miRNA Card

miRNA General Information
miRNA ID hsa-miR-4684-5p
Description Homo sapiens miR-4684 stem-loop
Comment None
Experiment Illumina [1]
Sequence CUCUCUACUGACUUGCAACAUA
miRNA Expression in different cancers

    by mir_boxplot.py


circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr8:144844789|144844911 hsa-miR-4684-5p 1 0 0
chr3:52523911|52524017 hsa-miR-4684-5p 0 1 0
chr7:100099386|100099711 hsa-miR-4684-5p 0 1 0
chr11:62792494|62792701 hsa-miR-4684-5p 0 1 0
chr20:441608|441936 hsa-miR-4684-5p 0 1 0
chr3:123700374|123700550 hsa-miR-4684-5p 0 1 0
chr6:79307111|79307264 hsa-miR-4684-5p 0 1 0
chr13:113323032|113323152 hsa-miR-4684-5p 0 1 0
chr19:1038215|1038354 hsa-miR-4684-5p 0 1 0
chr16:84907969|84908055 hsa-miR-4684-5p 0 1 0
chr13:113323003|113323152 hsa-miR-4684-5p 0 1 0
chr21:34517648|34517775 hsa-miR-4684-5p 0 1 0
chr12:6730783|6731154 hsa-miR-4684-5p 0 1 0
chr13:113322994|113323152 hsa-miR-4684-5p 0 1 0
chrX:129805660|129805756 hsa-miR-4684-5p 0 1 0
chr10:102161865|102162239 hsa-miR-4684-5p 0 1 0
chr6:152092137|152092260 hsa-miR-4684-5p 0 1 0
chr21:34517648|34517758 hsa-miR-4684-5p 0 1 0
chr12:57602055|57602209 hsa-miR-4684-5p 0 1 0
chr15:40979461|40979559 hsa-miR-4684-5p 0 1 0
chr3:123700366|123700550 hsa-miR-4684-5p 0 1 0
chr11:63997493|63997601 hsa-miR-4684-5p 0 1 0
chr12:57602069|57602209 hsa-miR-4684-5p 0 1 0
chr11:72007189|72007412 hsa-miR-4684-5p 0 1 0
chr1:201485482|201485569 hsa-miR-4684-5p 0 1 0
chr1:66373438|66373560 hsa-miR-4684-5p 1 0 0
chr12:6537860|6538234 hsa-miR-4684-5p 1 0 0
chr12:57721217|57721313 hsa-miR-4684-5p 0 1 0
chr3:33143302|33143509 hsa-miR-4684-5p 0 1 0
chrX:71121125|71121423 hsa-miR-4684-5p 0 1 0
chr1:205144952|205145108 hsa-miR-4684-5p 0 1 0
chr11:120485504|120485625 hsa-miR-4684-5p 0 1 0
chr1:119913992|119914087 hsa-miR-4684-5p 0 1 0
chr14:102039130|102039241 hsa-miR-4684-5p 0 1 0
chr11:63997484|63997609 hsa-miR-4684-5p 0 1 0
chr4:41650421|41650555 hsa-miR-4684-5p 0 1 0
chr1:161037714|161037938 hsa-miR-4684-5p 0 1 0
chr20:32166927|32167052 hsa-miR-4684-5p 0 1 0
chr18:62306597|62306742 hsa-miR-4684-5p 0 1 0
chr14:92941238|92941373 hsa-miR-4684-5p 0 1 0
chr21:34517648|34517753 hsa-miR-4684-5p 0 1 0
chr1:22661039|22661242 hsa-miR-4684-5p 0 1 0
chr11:9812532|9812699 hsa-miR-4684-5p 0 1 0
chr12:50222259|50222452 hsa-miR-4684-5p 0 1 0
chr1:228098545|228098744 hsa-miR-4684-5p 0 1 0
chr14:102039119|102039254 hsa-miR-4684-5p 0 1 0
chr3:172505809|172505973 hsa-miR-4684-5p 0 1 0
chr1:39483326|39483446 hsa-miR-4684-5p 0 1 0
chr7:156681221|156681395 hsa-miR-4684-5p 0 1 0
chr19:54145775|54146043 hsa-miR-4684-5p 0 1 0
chr21:34517648|34517728 hsa-miR-4684-5p 0 1 0
chr14:102039117|102039254 hsa-miR-4684-5p 0 1 0
chr5:177299433|177299582 hsa-miR-4684-5p 0 1 0
chr15:29747054|29747220 hsa-miR-4684-5p 0 1 0
chr8:23444456|23444573 hsa-miR-4684-5p 0 1 0
chr12:57721105|57721288 hsa-miR-4684-5p 0 1 0
chr2:202559732|202559821 hsa-miR-4684-5p 0 1 0
chr5:138558613|138559997 hsa-miR-4684-5p 0 1 0
chr3:50365706|50365881 hsa-miR-4684-5p 0 1 0
chr21:34517645|34517802 hsa-miR-4684-5p 0 1 0
chrX:118792409|118792575 hsa-miR-4684-5p 0 1 0
chrX:101494220|101494479 hsa-miR-4684-5p 0 1 0
chr19:30012283|30012445 hsa-miR-4684-5p 0 1 0
chr14:105587312|105587620 hsa-miR-4684-5p 0 1 0
chr11:48167877|48168070 hsa-miR-4684-5p 0 1 0
chr15:29766358~29766487 hsa-miR-4684-5p 0 1 0
chr5:138468090|138468224 hsa-miR-4684-5p 0 1 0
chr1:228098453~228098744 hsa-miR-4684-5p 0 1 0
chr2:235055051~235055245 hsa-miR-4684-5p 0 1 0
chr4:1981772~1981958 hsa-miR-4684-5p 0 1 0
chr13:113323032~113323152 hsa-miR-4684-5p 0 1 0
chr16:15409236~15409404 hsa-miR-4684-5p 0 1 0
chr18:62084047~62084277 hsa-miR-4684-5p 0 1 0
chr14:105770669~105770796 hsa-miR-4684-5p 0 1 0
chr17:63695528~63695666 hsa-miR-4684-5p 0 1 0
chr13:113323003~113323152 hsa-miR-4684-5p 0 1 0
chr20:480620~480747 hsa-miR-4684-5p 0 1 0
chr19:49340859~49340995 hsa-miR-4684-5p 0 1 0
chr11:72091451~72091551 hsa-miR-4684-5p 0 1 0
chr20:32167026|32167128 hsa-miR-4684-5p 0 1 0
chr6:127287349~127287461 hsa-miR-4684-5p 0 1 0
chr16:68227978~68228094 hsa-miR-4684-5p 0 1 0
chr7:76505829~76505955 hsa-miR-4684-5p 0 1 0
chr12:57721097~57721308 hsa-miR-4684-5p 0 1 0
chr14:102039121~102039254 hsa-miR-4684-5p 0 1 0
chr6:31509957~31510119 hsa-miR-4684-5p 0 1 0
chr19:10112702~10112877 hsa-miR-4684-5p 0 1 0
chr14:102039119~102039258 hsa-miR-4684-5p 0 1 0
