-miR-4668-5p 1 0 0
chr10:128098953|128099231 hsa-miR-4668-5p 1 0 0
chr6:35455924|35456162 hsa-miR-4668-5p 1 0 0
chr1:17408771|17408961 hsa-miR-4668-5p 1 0 0
chr15:90391185|90391322 hsa-miR-4668-5p 1 0 0
chr17:7907675|7907984 hsa-miR-4668-5p 1 0 0
chr7:128660942|128661190 hsa-miR-4668-5p 1 0 0
chr17:68042955|68043197 hsa-miR-4668-5p 1 0 0
chr1:109757944|109758333 hsa-miR-4668-5p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4668-5p PHKG2 phosphorylase kinase catalytic subunit gamma 2 HGNC:8931 details
hsa-miR-4668-5p AK4 adenylate kinase 4 HGNC:363 details
hsa-miR-4668-5p KMT2A lysine methyltransferase 2A HGNC:7132 details
hsa-miR-4668-5p HAVCR1 hepatitis A virus cellular receptor 1 HGNC:17866 details
hsa-miR-4668-5p NCEH1 neutral cholesterol ester hydrolase 1 HGNC:29260 details
hsa-miR-4668-5p TSTD2 thiosulfate sulfurtransferase like domain containing 2 HGNC:30087 details
hsa-miR-4668-5p UHRF1BP1L UHRF1 binding protein 1 like HGNC:29102 details
hsa-miR-4668-5p PDHA1 pyruvate dehydrogenase E1 subunit alpha 1 HGNC:8806 details
hsa-miR-4668-5p CDR2L cerebellar degeneration related protein 2 like HGNC:29999 details
hsa-miR-4668-5p SH3BP5L SH3 binding domain protein 5 like HGNC:29360 details
hsa-miR-4668-5p CNKSR3 CNKSR family member 3 HGNC:23034 details
hsa-miR-4668-5p GSTCD glutathione S-transferase C-terminal domain containing HGNC:25806 details
hsa-miR-4668-5p RCC2 regulator of chromosome condensation 2 HGNC:30297 details
hsa-miR-4668-5p LMAN1 lectin, mannose binding 1 HGNC:6631 details
hsa-miR-4668-5p DUSP4 dual specificity phosphatase 4 HGNC:3070 details
hsa-miR-4668-5p SHOX2 short stature homeobox 2 HGNC:10854 details
hsa-miR-4668-5p RAD51B RAD51 paralog B HGNC:9822 details
hsa-miR-4668-5p SMIM19 small integral membrane protein 19 HGNC:25166 details
hsa-miR-4668-5p DPP6 dipeptidyl peptidase like 6 HGNC:3010 details
hsa-miR-4668-5p MED30 mediator complex subunit 30 HGNC:23032 details
hsa-miR-4668-5p ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide HGNC:253 details
hsa-miR-4668-5p DLC1 DLC1 Rho GTPase activating protein HGNC:2897 details
hsa-miR-4668-5p ZNF236 zinc finger protein 236 HGNC:13028 details
hsa-miR-4668-5p RORA RAR related orphan receptor A HGNC:10258 details
hsa-miR-4668-5p KNSTRN kinetochore localized astrin (SPAG5) binding protein HGNC:30767 details
hsa-miR-4668-5p FARSA phenylalanyl-tRNA synthetase subunit alpha HGNC:3592 details
hsa-miR-4668-5p CDCA3 cell division cycle associated 3 HGNC:14624 details
hsa-miR-4668-5p CACNA2D2 calcium voltage-gated channel auxiliary subunit alpha2delta 2 HGNC:1400 details
hsa-miR-4668-5p RAP1GDS1 Rap1 GTPase-GDP dissociation stimulator 1 HGNC:9859 details
hsa-miR-4668-5p PIGS phosphatidylinositol glycan anchor biosynthesis class S HGNC:14937 details
hsa-miR-4668-5p EPB41L4B erythrocyte membrane protein band 4.1 like 4B HGNC:19818 details
hsa-miR-4668-5p TAF12 TATA-box binding protein associated factor 12 HGNC:11545 details
hsa-miR-4668-5p KLHL12 kelch like family member 12 HGNC:19360 details
hsa-miR-4668-5p MORF4L2 mortality factor 4 like 2 HGNC:16849 details
hsa-miR-4668-5p ACADSB acyl-CoA dehydrogenase short/branched chain HGNC:91 details
hsa-miR-4668-5p NEGR1 neuronal growth regulator 1 HGNC:17302 details
hsa-miR-4668-5p MRI1 methylthioribose-1-phosphate isomerase 1 HGNC:28469 details
hsa-miR-4668-5p GABARAP GABA type A receptor-associated protein HGNC:4067 details
hsa-miR-4668-5p GNG3 G protein subunit gamma 3 HGNC:4405 details
hsa-miR-4668-5p SH3RF1 SH3 domain containing ring finger 1 HGNC:17650 details
hsa-miR-4668-5p RBM28 RNA binding motif protein 28 HGNC:21863 details
hsa-miR-4668-5p VPS35 VPS35 retromer complex component HGNC:13487 details
hsa-miR-4668-5p UBXN7 UBX domain protein 7 HGNC:29119 details
hsa-miR-4668-5p UBE4B ubiquitination factor E4B HGNC:12500 details
hsa-miR-4668-5p TNRC6A trinucleotide repeat containing adaptor 6A HGNC:11969 details
hsa-miR-4668-5p TMBIM6 transmembrane BAX inhibitor motif containing 6 HGNC:11723 details
hsa-miR-4668-5p TET3 tet methylcytosine dioxygenase 3 HGNC:28313 details
hsa-miR-4668-5p TBL1XR1 TBL1X receptor 1 HGNC:29529 details
hsa-miR-4668-5p TBC1D2B TBC1 domain family member 2B HGNC:29183 details
hsa-miR-4668-5p SPART spartin HGNC:18514 details
hsa-miR-4668-5p SLC7A5 solute carrier family 7 member 5 HGNC:11063 details
hsa-miR-4668-5p SLC25A36 solute carrier family 25 member 36 HGNC:25554 details
hsa-miR-4668-5p SHOC2 SHOC2 leucine rich repeat scaffold protein HGNC:15454 details
hsa-miR-4668-5p SFT2D2 SFT2 domain containing 2 HGNC:25140 details
hsa-miR-4668-5p RGMB repulsive guidance molecule BMP co-receptor b HGNC:26896 details
hsa-miR-4668-5p PKM pyruvate kinase M1/2 HGNC:9021 details
hsa-miR-4668-5p PDE4D phosphodiesterase 4D HGNC:8783 details
hsa-miR-4668-5p PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 HGNC:8575 details
hsa-miR-4668-5p OGT O-linked N-acetylglucosamine (GlcNAc) transferase HGNC:8127 details
hsa-miR-4668-5p LYN LYN proto-oncogene, Src family tyrosine kinase HGNC:6735 details
hsa-miR-4668-5p LATS2 large tumor suppressor kinase 2 HGNC:6515 details
hsa-miR-4668-5p KLHL28 kelch like family member 28 HGNC:19741 details
hsa-miR-4668-5p IPPK inositol-pentakisphosphate 2-kinase HGNC:14645 details
hsa-miR-4668-5p HDLBP high density lipoprotein binding protein HGNC:4857 details
hsa-miR-4668-5p GTPBP2 GTP binding protein 2 HGNC:4670 details
hsa-miR-4668-5p EFNA1 ephrin A1 HGNC:3221 details
hsa-miR-4668-5p E2F3 E2F transcription factor 3 HGNC:3115 details
hsa-miR-4668-5p E2F2 E2F transcription factor 2 HGNC:3114 details
hsa-miR-4668-5p DPM2 dolichyl-phosphate mannosyltransferase subunit 2, regulatory HGNC:3006 details
hsa-miR-4668-5p DLG5 discs large MAGUK scaffold protein 5 HGNC:2904 details
hsa-miR-4668-5p CDC5L cell division cycle 5 like HGNC:1743 details
hsa-miR-4668-5p NCBP3 nuclear cap binding subunit 3 HGNC:24612 details
hsa-miR-4668-5p BSCL2 BSCL2 lipid droplet biogenesis associated, seipin HGNC:15832 details
hsa-miR-4668-5p BAZ2A bromodomain adjacent to zinc finger domain 2A HGNC:962 details
hsa-miR-4668-5p B4GALT1 beta-1,4-galactosyltransferase 1 HGNC:924 details
hsa-miR-4668-5p AP1S1 adaptor related protein complex 1 subunit sigma 1 HGNC:559 details
hsa-miR-4668-5p TGIF1 TGFB induced factor homeobox 1 HGNC:11776 details
hsa-miR-4668-5p EPN1 epsin 1 HGNC:21604 details
hsa-miR-4668-5p IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-4668-5p CDKN1A cyclin dependent kinase inhibitor 1A HGNC:1784 details
hsa-miR-4668-5p PDRG1 p53 and DNA damage regulated 1 HGNC:16119 details
hsa-miR-4668-5p TAB2 TGF-beta activated kinase 1 (MAP3K7) binding protein 2 HGNC:17075 details
hsa-miR-4668-5p PNRC1 proline rich nuclear receptor coactivator 1 HGNC:17278 details
hsa-miR-4668-5p CCND2 cyclin D2 HGNC:1583 details
hsa-miR-4668-5p ARL5B ADP ribosylation factor like GTPase 5B HGNC:23052 details
hsa-miR-4668-5p AP3M2 adaptor related protein complex 3 subunit mu 2 HGNC:570 details
hsa-miR-4668-5p SLC25A21 solute carrier family 25 member 21 HGNC:14411 details
hsa-miR-4668-5p TMEM164 transmembrane protein 164 HGNC:26217 details
hsa-miR-4668-5p NPM3 nucleophosmin/nucleoplasmin 3 HGNC:7931 details
hsa-miR-4668-5p NF2 neurofibromin 2 HGNC:7773 details
hsa-miR-4668-5p EPHB4 EPH receptor B4 HGNC:3395 details
hsa-miR-4668-5p TERB2 telomere repeat binding bouquet formation protein 2 HGNC:28520 details
hsa-miR-4668-5p SVOP SV2 related protein HGNC:25417 details