chr16:84907969~84908055 hsa-miR-4684-5p 0 1 0
chr16:11180537~11180650 hsa-miR-4684-5p 0 1 0
chrX:129805660~129805756 hsa-miR-4684-5p 0 1 0
chrX:129805603~129805821 hsa-miR-4684-5p 0 1 0
chr13:113323040~113323152 hsa-miR-4684-5p 0 1 0
chr15:40979461~40979559 hsa-miR-4684-5p 0 1 0
chr13:113323040|113323152 hsa-miR-4684-5p 0 1 0
chr20:32167026~32167128 hsa-miR-4684-5p 0 1 0
chr21:34517648~34517802 hsa-miR-4684-5p 0 1 0
chr6:33201624~33201853 hsa-miR-4684-5p 0 1 0
chr7:156681210~156681380 hsa-miR-4684-5p 0 1 0
chr1:54850844~54851069 hsa-miR-4684-5p 0 1 0
chr2:219247142~219247476 hsa-miR-4684-5p 0 1 0
chr22:38738316~38738547 hsa-miR-4684-5p 0 1 0
chr1:15056133~15056280 hsa-miR-4684-5p 0 1 0
chr13:113323042~113323206 hsa-miR-4684-5p 0 1 0
chr15:92618906~92619090 hsa-miR-4684-5p 0 1 0
chr17:2680407|2680603 hsa-miR-4684-5p 1 0 0
chr1:167700883|167701006 hsa-miR-4684-5p 0 1 0
chr12:51051481|51051636 hsa-miR-4684-5p 0 1 0
chr13:49631610|49631734 hsa-miR-4684-5p 0 1 0
chr20:32166945|32167069 hsa-miR-4684-5p 0 1 0
chr6:35344746|35344980 hsa-miR-4684-5p 0 1 0
chr21:29502385|29502525 hsa-miR-4684-5p 0 1 0
chr15:50048477|50048643 hsa-miR-4684-5p 0 1 0
chr11:83179673|83179820 hsa-miR-4684-5p 0 1 0
chr3:53173641|53173877 hsa-miR-4684-5p 0 1 0
chr2:218252492|218252698 hsa-miR-4684-5p 0 1 0
chr4:24529623|24529748 hsa-miR-4684-5p 0 1 0
chr1:156211741|156211818 hsa-miR-4684-5p 0 1 0
chr9:131138751|131138981 hsa-miR-4684-5p 0 1 0
chr8:67061962|67062063 hsa-miR-4684-5p 0 1 0
chr7:66112127|66112260 hsa-miR-4684-5p 0 1 0
chr5:138940279|138940371 hsa-miR-4684-5p 0 1 0
chr2:27042658|27042845 hsa-miR-4684-5p 0 1 0
chr1:33272497|33272581 hsa-miR-4684-5p 0 1 0
chr11:63997451|63997609 hsa-miR-4684-5p 0 1 0
chr5:138468137|138468231 hsa-miR-4684-5p 0 1 0
chr11:14799581|14799713 hsa-miR-4684-5p 1 0 0
chr1:22661114|22661333 hsa-miR-4684-5p 0 1 0
chr17:1501706|1501905 hsa-miR-4684-5p 0 1 0
chr3:49502500|49502627 hsa-miR-4684-5p 0 1 0
chr2:233208989|233209117 hsa-miR-4684-5p 0 1 0
chr19:13834651|13834845 hsa-miR-4684-5p 0 1 0
chr17:35407476|35407670 hsa-miR-4684-5p 0 1 0
chr4:5014934|5015063 hsa-miR-4684-5p 0 1 0
chr9:85566315|85566459 hsa-miR-4684-5p 0 1 0
chr5:179802681|179802876 hsa-miR-4684-5p 0 1 0
chr1:151366842|151367015 hsa-miR-4684-5p 0 1 0
chr12:131929411|131929558 hsa-miR-4684-5p 0 1 0
chr19:54458390|54458495 hsa-miR-4684-5p 0 1 0
chr7:100099334|100099731 hsa-miR-4684-5p 0 1 0
chr1:40789230|40789352 hsa-miR-4684-5p 0 1 0
chr18:45875004|45875168 hsa-miR-4684-5p 0 1 0
chr17:4542913|4543074 hsa-miR-4684-5p 0 1 0
chr16:67583460|67583616 hsa-miR-4684-5p 0 1 0
chr11:63997484|63997620 hsa-miR-4684-5p 0 1 0
chr14:105253316|105253540 hsa-miR-4684-5p 0 1 0
chr6:33453509|33453643 hsa-miR-4684-5p 1 0 0
chr2:174348422|174348655 hsa-miR-4684-5p 1 0 0
chr10:110119308|110119520 hsa-miR-4684-5p 1 0 0
chr2:174348422|174348535 hsa-miR-4684-5p 1 0 0
chr3:183301320|183301420 hsa-miR-4684-5p 1 0 0
chr19:35743809|35744130 hsa-miR-4684-5p 0 1 0
chr14:24439683|24439965 hsa-miR-4684-5p 0 1 0
chr9:137242808|137243096 hsa-miR-4684-5p 0 1 0
chrX:73823604|73823768 hsa-miR-4684-5p 0 1 0
chr10:79940293|79940555 hsa-miR-4684-5p 0 1 0
chr6:30595289|30595423 hsa-miR-4684-5p 0 1 0
chr9:128258121|128258517 hsa-miR-4684-5p 0 1 0
chr8:97676789|97676881 hsa-miR-4684-5p 0 1 0
chr20:58716085|58716217 hsa-miR-4684-5p 0 1 0
chr2:217825102|217825208 hsa-miR-4684-5p 0 1 0
chr15:40979422|40979579 hsa-miR-4684-5p 0 1 0
chr19:12665483|12665772 hsa-miR-4684-5p 0 1 0
chr19:4652907|4653239 hsa-miR-4684-5p 0 1 0
chrX:129805586|129805756 hsa-miR-4684-5p 0 1 0
chr19:14054301|14054457 hsa-miR-4684-5p 0 1 0
chr2:27381500|27381667 hsa-miR-4684-5p 0 1 0
chr1:161037714|161037968 hsa-miR-4684-5p 0 1 0
chr2:101304992|101305138 hsa-miR-4684-5p 0 1 0
chr9:133259598|133259701 hsa-miR-4684-5p 0 1 0
chr6:21231581|21231891 hsa-miR-4684-5p 0 1 0
chr14:24439817|24439922 hsa-miR-4684-5p 0 1 0
chr1:201485411|201485579 hsa-miR-4684-5p 0 1 0
chr1:228098545|228098708 hsa-miR-4684-5p 0 1 0
chr21:34517648|34517744 hsa-miR-4684-5p 0 1 0
chr5:181051061|181051145 hsa-miR-4684-5p 0 1 0
chr6:127287315|127287461 hsa-miR-4684-5p 0 1 0
chr19:2072115|2072304 hsa-miR-4684-5p 0 1 0
chr11:72091451|72091687 hsa-miR-4684-5p 0 1 0
chr7:77372811|77372925 hsa-miR-4684-5p 0 1 0
chr7:45913415|45913516 hsa-miR-4684-5p 0 1 0
chr13:113322948|113323152 hsa-miR-4684-5p 0 1 0
chr9:129827945|129829231 hsa-miR-4684-5p 0 1 0