hsa-miR-4668-5p RNF44 ring finger protein 44 HGNC:19180 details
hsa-miR-4668-5p TUSC1 tumor suppressor candidate 1 HGNC:31010 details
hsa-miR-4668-5p TOR1AIP2 torsin 1A interacting protein 2 HGNC:24055 details
hsa-miR-4668-5p STMN1 stathmin 1 HGNC:6510 details
hsa-miR-4668-5p PHF12 PHD finger protein 12 HGNC:20816 details
hsa-miR-4668-5p AXIN2 axin 2 HGNC:904 details
hsa-miR-4668-5p SMAD4 SMAD family member 4 HGNC:6770 details
hsa-miR-4668-5p RABGAP1 RAB GTPase activating protein 1 HGNC:17155 details
hsa-miR-4668-5p CENPA centromere protein A HGNC:1851 details
hsa-miR-4668-5p ZNF354B zinc finger protein 354B HGNC:17197 details
hsa-miR-4668-5p MCRIP2 MAPK regulated corepressor interacting protein 2 HGNC:14142 details
hsa-miR-4668-5p UCP1 uncoupling protein 1 HGNC:12517 details
hsa-miR-4668-5p UNG uracil DNA glycosylase HGNC:12572 details
hsa-miR-4668-5p ZNF132 zinc finger protein 132 HGNC:12916 details
hsa-miR-4668-5p INCENP inner centromere protein HGNC:6058 details
hsa-miR-4668-5p SRPX2 sushi repeat containing protein X-linked 2 HGNC:30668 details
hsa-miR-4668-5p ITM2C integral membrane protein 2C HGNC:6175 details
hsa-miR-4668-5p ZNF579 zinc finger protein 579 HGNC:26646 details
hsa-miR-4668-5p CYP4F11 cytochrome P450 family 4 subfamily F member 11 HGNC:13265 details
hsa-miR-4668-5p WASF3 WASP family member 3 HGNC:12734 details
hsa-miR-4668-5p ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 HGNC:689 details
hsa-miR-4668-5p FRK fyn related Src family tyrosine kinase HGNC:3955 details
hsa-miR-4668-5p PPIA peptidylprolyl isomerase A HGNC:9253 details
hsa-miR-4668-5p VSTM5 V-set and transmembrane domain containing 5 HGNC:34443 details
hsa-miR-4668-5p SIAH3 siah E3 ubiquitin protein ligase family member 3 HGNC:30553 details
hsa-miR-4668-5p SREBF1 sterol regulatory element binding transcription factor 1 HGNC:11289 details
hsa-miR-4668-5p NXT2 nuclear transport factor 2 like export factor 2 HGNC:18151 details
hsa-miR-4668-5p details
hsa-miR-4668-5p SEL1L SEL1L adaptor subunit of ERAD E3 ubiquitin ligase HGNC:10717 details
hsa-miR-4668-5p FAM174B family with sequence similarity 174 member B HGNC:34339 details
hsa-miR-4668-5p HCCS holocytochrome c synthase HGNC:4837 details
hsa-miR-4668-5p TTLL5 tubulin tyrosine ligase like 5 HGNC:19963 details
hsa-miR-4668-5p VEGFC vascular endothelial growth factor C HGNC:12682 details
hsa-miR-4668-5p RTTN rotatin HGNC:18654 details
hsa-miR-4668-5p details
hsa-miR-4668-5p HOXA13 homeobox A13 HGNC:5102 details
hsa-miR-4668-5p LDHD lactate dehydrogenase D HGNC:19708 details
hsa-miR-4668-5p WEE1 WEE1 G2 checkpoint kinase HGNC:12761 details
hsa-miR-4668-5p TRPS1 transcriptional repressor GATA binding 1 HGNC:12340 details
hsa-miR-4668-5p TNFRSF13C TNF receptor superfamily member 13C HGNC:17755 details
hsa-miR-4668-5p SNX33 sorting nexin 33 HGNC:28468 details
hsa-miR-4668-5p QSER1 glutamine and serine rich 1 HGNC:26154 details
hsa-miR-4668-5p MELK maternal embryonic leucine zipper kinase HGNC:16870 details
hsa-miR-4668-5p DPP8 dipeptidyl peptidase 8 HGNC:16490 details
hsa-miR-4668-5p C5orf51 chromosome 5 open reading frame 51 HGNC:27750 details
hsa-miR-4668-5p C17orf75 chromosome 17 open reading frame 75 HGNC:30173 details
hsa-miR-4668-5p ANP32E acidic nuclear phosphoprotein 32 family member E HGNC:16673 details
hsa-miR-4668-5p HMGN2 high mobility group nucleosomal binding domain 2 HGNC:4986 details
hsa-miR-4668-5p PEX7 peroxisomal biogenesis factor 7 HGNC:8860 details
hsa-miR-4668-5p METTL8 methyltransferase 8, methylcytidine HGNC:25856 details
hsa-miR-4668-5p PPIL1 peptidylprolyl isomerase like 1 HGNC:9260 details
hsa-miR-4668-5p LRIF1 ligand dependent nuclear receptor interacting factor 1 HGNC:30299 details