chr12:6730766|6731078 hsa-miR-4684-5p 0 1 0
chrX:129805605|129805758 hsa-miR-4684-5p 0 1 0
chr7:45913415|45913664 hsa-miR-4684-5p 0 1 0
chr16:87708014|87708410 hsa-miR-4684-5p 0 1 0
chr1:154549751|154549900 hsa-miR-4684-5p 0 1 0
chr1:244054458|244054776 hsa-miR-4684-5p 0 1 0
chr12:68854402|68854499 hsa-miR-4684-5p 0 1 0
chr9:128258121|128258478 hsa-miR-4684-5p 0 1 0
chr17:10674514|10674694 hsa-miR-4684-5p 0 1 0
chr9:89328660|89328886 hsa-miR-4684-5p 0 1 0
chr15:44767231|44767595 hsa-miR-4684-5p 0 1 0
chr1:93618424|93618620 hsa-miR-4684-5p 0 1 0
chr13:113322996|113323152 hsa-miR-4684-5p 0 1 0
chr14:102039060|102039254 hsa-miR-4684-5p 0 1 0
chr1:10630366|10630464 hsa-miR-4684-5p 0 1 0
chrX:118792447|118792575 hsa-miR-4684-5p 0 1 0
chr12:111887383|111887610 hsa-miR-4684-5p 0 1 0
chr2:15415546|15478289 hsa-miR-4684-5p 0 1 0
chr7:76505829|76505955 hsa-miR-4684-5p 0 1 0
chr12:109449290|109449600 hsa-miR-4684-5p 0 1 0
chr3:42568896|42569073 hsa-miR-4684-5p 0 1 0
chr11:35809635|35809746 hsa-miR-4684-5p 0 1 0
chr2:37644301|37644562 hsa-miR-4684-5p 0 1 0
chr9:124358289|124358553 hsa-miR-4684-5p 0 1 0
chr1:228098545|228098733 hsa-miR-4684-5p 0 1 0
chr10:79946485|79946621 hsa-miR-4684-5p 0 1 0
chr7:73693149|73693269 hsa-miR-4684-5p 0 1 0
chr18:63211159|63211439 hsa-miR-4684-5p 0 1 0
chr1:155057669|155057909 hsa-miR-4684-5p 0 1 0
chr13:113323032|113323198 hsa-miR-4684-5p 0 1 0
chr7:45913436|45913570 hsa-miR-4684-5p 0 1 0
chr5:138558625|138560001 hsa-miR-4684-5p 0 1 0
chr15:89834668|89834835 hsa-miR-4684-5p 0 1 0
chr13:113322970|113323152 hsa-miR-4684-5p 0 1 0
chr19:44906615|44907809 hsa-miR-4684-5p 0 1 0
chr19:41383587|41383936 hsa-miR-4684-5p 0 1 0
chr1:212620314|212620483 hsa-miR-4684-5p 0 1 0
chr5:72220230|72220384 hsa-miR-4684-5p 0 1 0
chr2:203392520|203392646 hsa-miR-4684-5p 0 1 0
chr14:92941236|92941381 hsa-miR-4684-5p 0 1 0
chr19:2072174|2072317 hsa-miR-4684-5p 0 1 0
chr1:148435146|148435306 hsa-miR-4684-5p 0 1 0
chr17:78224119|78224290 hsa-miR-4684-5p 0 1 0
chr1:43976527|43976674 hsa-miR-4684-5p 0 1 0
chr7:100099529|100099705 hsa-miR-4684-5p 0 1 0
chr1:162380285|162380441 hsa-miR-4684-5p 0 1 0
chr11:107791661|107791797 hsa-miR-4684-5p 0 1 0
chr12:21512860|21512996 hsa-miR-4684-5p 0 1 0
chr1:26038437|26038661 hsa-miR-4684-5p 0 1 0
chr12:57601981|57602209 hsa-miR-4684-5p 0 1 0
chr9:128258121|128258520 hsa-miR-4684-5p -10 1 0
chr14:102039067|102039254 hsa-miR-4684-5p -3 1 0
chr1:119913992|119914168 hsa-miR-4684-5p -11 1 0
chr14:102039108|102039254 hsa-miR-4684-5p -3 1 0
chr20:36528185|36528280 hsa-miR-4684-5p 1 0 0
chr12:76025732|76025924 hsa-miR-4684-5p 0 1 0
chr3:168036836|168036950 hsa-miR-4684-5p 0 1 0
chr19:54145727|54146043 hsa-miR-4684-5p 0 1 0
chr1:55105229|55105401 hsa-miR-4684-5p 0 1 0
chr12:49269465|49269656 hsa-miR-4684-5p 0 1 0
chr16:24790640|24790906 hsa-miR-4684-5p 0 1 0
chr20:61949484|61949645 hsa-miR-4684-5p 0 1 0
chr5:72363640|72363740 hsa-miR-4684-5p 0 1 0
chr7:135164399|135164564 hsa-miR-4684-5p 0 1 0
chr16:87708016|87708401 hsa-miR-4684-5p 0 1 0
chr4:102584716|102584820 hsa-miR-4684-5p 0 1 0
chr1:228098465|228098744 hsa-miR-4684-5p 0 1 0
chr1:156211670|156211900 hsa-miR-4684-5p 0 1 0
chr16:87331115|87331232 hsa-miR-4684-5p 0 1 0
chr15:29766358|29766511 hsa-miR-4684-5p 0 1 0
chr6:127287315|127287433 hsa-miR-4684-5p 0 1 0
chr7:135164395|135164555 hsa-miR-4684-5p 0 1 0
chr12:76025748|76025846 hsa-miR-4684-5p 0 1 0
chr1:228098570|228098744 hsa-miR-4684-5p 0 1 0
chr11:1099934|1100025 hsa-miR-4684-5p 0 1 0
chr5:468541|468915 hsa-miR-4684-5p 0 1 0
chr13:48256247|48256383 hsa-miR-4684-5p 0 1 0
chr2:199457339|199457468 hsa-miR-4684-5p 0 1 0
chr19:43545898|43546103 hsa-miR-4684-5p 0 1 0
chr12:6730747|6731090 hsa-miR-4684-5p 0 1 0
chr2:219208146|219208314 hsa-miR-4684-5p 0 1 0
chr16:50638139|50638298 hsa-miR-4684-5p 0 1 0
chr14:92941281|92941396 hsa-miR-4684-5p 0 1 0
chr19:45020944|45021109 hsa-miR-4684-5p 0 1 0
chr6:127287220|127287461 hsa-miR-4684-5p 0 1 0
chr11:20045461|20045647 hsa-miR-4684-5p 0 1 0
chr7:100099529|100099702 hsa-miR-4684-5p 0 1 0
chr1:212620441|212620577 hsa-miR-4684-5p 0 1 0
chr1:244054485|244054776 hsa-miR-4684-5p 0 1 0
chr10:102161878|102162149 hsa-miR-4684-5p 0 1 0
chr1:202587733|202587902 hsa-miR-4684-5p 0 1 0
chr6:30915647|30915774 hsa-miR-4684-5p 0 1 0
chr1:32858077|32858263 hsa-miR-4684-5p 0 1 0
chr15:65611718|65611819 hsa-miR-4684-5p 0 1 0
chr12:76025732|76025876 hsa-miR-4684-5p 0 1 0
chr6:32977803|32978165 hsa-miR-4684-5p 0 1 0
chr7:135927754|135927867 hsa-miR-4684-5p 0 1 0
chr7:43874319|43874623 hsa-miR-4684-5p 0 1 0
chr13:46358630|46358808 hsa-miR-4684-5p 0 1 0
chr19:45526184|45526398 hsa-miR-4684-5p 0 1 0
chr11:130876186|130876364 hsa-miR-4684-5p 0 1 0
chr11:46857514|46857680 hsa-miR-4684-5p 0 1 0
chr1:228098461|228098708 hsa-miR-4684-5p 0 1 0
chr10:23440355|23440596 hsa-miR-4684-5p 0 1 0
chr14:20289319|20289514 hsa-miR-4684-5p 0 1 0
chr6:36978505|36978593 hsa-miR-4684-5p 0 1 0
chr1:66372828|66372938 hsa-miR-4684-5p 0 1 0
chr14:24439815|24439922 hsa-miR-4684-5p 0 1 0
chr15:63325581|63325745 hsa-miR-4684-5p 0 1 0
chr13:113323042|113323152 hsa-miR-4684-5p 0 1 0
chr19:58260939|58261153 hsa-miR-4684-5p 1 0 0
chr7:36597756|36597876 hsa-miR-4684-5p 0 1 0
chr15:78013083|78013250 hsa-miR-4684-5p 0 1 0
chr11:120485521|120485651 hsa-miR-4684-5p 0 1 0
chr14:77731015|77731131 hsa-miR-4684-5p 0 1 0
chr12:101489496|101489658 hsa-miR-4684-5p 1 0 0
chr17:44397548|44397769 hsa-miR-4684-5p 1 0 0
chr9:17300941|17301052 hsa-miR-4684-5p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4684-5p ZNF480 zinc finger protein 480 HGNC:23305 details
hsa-miR-4684-5p AGO1 argonaute RISC component 1 HGNC:3262 details
hsa-miR-4684-5p FLYWCH2 FLYWCH family member 2 HGNC:25178 details
hsa-miR-4684-5p RCSD1 RCSD domain containing 1 HGNC:28310 details
hsa-miR-4684-5p AGBL5 AGBL carboxypeptidase 5 HGNC:26147 details
hsa-miR-4684-5p TAOK1 TAO kinase 1 HGNC:29259 details
hsa-miR-4684-5p GNB1L G protein subunit beta 1 like HGNC:4397 details
hsa-miR-4684-5p STAT3 signal transducer and activator of transcription 3 HGNC:11364 details
hsa-miR-4684-5p EPGN epithelial mitogen HGNC:17470 details
hsa-miR-4684-5p RREB1 ras responsive element binding protein 1 HGNC:10449 details
hsa-miR-4684-5p SEC63 SEC63 homolog, protein translocation regulator HGNC:21082 details
hsa-miR-4684-5p CREBBP CREB binding protein HGNC:2348 details
hsa-miR-4684-5p OPN5 opsin 5 HGNC:19992 details
hsa-miR-4684-5p SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 HGNC:11109 details
hsa-miR-4684-5p LSM14A LSM14A mRNA processing body assembly factor HGNC:24489 details
hsa-miR-4684-5p S1PR2 sphingosine-1-phosphate receptor 2 HGNC:3169 details
hsa-miR-4684-5p MAPKAPK5 MAPK activated protein kinase 5 HGNC:6889 details
hsa-miR-4684-5p EBNA1BP2 EBNA1 binding protein 2 HGNC:15531 details
hsa-miR-4684-5p PLA2G2C phospholipase A2 group IIC HGNC:9032 details
hsa-miR-4684-5p ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-4684-5p USP9X ubiquitin specific peptidase 9 X-linked HGNC:12632 details
hsa-miR-4684-5p KPNA4 karyopherin subunit alpha 4 HGNC:6397 details
hsa-miR-4684-5p FHL2 four and a half LIM domains 2 HGNC:3703 details
hsa-miR-4684-5p EMC7 ER membrane protein complex subunit 7 HGNC:24301 details
hsa-miR-4684-5p DNAJC24 DnaJ heat shock protein family (Hsp40) member C24 HGNC:26979 details
hsa-miR-4684-5p C18orf32 chromosome 18 open reading frame 32 HGNC:31690 details
hsa-miR-4684-5p BCKDK branched chain keto acid dehydrogenase kinase HGNC:16902 details
hsa-miR-4684-5p ELP3 elongator acetyltransferase complex subunit 3 HGNC:20696 details
hsa-miR-4684-5p MAP10 microtubule associated protein 10 HGNC:29265 details
hsa-miR-4684-5p details
hsa-miR-4684-5p TGIF1 TGFB induced factor homeobox 1 HGNC:11776 details
hsa-miR-4684-5p TBL1XR1 TBL1X receptor 1 HGNC:29529 details
hsa-miR-4684-5p PKIA cAMP-dependent protein kinase inhibitor alpha HGNC:9017 details
hsa-miR-4684-5p PDZD8 PDZ domain containing 8 HGNC:26974 details
hsa-miR-4684-5p LRIG2 leucine rich repeats and immunoglobulin like domains 2 HGNC:20889 details
hsa-miR-4684-5p SH3RF2 SH3 domain containing ring finger 2 HGNC:26299 details
hsa-miR-4684-5p NT5DC3 5'-nucleotidase domain containing 3 HGNC:30826 details
hsa-miR-4684-5p ZBTB8OS zinc finger and BTB domain containing 8 opposite strand HGNC:24094 details
hsa-miR-4684-5p PEX26 peroxisomal biogenesis factor 26 HGNC:22965 details
hsa-miR-4684-5p ZNF136 zinc finger protein 136 HGNC:12920 details
hsa-miR-4684-5p NUMB NUMB endocytic adaptor protein HGNC:8060 details
hsa-miR-4684-5p MAVS mitochondrial antiviral signaling protein HGNC:29233 details
hsa-miR-4684-5p HMGB2 high mobility group box 2 HGNC:5000 details
hsa-miR-4684-5p HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 HGNC:5030 details
hsa-miR-4684-5p RAB22A RAB22A, member RAS oncogene family HGNC:9764 details