hsa-miR-4668-5p VANGL2 VANGL planar cell polarity protein 2 HGNC:15511 details
hsa-miR-4668-5p INTU inturned planar cell polarity protein HGNC:29239 details
hsa-miR-4668-5p RFTN2 raftlin family member 2 HGNC:26402 details
hsa-miR-4668-5p EIF4A3 eukaryotic translation initiation factor 4A3 HGNC:18683 details
hsa-miR-4668-5p ZNF608 zinc finger protein 608 HGNC:29238 details
hsa-miR-4668-5p ZFP91 ZFP91 zinc finger protein, atypical E3 ubiquitin ligase HGNC:14983 details
hsa-miR-4668-5p XKR4 XK related 4 HGNC:29394 details
hsa-miR-4668-5p PPP1CB protein phosphatase 1 catalytic subunit beta HGNC:9282 details
hsa-miR-4668-5p MAZ MYC associated zinc finger protein HGNC:6914 details
hsa-miR-4668-5p LCOR ligand dependent nuclear receptor corepressor HGNC:29503 details
hsa-miR-4668-5p ETV3 ETS variant transcription factor 3 HGNC:3492 details
hsa-miR-4668-5p CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 HGNC:105 details
hsa-miR-4668-5p AKAP11 A-kinase anchoring protein 11 HGNC:369 details
hsa-miR-4668-5p MYC MYC proto-oncogene, bHLH transcription factor HGNC:7553 details
hsa-miR-4668-5p WNK3 WNK lysine deficient protein kinase 3 HGNC:14543 details
hsa-miR-4668-5p TBRG1 transforming growth factor beta regulator 1 HGNC:29551 details
hsa-miR-4668-5p SOX6 SRY-box transcription factor 6 HGNC:16421 details
hsa-miR-4668-5p GNPTAB N-acetylglucosamine-1-phosphate transferase subunits alpha and beta HGNC:29670 details
hsa-miR-4668-5p EXT1 exostosin glycosyltransferase 1 HGNC:3512 details
hsa-miR-4668-5p CRCP CGRP receptor component HGNC:17888 details
hsa-miR-4668-5p SINHCAF SIN3-HDAC complex associated factor HGNC:30702 details
hsa-miR-4668-5p ENSA endosulfine alpha HGNC:3360 details
hsa-miR-4668-5p RRP7A ribosomal RNA processing 7 homolog A HGNC:24286 details
hsa-miR-4668-5p PDPK1 3-phosphoinositide dependent protein kinase 1 HGNC:8816 details
hsa-miR-4668-5p RAD54L2 RAD54 like 2 HGNC:29123 details
hsa-miR-4668-5p PTP4A1 protein tyrosine phosphatase 4A1 HGNC:9634 details
hsa-miR-4668-5p LRRC8B leucine rich repeat containing 8 VRAC subunit B HGNC:30692 details
hsa-miR-4668-5p RAB6A RAB6A, member RAS oncogene family HGNC:9786 details
hsa-miR-4668-5p details
hsa-miR-4668-5p MOCS3 molybdenum cofactor synthesis 3 HGNC:15765 details
hsa-miR-4668-5p VIM vimentin HGNC:12692 details
hsa-miR-4668-5p UBE3C ubiquitin protein ligase E3C HGNC:16803 details
hsa-miR-4668-5p SP1 Sp1 transcription factor HGNC:11205 details
hsa-miR-4668-5p REST RE1 silencing transcription factor HGNC:9966 details
hsa-miR-4668-5p NFYA nuclear transcription factor Y subunit alpha HGNC:7804 details
hsa-miR-4668-5p NACC2 NACC family member 2 HGNC:23846 details
hsa-miR-4668-5p MORF4L1 mortality factor 4 like 1 HGNC:16989 details
hsa-miR-4668-5p LMAN2 lectin, mannose binding 2 HGNC:16986 details
hsa-miR-4668-5p KCNB1 potassium voltage-gated channel subfamily B member 1 HGNC:6231 details
hsa-miR-4668-5p FCHSD2 FCH and double SH3 domains 2 HGNC:29114 details
hsa-miR-4668-5p TMEM167A transmembrane protein 167A HGNC:28330 details
hsa-miR-4668-5p USP45 ubiquitin specific peptidase 45 HGNC:20080 details
hsa-miR-4668-5p ZNF746 zinc finger protein 746 HGNC:21948 details
hsa-miR-4668-5p RBM12B RNA binding motif protein 12B HGNC:32310 details
hsa-miR-4668-5p UBE2H ubiquitin conjugating enzyme E2 H HGNC:12484 details
hsa-miR-4668-5p USP15 ubiquitin specific peptidase 15 HGNC:12613 details
hsa-miR-4668-5p SCD stearoyl-CoA desaturase HGNC:10571 details
hsa-miR-4668-5p MKNK2 MAPK interacting serine/threonine kinase 2 HGNC:7111 details
hsa-miR-4668-5p MYO1C myosin IC HGNC:7597 details
hsa-miR-4668-5p TRIM21 tripartite motif containing 21 HGNC:11312 details
hsa-miR-4668-5p SLC24A4 solute carrier family 24 member 4 HGNC:10978 details
hsa-miR-4668-5p VPS50 VPS50 subunit of EARP/GARPII complex HGNC:25956 details
hsa-miR-4668-5p ZNF229 zinc finger protein 229 HGNC:13022 details
hsa-miR-4668-5p FGF2 fibroblast growth factor 2 HGNC:3676 details
hsa-miR-4668-5p ZNF581 zinc finger protein 581 HGNC:25017 details
hsa-miR-4668-5p PMPCA peptidase, mitochondrial processing subunit alpha HGNC:18667 details
hsa-miR-4668-5p NAV2 neuron navigator 2 HGNC:15997 details
hsa-miR-4668-5p MAT2A methionine adenosyltransferase 2A HGNC:6904 details
hsa-miR-4668-5p EDIL3 EGF like repeats and discoidin domains 3 HGNC:3173 details
hsa-miR-4668-5p ZYG11B zyg-11 family member B, cell cycle regulator HGNC:25820 details
hsa-miR-4668-5p PDGFRA platelet derived growth factor receptor alpha HGNC:8803 details
hsa-miR-4668-5p CDKN2AIPNL CDKN2A interacting protein N-terminal like HGNC:30545 details
hsa-miR-4668-5p XRCC2 X-ray repair cross complementing 2 HGNC:12829 details
hsa-miR-4668-5p TM4SF20 transmembrane 4 L six family member 20 HGNC:26230 details
hsa-miR-4668-5p LIX1 limb and CNS expressed 1 HGNC:18581 details
hsa-miR-4668-5p SDC1 syndecan 1 HGNC:10658 details
hsa-miR-4668-5p ZBTB10 zinc finger and BTB domain containing 10 HGNC:30953 details
hsa-miR-4668-5p DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 HGNC:24013 details
hsa-miR-4668-5p PHACTR2 phosphatase and actin regulator 2 HGNC:20956 details
hsa-miR-4668-5p DLG4 discs large MAGUK scaffold protein 4 HGNC:2903 details
hsa-miR-4668-5p CCNF cyclin F HGNC:1591 details
hsa-miR-4668-5p SLC35C2 solute carrier family 35 member C2 HGNC:17117 details
hsa-miR-4668-5p PRIM1 DNA primase subunit 1 HGNC:9369 details
hsa-miR-4668-5p PSMD11 proteasome 26S subunit, non-ATPase 11 HGNC:9556 details
hsa-miR-4668-5p FAM117B family with sequence similarity 117 member B HGNC:14440 details
hsa-miR-4668-5p ACTR10 actin related protein 10 HGNC:17372 details
hsa-miR-4668-5p RASGEF1B RasGEF domain family member 1B HGNC:24881 details
hsa-miR-4668-5p PARD6B par-6 family cell polarity regulator beta HGNC:16245 details
hsa-miR-4668-5p SH3BP2 SH3 domain binding protein 2 HGNC:10825 details
hsa-miR-4668-5p ORAI1 ORAI calcium release-activated calcium modulator 1 HGNC:25896 details
hsa-miR-4668-5p HECTD1 HECT domain E3 ubiquitin protein ligase 1 HGNC:20157 details
hsa-miR-4668-5p SPIC Spi-C transcription factor HGNC:29549 details
hsa-miR-4668-5p SOD2 superoxide dismutase 2 HGNC:11180 details
hsa-miR-4668-5p ZNF713 zinc finger protein 713 HGNC:22043 details
hsa-miR-4668-5p IGSF11 immunoglobulin superfamily member 11 HGNC:16669 details
hsa-miR-4668-5p ZNF568 zinc finger protein 568 HGNC:25392 details
hsa-miR-4668-5p MCOLN3 mucolipin TRP cation channel 3 HGNC:13358 details
hsa-miR-4668-5p PLXNA3 plexin A3 HGNC:9101 details
hsa-miR-4668-5p ATAT1 alpha tubulin acetyltransferase 1 HGNC:21186 details
hsa-miR-4668-5p CWF19L1 CWF19 like cell cycle control factor 1 HGNC:25613 details
hsa-miR-4668-5p TMEM220 transmembrane protein 220 HGNC:33757 details
hsa-miR-4668-5p SRFBP1 serum response factor binding protein 1 HGNC:26333 details
hsa-miR-4668-5p NRIP2 nuclear receptor interacting protein 2 HGNC:23078 details
hsa-miR-4668-5p ALYREF Aly/REF export factor HGNC:19071 details
hsa-miR-4668-5p LACC1 laccase domain containing 1 HGNC:26789 details
hsa-miR-4668-5p TFDP3 transcription factor Dp family member 3 HGNC:24603 details
hsa-miR-4668-5p CFAP65 cilia and flagella associated protein 65 HGNC:25325 details
hsa-miR-4668-5p POLR2D RNA polymerase II subunit D HGNC:9191 details
hsa-miR-4668-5p TM4SF5 transmembrane 4 L six family member 5 HGNC:11857 details
hsa-miR-4668-5p ITGB8 integrin subunit beta 8 HGNC:6163 details
hsa-miR-4668-5p ITGA3 integrin subunit alpha 3 HGNC:6139 details