hsa-miR-4684-5p H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase HGNC:4795 details
hsa-miR-4684-5p details
hsa-miR-4684-5p ABCF3 ATP binding cassette subfamily F member 3 HGNC:72 details
hsa-miR-4684-5p DHX36 DEAH-box helicase 36 HGNC:14410 details
hsa-miR-4684-5p TRIM10 tripartite motif containing 10 HGNC:10072 details
hsa-miR-4684-5p PTPN3 protein tyrosine phosphatase non-receptor type 3 HGNC:9655 details
hsa-miR-4684-5p SLC44A1 solute carrier family 44 member 1 HGNC:18798 details
hsa-miR-4684-5p FKBP9 FKBP prolyl isomerase 9 HGNC:3725 details
hsa-miR-4684-5p MICA MHC class I polypeptide-related sequence A HGNC:7090 details
hsa-miR-4684-5p LIMS3 LIM zinc finger domain containing 3 HGNC:30047 details
hsa-miR-4684-5p LIMS4 LIM zinc finger domain containing 4 HGNC:39941 details
hsa-miR-4684-5p EPB41L3 erythrocyte membrane protein band 4.1 like 3 HGNC:3380 details
hsa-miR-4684-5p RAD51 RAD51 recombinase HGNC:9817 details
hsa-miR-4684-5p HASPIN histone H3 associated protein kinase HGNC:19682 details
hsa-miR-4684-5p ZNF878 zinc finger protein 878 HGNC:37246 details
hsa-miR-4684-5p WDR73 WD repeat domain 73 HGNC:25928 details
hsa-miR-4684-5p SP140L SP140 nuclear body protein like HGNC:25105 details
hsa-miR-4684-5p ADD1 adducin 1 HGNC:243 details
hsa-miR-4684-5p TADA2A transcriptional adaptor 2A HGNC:11531 details
hsa-miR-4684-5p NOL9 nucleolar protein 9 HGNC:26265 details
hsa-miR-4684-5p NEBL nebulette HGNC:16932 details
hsa-miR-4684-5p ANGPTL7 angiopoietin like 7 HGNC:24078 details
hsa-miR-4684-5p details
hsa-miR-4684-5p TM4SF20 transmembrane 4 L six family member 20 HGNC:26230 details
hsa-miR-4684-5p ADAMTS18 ADAM metallopeptidase with thrombospondin type 1 motif 18 HGNC:17110 details
hsa-miR-4684-5p FAM151B family with sequence similarity 151 member B HGNC:33716 details
hsa-miR-4684-5p L2HGDH L-2-hydroxyglutarate dehydrogenase HGNC:20499 details
hsa-miR-4684-5p SOWAHC sosondowah ankyrin repeat domain family member C HGNC:26149 details
hsa-miR-4684-5p details
hsa-miR-4684-5p PAK3 p21 (RAC1) activated kinase 3 HGNC:8592 details
hsa-miR-4684-5p FAM83F family with sequence similarity 83 member F HGNC:25148 details
hsa-miR-4684-5p DHX33 DEAH-box helicase 33 HGNC:16718 details
hsa-miR-4684-5p BLOC1S5 biogenesis of lysosomal organelles complex 1 subunit 5 HGNC:18561 details
hsa-miR-4684-5p AKAP2 A-kinase anchoring protein 2 HGNC:372 details
hsa-miR-4684-5p COA4 cytochrome c oxidase assembly factor 4 homolog HGNC:24604 details
hsa-miR-4684-5p TBL2 transducin beta like 2 HGNC:11586 details
hsa-miR-4684-5p VPS8 VPS8 subunit of CORVET complex HGNC:29122 details
hsa-miR-4684-5p SYT11 synaptotagmin 11 HGNC:19239 details
hsa-miR-4684-5p SLC39A9 solute carrier family 39 member 9 HGNC:20182 details
hsa-miR-4684-5p TOR1AIP2 torsin 1A interacting protein 2 HGNC:24055 details
hsa-miR-4684-5p FOSL2 FOS like 2, AP-1 transcription factor subunit HGNC:3798 details
hsa-miR-4684-5p RORB RAR related orphan receptor B HGNC:10259 details
hsa-miR-4684-5p SLCO5A1 solute carrier organic anion transporter family member 5A1 HGNC:19046 details
hsa-miR-4684-5p details
hsa-miR-4684-5p CARD8 caspase recruitment domain family member 8 HGNC:17057 details
hsa-miR-4684-5p LAX1 lymphocyte transmembrane adaptor 1 HGNC:26005 details
hsa-miR-4684-5p EXOSC6 exosome component 6 HGNC:19055 details
hsa-miR-4684-5p TAF8 TATA-box binding protein associated factor 8 HGNC:17300 details
hsa-miR-4684-5p ZNF708 zinc finger protein 708 HGNC:12945 details
hsa-miR-4684-5p ZSCAN22 zinc finger and SCAN domain containing 22 HGNC:4929 details
hsa-miR-4684-5p details
hsa-miR-4684-5p MAGI3 membrane associated guanylate kinase, WW and PDZ domain containing 3 HGNC:29647 details
hsa-miR-4684-5p ACAD8 acyl-CoA dehydrogenase family member 8 HGNC:87 details
hsa-miR-4684-5p FBXO25 F-box protein 25 HGNC:13596 details
hsa-miR-4684-5p PM20D2 peptidase M20 domain containing 2 HGNC:21408 details
hsa-miR-4684-5p SLC10A6 solute carrier family 10 member 6 HGNC:30603 details
hsa-miR-4684-5p MYOM2 myomesin 2 HGNC:7614 details
hsa-miR-4684-5p TRIM45 tripartite motif containing 45 HGNC:19018 details
hsa-miR-4684-5p SLC5A5 solute carrier family 5 member 5 HGNC:11040 details
hsa-miR-4684-5p B4GALT7 beta-1,4-galactosyltransferase 7 HGNC:930 details
hsa-miR-4684-5p TVP23C trans-golgi network vesicle protein 23 homolog C HGNC:30453 details