hsa-miR-4668-5p UNC45B unc-45 myosin chaperone B HGNC:14304 details
hsa-miR-4668-5p TNPO1 transportin 1 HGNC:6401 details
hsa-miR-4668-5p STK17B serine/threonine kinase 17b HGNC:11396 details
hsa-miR-4668-5p SEH1L SEH1 like nucleoporin HGNC:30379 details
hsa-miR-4668-5p SEC63 SEC63 homolog, protein translocation regulator HGNC:21082 details
hsa-miR-4668-5p SALL3 spalt like transcription factor 3 HGNC:10527 details
hsa-miR-4668-5p PPM1K protein phosphatase, Mg2+/Mn2+ dependent 1K HGNC:25415 details
hsa-miR-4668-5p PCNT pericentrin HGNC:16068 details
hsa-miR-4668-5p NAA15 N-alpha-acetyltransferase 15, NatA auxiliary subunit HGNC:30782 details
hsa-miR-4668-5p MAX MYC associated factor X HGNC:6913 details
hsa-miR-4668-5p HS3ST5 heparan sulfate-glucosamine 3-sulfotransferase 5 HGNC:19419 details
hsa-miR-4668-5p HAPLN1 hyaluronan and proteoglycan link protein 1 HGNC:2380 details
hsa-miR-4668-5p GK5 glycerol kinase 5 HGNC:28635 details
hsa-miR-4668-5p FICD FIC domain protein adenylyltransferase HGNC:18416 details
hsa-miR-4668-5p FGF12 fibroblast growth factor 12 HGNC:3668 details
hsa-miR-4668-5p FBN2 fibrillin 2 HGNC:3604 details
hsa-miR-4668-5p FAM104A family with sequence similarity 104 member A HGNC:25918 details
hsa-miR-4668-5p CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 HGNC:25248 details
hsa-miR-4668-5p CNOT6L CCR4-NOT transcription complex subunit 6 like HGNC:18042 details
hsa-miR-4668-5p CISD1 CDGSH iron sulfur domain 1 HGNC:30880 details
hsa-miR-4668-5p STMP1 short transmembrane mitochondrial protein 1 HGNC:41909 details
hsa-miR-4668-5p AR androgen receptor HGNC:644 details
hsa-miR-4668-5p ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 HGNC:16469 details
hsa-miR-4668-5p USP6NL USP6 N-terminal like HGNC:16858 details
hsa-miR-4668-5p OGFOD1 2-oxoglutarate and iron dependent oxygenase domain containing 1 HGNC:25585 details
hsa-miR-4668-5p ZNF619 zinc finger protein 619 HGNC:26910 details
hsa-miR-4668-5p TAPBP TAP binding protein HGNC:11566 details
hsa-miR-4668-5p RMDN1 regulator of microtubule dynamics 1 HGNC:24285 details
hsa-miR-4668-5p TP73 tumor protein p73 HGNC:12003 details
hsa-miR-4668-5p PAQR7 progestin and adipoQ receptor family member 7 HGNC:23146 details
hsa-miR-4668-5p GBP6 guanylate binding protein family member 6 HGNC:25395 details
hsa-miR-4668-5p ABCC9 ATP binding cassette subfamily C member 9 HGNC:60 details
hsa-miR-4668-5p ZMYM6 zinc finger MYM-type containing 6 HGNC:13050 details
hsa-miR-4668-5p SLC19A1 solute carrier family 19 member 1 HGNC:10937 details
hsa-miR-4668-5p SNRPD1 small nuclear ribonucleoprotein D1 polypeptide HGNC:11158 details
hsa-miR-4668-5p TSC1 TSC complex subunit 1 HGNC:12362 details
hsa-miR-4668-5p DRAM2 DNA damage regulated autophagy modulator 2 HGNC:28769 details
hsa-miR-4668-5p FECH ferrochelatase HGNC:3647 details
hsa-miR-4668-5p PRDM2 PR/SET domain 2 HGNC:9347 details
hsa-miR-4668-5p ZBTB3 zinc finger and BTB domain containing 3 HGNC:22918 details
hsa-miR-4668-5p WIPF2 WAS/WASL interacting protein family member 2 HGNC:30923 details
hsa-miR-4668-5p STRIP2 striatin interacting protein 2 HGNC:22209 details
hsa-miR-4668-5p SP4 Sp4 transcription factor HGNC:11209 details
hsa-miR-4668-5p SLC44A1 solute carrier family 44 member 1 HGNC:18798 details
hsa-miR-4668-5p RAB30 RAB30, member RAS oncogene family HGNC:9770 details
hsa-miR-4668-5p PRR3 proline rich 3 HGNC:21149 details
hsa-miR-4668-5p MEF2C myocyte enhancer factor 2C HGNC:6996 details
hsa-miR-4668-5p LIMD1 LIM domain containing 1 HGNC:6612 details
hsa-miR-4668-5p CNN3 calponin 3 HGNC:2157 details
hsa-miR-4668-5p CCDC117 coiled-coil domain containing 117 HGNC:26599 details
hsa-miR-4668-5p ZMYM1 zinc finger MYM-type containing 1 HGNC:26253 details
hsa-miR-4668-5p details