hsa-miR-4684-5p OTUD7B OTU deubiquitinase 7B HGNC:16683 details
hsa-miR-4684-5p NUP155 nucleoporin 155 HGNC:8063 details
hsa-miR-4684-5p FAM234B family with sequence similarity 234 member B HGNC:29288 details
hsa-miR-4684-5p KCNJ15 potassium inwardly rectifying channel subfamily J member 15 HGNC:6261 details
hsa-miR-4684-5p IREB2 iron responsive element binding protein 2 HGNC:6115 details
hsa-miR-4684-5p HHIP hedgehog interacting protein HGNC:14866 details
hsa-miR-4684-5p FRRS1 ferric chelate reductase 1 HGNC:27622 details
hsa-miR-4684-5p details
hsa-miR-4684-5p DNA2 DNA replication helicase/nuclease 2 HGNC:2939 details
hsa-miR-4684-5p FAM241A family with sequence similarity 241 member A HGNC:26813 details
hsa-miR-4684-5p C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 HGNC:24337 details
hsa-miR-4684-5p ARSB arylsulfatase B HGNC:714 details
hsa-miR-4684-5p AMD1 adenosylmethionine decarboxylase 1 HGNC:457 details
hsa-miR-4684-5p ZNF574 zinc finger protein 574 HGNC:26166 details
hsa-miR-4684-5p SCIMP SLP adaptor and CSK interacting membrane protein HGNC:33504 details
hsa-miR-4684-5p details
hsa-miR-4684-5p RSRC1 arginine and serine rich coiled-coil 1 HGNC:24152 details
hsa-miR-4684-5p ZNF845 zinc finger protein 845 HGNC:25112 details
hsa-miR-4684-5p DCTN3 dynactin subunit 3 HGNC:2713 details
hsa-miR-4684-5p RDH13 retinol dehydrogenase 13 HGNC:19978 details
hsa-miR-4684-5p ICOSLG inducible T cell costimulator ligand HGNC:17087 details
hsa-miR-4684-5p ZNF552 zinc finger protein 552 HGNC:26135 details
hsa-miR-4684-5p RNF207 ring finger protein 207 HGNC:32947 details
hsa-miR-4684-5p BCAS4 breast carcinoma amplified sequence 4 HGNC:14367 details
hsa-miR-4684-5p details
hsa-miR-4684-5p ZNF528 zinc finger protein 528 HGNC:29384 details
hsa-miR-4684-5p ZNF70 zinc finger protein 70 HGNC:13140 details
hsa-miR-4684-5p LRTOMT leucine rich transmembrane and O-methyltransferase domain containing HGNC:25033 details
hsa-miR-4684-5p CD300LG CD300 molecule like family member g HGNC:30455 details
hsa-miR-4684-5p PHAX phosphorylated adaptor for RNA export HGNC:10241 details
hsa-miR-4684-5p NUP205 nucleoporin 205 HGNC:18658 details
hsa-miR-4684-5p SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 HGNC:13655 details
hsa-miR-4684-5p GLP2R glucagon like peptide 2 receptor HGNC:4325 details
hsa-miR-4684-5p ALG1 ALG1 chitobiosyldiphosphodolichol beta-mannosyltransferase HGNC:18294 details
hsa-miR-4684-5p APOC3 apolipoprotein C3 HGNC:610 details
hsa-miR-4684-5p RBM28 RNA binding motif protein 28 HGNC:21863 details
hsa-miR-4684-5p SAMD15 sterile alpha motif domain containing 15 HGNC:18631 details
hsa-miR-4684-5p CCDC80 coiled-coil domain containing 80 HGNC:30649 details
hsa-miR-4684-5p GOLGA5 golgin A5 HGNC:4428 details
hsa-miR-4684-5p ZNF394 zinc finger protein 394 HGNC:18832 details
hsa-miR-4684-5p XIAP X-linked inhibitor of apoptosis HGNC:592 details
hsa-miR-4684-5p USP6NL USP6 N-terminal like HGNC:16858 details
hsa-miR-4684-5p UBXN7 UBX domain protein 7 HGNC:29119 details
hsa-miR-4684-5p TNPO3 transportin 3 HGNC:17103 details
hsa-miR-4684-5p TMEM127 transmembrane protein 127 HGNC:26038 details
hsa-miR-4684-5p TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 HGNC:11804 details
hsa-miR-4684-5p TBC1D15 TBC1 domain family member 15 HGNC:25694 details
hsa-miR-4684-5p STX6 syntaxin 6 HGNC:11441 details
hsa-miR-4684-5p STOM stomatin HGNC:3383 details
hsa-miR-4684-5p SOAT1 sterol O-acyltransferase 1 HGNC:11177 details
hsa-miR-4684-5p SMU1 SMU1 DNA replication regulator and spliceosomal factor HGNC:18247 details
hsa-miR-4684-5p SAR1B secretion associated Ras related GTPase 1B HGNC:10535 details
hsa-miR-4684-5p PTPRF protein tyrosine phosphatase receptor type F HGNC:9670 details
hsa-miR-4684-5p NOA1 nitric oxide associated 1 HGNC:28473 details
hsa-miR-4684-5p NLRC3 NLR family CARD domain containing 3 HGNC:29889 details
hsa-miR-4684-5p MYPN myopalladin HGNC:23246 details
hsa-miR-4684-5p MYO10 myosin X HGNC:7593 details
hsa-miR-4684-5p MRO maestro HGNC:24121 details
hsa-miR-4684-5p MON2 MON2 homolog, regulator of endosome-to-Golgi trafficking HGNC:29177 details
hsa-miR-4684-5p IFNLR1 interferon lambda receptor 1 HGNC:18584 details
hsa-miR-4684-5p FOXJ3 forkhead box J3 HGNC:29178 details
hsa-miR-4684-5p EMP2 epithelial membrane protein 2 HGNC:3334 details
hsa-miR-4684-5p EMC10 ER membrane protein complex subunit 10 HGNC:27609 details
hsa-miR-4684-5p DCAF16 DDB1 and CUL4 associated factor 16 HGNC:25987 details
hsa-miR-4684-5p CLN8 CLN8 transmembrane ER and ERGIC protein HGNC:2079 details
hsa-miR-4684-5p details
hsa-miR-4684-5p ANAPC16 anaphase promoting complex subunit 16 HGNC:26976 details
hsa-miR-4684-5p AHCY adenosylhomocysteinase HGNC:343 details
hsa-miR-4684-5p TIMM50 translocase of inner mitochondrial membrane 50 HGNC:23656 details
hsa-miR-4684-5p TRA2B transformer 2 beta homolog HGNC:10781 details
hsa-miR-4684-5p details
hsa-miR-4684-5p XPNPEP3 X-prolyl aminopeptidase 3 HGNC:28052 details
hsa-miR-4684-5p PPFIBP1 PPFIA binding protein 1 HGNC:9249 details
hsa-miR-4684-5p AXL AXL receptor tyrosine kinase HGNC:905 details
hsa-miR-4684-5p CRIPT CXXC repeat containing interactor of PDZ3 domain HGNC:14312 details
hsa-miR-4684-5p FAM118A family with sequence similarity 118 member A HGNC:1313 details
hsa-miR-4684-5p CDC6 cell division cycle 6 HGNC:1744 details
hsa-miR-4684-5p TMEM170A transmembrane protein 170A HGNC:29577 details
hsa-miR-4684-5p PDK3 pyruvate dehydrogenase kinase 3 HGNC:8811 details
hsa-miR-4684-5p NUDT4 nudix hydrolase 4 HGNC:8051 details
hsa-miR-4684-5p MRPS14 mitochondrial ribosomal protein S14 HGNC:14049 details
hsa-miR-4684-5p LIX1L limb and CNS expressed 1 like HGNC:28715 details
hsa-miR-4684-5p GK5 glycerol kinase 5 HGNC:28635 details
hsa-miR-4684-5p ANP32E acidic nuclear phosphoprotein 32 family member E HGNC:16673 details
hsa-miR-4684-5p details
hsa-miR-4684-5p ALDOA aldolase, fructose-bisphosphate A HGNC:414 details
hsa-miR-4684-5p CRY2 cryptochrome circadian regulator 2 HGNC:2385 details
hsa-miR-4684-5p FBXL20 F-box and leucine rich repeat protein 20 HGNC:24679 details
hsa-miR-4684-5p GEN1 GEN1 Holliday junction 5' flap endonuclease HGNC:26881 details
hsa-miR-4684-5p ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 HGNC:19745 details
hsa-miR-4684-5p SLC35F2 solute carrier family 35 member F2 HGNC:23615 details
hsa-miR-4684-5p ARMC10 armadillo repeat containing 10 HGNC:21706 details
hsa-miR-4684-5p PPP1R8 protein phosphatase 1 regulatory subunit 8 HGNC:9296 details
hsa-miR-4684-5p MEOX2 mesenchyme homeobox 2 HGNC:7014 details
hsa-miR-4684-5p SPC24 SPC24 component of NDC80 kinetochore complex HGNC:26913 details
hsa-miR-4684-5p ACVRL1 activin A receptor like type 1 HGNC:175 details
hsa-miR-4684-5p C22orf46 chromosome 22 putative open reading frame 46 HGNC:26294 details
hsa-miR-4684-5p NCKAP1 NCK associated protein 1 HGNC:7666 details
hsa-miR-4684-5p METTL7A methyltransferase like 7A HGNC:24550 details
hsa-miR-4684-5p PCYOX1L prenylcysteine oxidase 1 like HGNC:28477 details
hsa-miR-4684-5p PTGIS prostaglandin I2 synthase HGNC:9603 details
hsa-miR-4684-5p ZNF449 zinc finger protein 449 HGNC:21039 details
hsa-miR-4684-5p ELOVL7 ELOVL fatty acid elongase 7 HGNC:26292 details
hsa-miR-4684-5p TMEM131L transmembrane 131 like HGNC:29146 details
hsa-miR-4684-5p MACC1 MET transcriptional regulator MACC1 HGNC:30215 details
hsa-miR-4684-5p DKK3 dickkopf WNT signaling pathway inhibitor 3 HGNC:2893 details
hsa-miR-4684-5p TRMT13 tRNA methyltransferase 13 homolog HGNC:25502 details
hsa-miR-4684-5p ZNF470 zinc finger protein 470 HGNC:22220 details
hsa-miR-4684-5p KLC3 kinesin light chain 3 HGNC:20717 details
hsa-miR-4684-5p MARK4 microtubule affinity regulating kinase 4 HGNC:13538 details
hsa-miR-4684-5p ANK1 ankyrin 1 HGNC:492 details
hsa-miR-4684-5p HAUS3 HAUS augmin like complex subunit 3 HGNC:28719 details
hsa-miR-4684-5p PRR14L proline rich 14 like HGNC:28738 details
hsa-miR-4684-5p PSME3 proteasome activator subunit 3 HGNC:9570 details
hsa-miR-4684-5p UHMK1 U2AF homology motif kinase 1 HGNC:19683 details
hsa-miR-4684-5p ZNF747 zinc finger protein 747 HGNC:28350 details
hsa-miR-4684-5p ADA2 adenosine deaminase 2 HGNC:1839 details
hsa-miR-4684-5p AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 HGNC:23463 details
hsa-miR-4684-5p APOL6 apolipoprotein L6 HGNC:14870 details
hsa-miR-4684-5p ARHGAP29 Rho GTPase activating protein 29 HGNC:30207 details
hsa-miR-4684-5p ARL5C ADP ribosylation factor like GTPase 5C HGNC:31111 details
hsa-miR-4684-5p ATIC 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase HGNC:794 details
hsa-miR-4684-5p details
hsa-miR-4684-5p C1GALT1C1 C1GALT1 specific chaperone 1 HGNC:24338 details
hsa-miR-4684-5p CC2D1B coiled-coil and C2 domain containing 1B HGNC:29386 details
hsa-miR-4684-5p CD3D CD3d molecule HGNC:1673 details
hsa-miR-4684-5p CENPA centromere protein A HGNC:1851 details
hsa-miR-4684-5p CGNL1 cingulin like 1 HGNC:25931 details
hsa-miR-4684-5p CHMP1B charged multivesicular body protein 1B HGNC:24287 details
hsa-miR-4684-5p CLCC1 chloride channel CLIC like 1 HGNC:29675 details
hsa-miR-4684-5p CTH cystathionine gamma-lyase HGNC:2501 details
hsa-miR-4684-5p DPPA4 developmental pluripotency associated 4 HGNC:19200 details
hsa-miR-4684-5p FAT3 FAT atypical cadherin 3 HGNC:23112 details
hsa-miR-4684-5p FBXL3 F-box and leucine rich repeat protein 3 HGNC:13599 details
hsa-miR-4684-5p details
hsa-miR-4684-5p FKBP5 FKBP prolyl isomerase 5 HGNC:3721 details
hsa-miR-4684-5p FUS FUS RNA binding protein HGNC:4010 details
hsa-miR-4684-5p GRK4 G protein-coupled receptor kinase 4 HGNC:4543 details
hsa-miR-4684-5p GRSF1 G-rich RNA sequence binding factor 1 HGNC:4610 details
hsa-miR-4684-5p GRWD1 glutamate rich WD repeat containing 1 HGNC:21270 details
hsa-miR-4684-5p HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 HGNC:18646 details
hsa-miR-4684-5p IER5 immediate early response 5 HGNC:5393 details
hsa-miR-4684-5p KIAA0513 KIAA0513 HGNC:29058 details
hsa-miR-4684-5p LZIC leucine zipper and CTNNBIP1 domain containing HGNC:17497 details
hsa-miR-4684-5p MED29 mediator complex subunit 29 HGNC:23074 details
hsa-miR-4684-5p NCBP3 nuclear cap binding subunit 3 HGNC:24612 details
hsa-miR-4684-5p NCKIPSD NCK interacting protein with SH3 domain HGNC:15486 details
hsa-miR-4684-5p NUDCD2 NudC domain containing 2 HGNC:30535 details
hsa-miR-4684-5p OTULIN OTU deubiquitinase with linear linkage specificity HGNC:25118 details
hsa-miR-4684-5p PARVB parvin beta HGNC:14653 details
hsa-miR-4684-5p PCCB propionyl-CoA carboxylase subunit beta HGNC:8654 details
hsa-miR-4684-5p PGAP1 post-GPI attachment to proteins inositol deacylase 1 HGNC:25712 details
hsa-miR-4684-5p PON1 paraoxonase 1 HGNC:9204 details
hsa-miR-4684-5p POU2F3 POU class 2 homeobox 3 HGNC:19864 details
hsa-miR-4684-5p PROSER2 proline and serine rich 2 HGNC:23728 details
hsa-miR-4684-5p PROSER3 proline and serine rich 3 HGNC:25204 details
hsa-miR-4684-5p PSD4 pleckstrin and Sec7 domain containing 4 HGNC:19096 details
hsa-miR-4684-5p PTCD2 pentatricopeptide repeat domain 2 HGNC:25734 details
hsa-miR-4684-5p PTPRB protein tyrosine phosphatase receptor type B HGNC:9665 details
hsa-miR-4684-5p QPCTL glutaminyl-peptide cyclotransferase like HGNC:25952 details
hsa-miR-4684-5p RAB5B RAB5B, member RAS oncogene family HGNC:9784 details
hsa-miR-4684-5p RAP1A RAP1A, member of RAS oncogene family HGNC:9855 details
hsa-miR-4684-5p RBM48 RNA binding motif protein 48 HGNC:21785 details
hsa-miR-4684-5p RGS9BP regulator of G protein signaling 9 binding protein HGNC:30304 details
hsa-miR-4684-5p RIPPLY3 ripply transcriptional repressor 3 HGNC:3047 details
hsa-miR-4684-5p RMDN1 regulator of microtubule dynamics 1 HGNC:24285 details
hsa-miR-4684-5p RPL12 ribosomal protein L12 HGNC:10302 details
hsa-miR-4684-5p SAMD5 sterile alpha motif domain containing 5 HGNC:21180 details
hsa-miR-4684-5p SFXN1 sideroflexin 1 HGNC:16085 details
hsa-miR-4684-5p SLC27A1 solute carrier family 27 member 1 HGNC:10995 details
hsa-miR-4684-5p SLC48A1 solute carrier family 48 member 1 HGNC:26035 details
hsa-miR-4684-5p SRP19 signal recognition particle 19 HGNC:11300 details
hsa-miR-4684-5p TMED4 transmembrane p24 trafficking protein 4 HGNC:22301 details
hsa-miR-4684-5p TMEM250 transmembrane protein 250 HGNC:31009 details
hsa-miR-4684-5p TPGS1 tubulin polyglutamylase complex subunit 1 HGNC:25058 details
hsa-miR-4684-5p TPM3 tropomyosin 3 HGNC:12012 details
hsa-miR-4684-5p details
hsa-miR-4684-5p TRUB2 TruB pseudouridine synthase family member 2 HGNC:17170 details
hsa-miR-4684-5p WDR76 WD repeat domain 76 HGNC:25773 details
hsa-miR-4684-5p ZBTB8A zinc finger and BTB domain containing 8A HGNC:24172 details
hsa-miR-4684-5p ZKSCAN7 zinc finger with KRAB and SCAN domains 7 HGNC:12955 details
hsa-miR-4684-5p ZMAT2 zinc finger matrin-type 2 HGNC:26433 details
hsa-miR-4684-5p ZNF124 zinc finger protein 124 HGNC:12907 details
hsa-miR-4684-5p ZNF329 zinc finger protein 329 HGNC:14209 details
hsa-miR-4684-5p ZNF442 zinc finger protein 442 HGNC:20877 details
hsa-miR-4684-5p ZNF699 zinc finger protein 699 HGNC:24750 details
hsa-miR-4684-5p PTCHD1 patched domain containing 1 HGNC:26392 details