hsa-miR-4668-5p B3GNT7 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7 HGNC:18811 details
hsa-miR-4668-5p ACER2 alkaline ceramidase 2 HGNC:23675 details
hsa-miR-4668-5p SLC30A4 solute carrier family 30 member 4 HGNC:11015 details
hsa-miR-4668-5p INTS7 integrator complex subunit 7 HGNC:24484 details
hsa-miR-4668-5p CPT1B carnitine palmitoyltransferase 1B HGNC:2329 details
hsa-miR-4668-5p TRIM14 tripartite motif containing 14 HGNC:16283 details
hsa-miR-4668-5p AP1M1 adaptor related protein complex 1 subunit mu 1 HGNC:13667 details
hsa-miR-4668-5p KCNK6 potassium two pore domain channel subfamily K member 6 HGNC:6281 details
hsa-miR-4668-5p TRAPPC8 trafficking protein particle complex subunit 8 HGNC:29169 details
hsa-miR-4668-5p SIN3A SIN3 transcription regulator family member A HGNC:19353 details
hsa-miR-4668-5p MTX3 metaxin 3 HGNC:24812 details
hsa-miR-4668-5p MMS22L MMS22 like, DNA repair protein HGNC:21475 details
hsa-miR-4668-5p METTL1 methyltransferase 1, tRNA methylguanosine HGNC:7030 details
hsa-miR-4668-5p GJD3 gap junction protein delta 3 HGNC:19147 details
hsa-miR-4668-5p CLSPN claspin HGNC:19715 details
hsa-miR-4668-5p DYRK4 dual specificity tyrosine phosphorylation regulated kinase 4 HGNC:3095 details
hsa-miR-4668-5p EEF1AKMT2 EEF1A lysine methyltransferase 2 HGNC:33787 details
hsa-miR-4668-5p details
hsa-miR-4668-5p RFX3 regulatory factor X3 HGNC:9984 details
hsa-miR-4668-5p RAP2B RAP2B, member of RAS oncogene family HGNC:9862 details
hsa-miR-4668-5p KCTD11 potassium channel tetramerization domain containing 11 HGNC:21302 details
hsa-miR-4668-5p DR1 down-regulator of transcription 1 HGNC:3017 details
hsa-miR-4668-5p KCNE4 potassium voltage-gated channel subfamily E regulatory subunit 4 HGNC:6244 details
hsa-miR-4668-5p TRPM6 transient receptor potential cation channel subfamily M member 6 HGNC:17995 details
hsa-miR-4668-5p CPM carboxypeptidase M HGNC:2311 details
hsa-miR-4668-5p TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D HGNC:28759 details
hsa-miR-4668-5p TUFT1 tuftelin 1 HGNC:12422 details
hsa-miR-4668-5p KHSRP KH-type splicing regulatory protein HGNC:6316 details
hsa-miR-4668-5p CYB561 cytochrome b561 HGNC:2571 details
hsa-miR-4668-5p LYZ lysozyme HGNC:6740 details
hsa-miR-4668-5p TGFBR1 transforming growth factor beta receptor 1 HGNC:11772 details
hsa-miR-4668-5p OCRL OCRL inositol polyphosphate-5-phosphatase HGNC:8108 details
hsa-miR-4668-5p KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 HGNC:6304 details
hsa-miR-4668-5p CD46 CD46 molecule HGNC:6953 details
hsa-miR-4668-5p MC2R melanocortin 2 receptor HGNC:6930 details
hsa-miR-4668-5p details
hsa-miR-4668-5p SPATS2 spermatogenesis associated serine rich 2 HGNC:18650 details
hsa-miR-4668-5p GEN1 GEN1 Holliday junction 5' flap endonuclease HGNC:26881 details
hsa-miR-4668-5p KRTAP6-1 keratin associated protein 6-1 HGNC:18931 details
hsa-miR-4668-5p USF3 upstream transcription factor family member 3 HGNC:30494 details
hsa-miR-4668-5p ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-4668-5p RASL11A RAS like family 11 member A HGNC:23802 details
hsa-miR-4668-5p RPL24 ribosomal protein L24 HGNC:10325 details
hsa-miR-4668-5p SESTD1 SEC14 and spectrin domain containing 1 HGNC:18379 details
hsa-miR-4668-5p CBY3 chibby family member 3 HGNC:33278 details
hsa-miR-4668-5p MPEG1 macrophage expressed 1 HGNC:29619 details
hsa-miR-4668-5p details
hsa-miR-4668-5p AVL9 AVL9 cell migration associated HGNC:28994 details
hsa-miR-4668-5p TMED10 transmembrane p24 trafficking protein 10 HGNC:16998 details
hsa-miR-4668-5p WTIP WT1 interacting protein HGNC:20964 details
hsa-miR-4668-5p PARVB parvin beta HGNC:14653 details
hsa-miR-4668-5p AGTRAP angiotensin II receptor associated protein HGNC:13539 details
hsa-miR-4668-5p ARGLU1 arginine and glutamate rich 1 HGNC:25482 details
hsa-miR-4668-5p ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 HGNC:18803 details
hsa-miR-4668-5p CFL1 cofilin 1 HGNC:1874 details
hsa-miR-4668-5p CHD3 chromodomain helicase DNA binding protein 3 HGNC:1918 details
hsa-miR-4668-5p CLDN4 claudin 4 HGNC:2046 details
hsa-miR-4668-5p ELL elongation factor for RNA polymerase II HGNC:23114 details
hsa-miR-4668-5p GAN gigaxonin HGNC:4137 details
hsa-miR-4668-5p GPR183 G protein-coupled receptor 183 HGNC:3128 details
hsa-miR-4668-5p GPR61 G protein-coupled receptor 61 HGNC:13300 details
hsa-miR-4668-5p HDGF heparin binding growth factor HGNC:4856 details
hsa-miR-4668-5p HMGB1 high mobility group box 1 HGNC:4983 details
hsa-miR-4668-5p LMNB2 lamin B2 HGNC:6638 details
hsa-miR-4668-5p MAOB monoamine oxidase B HGNC:6834 details
hsa-miR-4668-5p MLF2 myeloid leukemia factor 2 HGNC:7126 details
hsa-miR-4668-5p PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma HGNC:23786 details
hsa-miR-4668-5p SLC25A6 solute carrier family 25 member 6 HGNC:10992 details
hsa-miR-4668-5p STK4 serine/threonine kinase 4 HGNC:11408 details
hsa-miR-4668-5p AP5S1 adaptor related protein complex 5 subunit sigma 1 HGNC:15875 details
hsa-miR-4668-5p CALM1 calmodulin 1 HGNC:1442 details
hsa-miR-4668-5p CARD8 caspase recruitment domain family member 8 HGNC:17057 details
hsa-miR-4668-5p DCLK2 doublecortin like kinase 2 HGNC:19002 details
hsa-miR-4668-5p FEM1A fem-1 homolog A HGNC:16934 details
hsa-miR-4668-5p FHL2 four and a half LIM domains 2 HGNC:3703 details
hsa-miR-4668-5p FLCN folliculin HGNC:27310 details
hsa-miR-4668-5p FOXA1 forkhead box A1 HGNC:5021 details
hsa-miR-4668-5p GPR37L1 G protein-coupled receptor 37 like 1 HGNC:14923 details
hsa-miR-4668-5p GRK2 G protein-coupled receptor kinase 2 HGNC:289 details
hsa-miR-4668-5p HACD2 3-hydroxyacyl-CoA dehydratase 2 HGNC:9640 details
hsa-miR-4668-5p KLHL18 kelch like family member 18 HGNC:29120 details
hsa-miR-4668-5p KRTAP5-4 keratin associated protein 5-4 HGNC:23599 details
hsa-miR-4668-5p MDM4 MDM4 regulator of p53 HGNC:6974 details
hsa-miR-4668-5p NEK2 NIMA related kinase 2 HGNC:7745 details
hsa-miR-4668-5p PCBD1 pterin-4 alpha-carbinolamine dehydratase 1 HGNC:8646 details
hsa-miR-4668-5p PDF peptide deformylase, mitochondrial HGNC:30012 details
hsa-miR-4668-5p POU4F1 POU class 4 homeobox 1 HGNC:9218 details
hsa-miR-4668-5p PXMP4 peroxisomal membrane protein 4 HGNC:15920 details
hsa-miR-4668-5p SLC24A3 solute carrier family 24 member 3 HGNC:10977 details
hsa-miR-4668-5p TACO1 translational activator of cytochrome c oxidase I HGNC:24316 details
hsa-miR-4668-5p TAF13 TATA-box binding protein associated factor 13 HGNC:11546 details
hsa-miR-4668-5p TMEM65 transmembrane protein 65 HGNC:25203 details
hsa-miR-4668-5p USF1 upstream transcription factor 1 HGNC:12593 details
hsa-miR-4668-5p USP2 ubiquitin specific peptidase 2 HGNC:12618 details
hsa-miR-4668-5p ZNF557 zinc finger protein 557 HGNC:28632 details
hsa-miR-4668-5p BCL10 BCL10 immune signaling adaptor HGNC:989 details
hsa-miR-4668-5p FAM118A family with sequence similarity 118 member A HGNC:1313 details
hsa-miR-4668-5p details
hsa-miR-4668-5p FUT11 fucosyltransferase 11 HGNC:19233 details
hsa-miR-4668-5p KIAA0895L KIAA0895 like HGNC:34408 details
hsa-miR-4668-5p LDB1 LIM domain binding 1 HGNC:6532 details
hsa-miR-4668-5p PPARGC1A PPARG coactivator 1 alpha HGNC:9237 details
hsa-miR-4668-5p SET SET nuclear proto-oncogene HGNC:10760 details
hsa-miR-4668-5p ZNF284 zinc finger protein 284 HGNC:13078 details
hsa-miR-4668-5p ZNF730 zinc finger protein 730 HGNC:32470 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab