miRNA Card

miRNA General Information
miRNA ID hsa-miR-4719
Description Homo sapiens miR-4719 stem-loop
Comment None
Experiment Illumina [1]
Sequence UCACAAAUCUAUAAUAUGCAGG
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr1:150811644|150811749 hsa-miR-4719 0 1 0
chr22:37807182|37807259 hsa-miR-4719 0 1 0
chr3:119843255|119843353 hsa-miR-4719 0 1 0
chr6:33006653|33006802 hsa-miR-4719 0 1 0
chr7:29922549|29922746 hsa-miR-4719 0 1 0
chr16:78117415|78117521 hsa-miR-4719 0 1 0
chr17:42402600|42402719 hsa-miR-4719 0 1 0
chr17:42701620|42701752 hsa-miR-4719 0 1 0
chr22:42796765|42796962 hsa-miR-4719 0 1 0
chr17:42402580|42402719 hsa-miR-4719 0 1 0
chr17:42402600|42402723 hsa-miR-4719 0 1 0
chr7:134970106|134970201 hsa-miR-4719 0 1 0
chr1:164792641|164792738 hsa-miR-4719 0 1 0
chr12:56099955|56100245 hsa-miR-4719 0 1 0
chr1:44225356|44225481 hsa-miR-4719 0 1 0
chr1:154213788|154213881 hsa-miR-4719 0 1 0
chr12:24811903|24812087 hsa-miR-4719 0 1 0
chr8:95109312|95109417 hsa-miR-4719 0 1 0
chr14:39181653|39181858 hsa-miR-4719 0 1 0
chr2:227536648|227536993 hsa-miR-4719 0 1 0
chr12:56099923|56100245 hsa-miR-4719 0 1 0
chr10:79315801|79316195 hsa-miR-4719 0 1 0
chr17:42402600~42402719 hsa-miR-4719 0 1 0
chr14:39181671~39181775 hsa-miR-4719 0 1 0
chr1:164792641~164792738 hsa-miR-4719 0 1 0
chr7:134970106~134970201 hsa-miR-4719 0 1 0
chr17:40456569~40456960 hsa-miR-4719 0 1 0
chr6:43033592~43033756 hsa-miR-4719 0 1 0
chr17:40656080~40656266 hsa-miR-4719 0 1 0
chr14:60719098~60719248 hsa-miR-4719 0 1 0
chr17:42402580~42402723 hsa-miR-4719 0 1 0
chr14:69528694~69528822 hsa-miR-4719 0 1 0
chr7:87550246~87550549 hsa-miR-4719 0 1 0
chr17:42402600~42402723 hsa-miR-4719 0 1 0
chr2:17665402~17665533 hsa-miR-4719 0 1 0
chr14:39181653~39181775 hsa-miR-4719 0 1 0
chr1:160322221|160322337 hsa-miR-4719 0 1 0
chr12:46365210|46365381 hsa-miR-4719 0 1 0
chr12:2847145|2847308 hsa-miR-4719 0 1 0
chr1:43444687|43444867 hsa-miR-4719 0 1 0
chr19:7435513|7435734 hsa-miR-4719 0 1 0
chr17:2995046|2995182 hsa-miR-4719 0 1 0
chr5:177600610|177600726 hsa-miR-4719 0 1 0
chr10:122845918|122846028 hsa-miR-4719 0 1 0
chr2:143306831|143307043 hsa-miR-4719 0 1 0
chr22:25388767|25388979 hsa-miR-4719 0 1 0
chr5:172079925|172080110 hsa-miR-4719 0 1 0
chr1:150576452|150576561 hsa-miR-4719 0 1 0
chr7:100419630|100419719 hsa-miR-4719 0 1 0
chr20:57649473|57649645 hsa-miR-4719 0 1 0
chr14:39181653|39181775 hsa-miR-4719 0 1 0
chr15:42311667|42311915 hsa-miR-4719 0 1 0
chr3:13129305|13129525 hsa-miR-4719 0 1 0
chr20:1937320|1937672 hsa-miR-4719 0 1 0
chr9:127690920|127691181 hsa-miR-4719 0 1 0
chr19:37344987|37345184 hsa-miR-4719 0 1 0
chr2:17665402|17665533 hsa-miR-4719 0 1 0
chr7:154949095|154949222 hsa-miR-4719 0 1 0
chr1:222630147|222630306 hsa-miR-4719 0 1 0
chr8:11843582|11843733 hsa-miR-4719 0 1 0
chr2:229778547|229778935 hsa-miR-4719 0 1 0
chr1:155675010|155679512 hsa-miR-4719 0 1 0
chr1:155670320|155675096 hsa-miR-4719 0 1 0
chr8:47396376|47407961 hsa-miR-4719 0 1 0
chr7:155672867|155680908 hsa-miR-4719 0 1 0
chr15:41480833|41481119 hsa-miR-4719 0 1 0
chr13:94403802|94403983 hsa-miR-4719 0 1 0
chr13:44433940|44434071 hsa-miR-4719 0 1 0
chr18:44677125|44677283 hsa-miR-4719 0 1 0
chr5:129110067|129110336 hsa-miR-4719 0 1 0
chr16:4853938|4854147 hsa-miR-4719 0 1 0
chr20:32334181|32334389 hsa-miR-4719 0 1 0
chr13:20068277|20068399 hsa-miR-4719 0 1 0
chr14:39181653|39181789 hsa-miR-4719 0 1 0
chr5:177092685|177092945 hsa-miR-4719 0 1 0
chr2:53972906|53973042 hsa-miR-4719 0 1 0
chr14:39181656|39181789 hsa-miR-4719 0 1 0
chr20:32334246|32334405 hsa-miR-4719 0 1 0
chr19:35510184|35510387 hsa-miR-4719 0 1 0
chr14:39181637|39181789 hsa-miR-4719 0 1 0
chr14:60283071|60283238 hsa-miR-4719 0 1 0
chr3:152838565|152838721 hsa-miR-4719 0 1 0
chr3:99790680|99790853 hsa-miR-4719 0 1 0
chr2:17665441|17665533 hsa-miR-4719 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4719 NEU3 neuraminidase 3 HGNC:7760 details
hsa-miR-4719 NUDT12 nudix hydrolase 12 HGNC:18826 details
hsa-miR-4719 PRNP prion protein HGNC:9449 details
hsa-miR-4719 ZNF432 zinc finger protein 432 HGNC:20810 details
hsa-miR-4719 C20orf27 chromosome 20 open reading frame 27 HGNC:15873 details
hsa-miR-4719 TUBB2A tubulin beta 2A class IIa HGNC:12412 details
hsa-miR-4719 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 HGNC:11106 details
hsa-miR-4719 SLC16A1 solute carrier family 16 member 1 HGNC:10922 details
hsa-miR-4719 RREB1 ras responsive element binding protein 1 HGNC:10449 details
hsa-miR-4719 PEG10 paternally expressed 10 HGNC:14005 details
hsa-miR-4719 PANK3 pantothenate kinase 3 HGNC:19365 details
hsa-miR-4719 NIN ninein HGNC:14906 details
hsa-miR-4719 CAND1 cullin associated and neddylation dissociated 1 HGNC:30688 details
hsa-miR-4719 SSPN sarcospan HGNC:11322 details
hsa-miR-4719 CHST11 carbohydrate sulfotransferase 11 HGNC:17422 details
hsa-miR-4719 NCBP3 nuclear cap binding subunit 3 HGNC:24612 details
hsa-miR-4719 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 HGNC:24941 details
hsa-miR-4719 ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-4719 PPP4R3A protein phosphatase 4 regulatory subunit 3A HGNC:20219 details
hsa-miR-4719 PRRG4 proline rich and Gla domain 4 HGNC:30799 details
hsa-miR-4719 CLDN12 claudin 12 HGNC:2034 details
hsa-miR-4719 GRM5 glutamate metabotropic receptor 5 HGNC:4597 details
hsa-miR-4719 MYO6 myosin VI HGNC:7605 details
hsa-miR-4719 ZBTB34 zinc finger and BTB domain containing 34 HGNC:31446 details
hsa-miR-4719 LIN54 lin-54 DREAM MuvB core complex component HGNC:25397 details
hsa-miR-4719 RAB1A RAB1A, member RAS oncogene family HGNC:9758 details
hsa-miR-4719 LRRC2 leucine rich repeat containing 2 HGNC:14676 details
hsa-miR-4719 details
hsa-miR-4719 MAP1B microtubule associated protein 1B HGNC:6836 details
hsa-miR-4719 MAGEL2 MAGE family member L2 HGNC:6814 details
hsa-miR-4719 USP51 ubiquitin specific peptidase 51 HGNC:23086 details
hsa-miR-4719 OCIAD1 OCIA domain containing 1 HGNC:16074 details
hsa-miR-4719 THBS2 thrombospondin 2 HGNC:11786 details
hsa-miR-4719 SLC28A2 solute carrier family 28 member 2 HGNC:11002 details
hsa-miR-4719 CENPA centromere protein A HGNC:1851 details
hsa-miR-4719 SRARP steroid receptor associated and regulated protein HGNC:28339 details
hsa-miR-4719 FAT3 FAT atypical cadherin 3 HGNC:23112 details
hsa-miR-4719 SYT4 synaptotagmin 4 HGNC:11512 details
hsa-miR-4719 TP53INP1 tumor protein p53 inducible nuclear protein 1 HGNC:18022 details
hsa-miR-4719 details
hsa-miR-4719 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D HGNC:28759 details
hsa-miR-4719 MBOAT2 membrane bound O-acyltransferase domain containing 2 HGNC:25193 details
hsa-miR-4719 HOXD1 homeobox D1 HGNC:5132 details
hsa-miR-4719 CPEB2 cytoplasmic polyadenylation element binding protein 2 HGNC:21745 details
hsa-miR-4719 CCSER2 coiled-coil serine rich protein 2 HGNC:29197 details
hsa-miR-4719 MSMO1 methylsterol monooxygenase 1 HGNC:10545 details
hsa-miR-4719 PDZRN4 PDZ domain containing ring finger 4 HGNC:30552 details
hsa-miR-4719 SLC12A2 solute carrier family 12 member 2 HGNC:10911 details
hsa-miR-4719 MED29 mediator complex subunit 29 HGNC:23074 details
hsa-miR-4719 LRRFIP2 LRR binding FLII interacting protein 2 HGNC:6703 details
hsa-miR-4719 FNIP1 folliculin interacting protein 1 HGNC:29418 details
hsa-miR-4719 AKAP1 A-kinase anchoring protein 1 HGNC:367 details
hsa-miR-4719 MGAT4C MGAT4 family member C HGNC:30871 details
hsa-miR-4719 PNMA2 PNMA family member 2 HGNC:9159 details
hsa-miR-4719 GNL3 G protein nucleolar 3 HGNC:29931 details
hsa-miR-4719 AKAP8 A-kinase anchoring protein 8 HGNC:378 details
hsa-miR-4719 VEGFA vascular endothelial growth factor A HGNC:12680 details
hsa-miR-4719 NRAS NRAS proto-oncogene, GTPase HGNC:7989 details
hsa-miR-4719 KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-4719 HOOK1 hook microtubule tethering protein 1 HGNC:19884 details
hsa-miR-4719 PHEX phosphate regulating endopeptidase homolog X-linked HGNC:8918 details
hsa-miR-4719 REST RE1 silencing transcription factor HGNC:9966 details
hsa-miR-4719 PPP2R2A protein phosphatase 2 regulatory subunit Balpha HGNC:9304 details
hsa-miR-4719 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 HGNC:8575 details
hsa-miR-4719 HNRNPL heterogeneous nuclear ribonucleoprotein L HGNC:5045 details
hsa-miR-4719 CBX2 chromobox 2 HGNC:1552 details
hsa-miR-4719 MED26 mediator complex subunit 26 HGNC:2376 details
hsa-miR-4719 COASY Coenzyme A synthase HGNC:29932 details
hsa-miR-4719 KAT7 lysine acetyltransferase 7 HGNC:17016 details
hsa-miR-4719 CLIP4 CAP-Gly domain containing linker protein family member 4 HGNC:26108 details
hsa-miR-4719 AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-4719 LRRC8A leucine rich repeat containing 8 VRAC subunit A HGNC:19027 details
hsa-miR-4719 details
hsa-miR-4719 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta HGNC:12854 details
hsa-miR-4719 DHODH dihydroorotate dehydrogenase (quinone) HGNC:2867 details
hsa-miR-4719 BACH1 BTB domain and CNC homolog 1 HGNC:935 details
hsa-miR-4719 ZNF878 zinc finger protein 878 HGNC:37246 details
hsa-miR-4719 GNAI1 G protein subunit alpha i1 HGNC:4384 details
hsa-miR-4719 TPI1 triosephosphate isomerase 1 HGNC:12009 details
hsa-miR-4719 TFCP2 transcription factor CP2 HGNC:11748 details
hsa-miR-4719 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A HGNC:9275 details
hsa-miR-4719 IGFBP5 insulin like growth factor binding protein 5 HGNC:5474 details
hsa-miR-4719 LYRM7 LYR motif containing 7 HGNC:28072 details
hsa-miR-4719 GABPB1 GA binding protein transcription factor subunit beta 1 HGNC:4074 details
hsa-miR-4719 NPTX1 neuronal pentraxin 1 HGNC:7952 details
hsa-miR-4719 KIAA1549L KIAA1549 like HGNC:24836 details
hsa-miR-4719 BTBD9 BTB domain containing 9 HGNC:21228 details
hsa-miR-4719 ZBTB43 zinc finger and BTB domain containing 43 HGNC:17908 details
hsa-miR-4719 TFAM transcription factor A, mitochondrial HGNC:11741 details
hsa-miR-4719 SLC36A1 solute carrier family 36 member 1 HGNC:18761 details
hsa-miR-4719 PLXNC1 plexin C1 HGNC:9106 details
hsa-miR-4719 PDGFRA platelet derived growth factor receptor alpha HGNC:8803 details
hsa-miR-4719 CTTNBP2NL CTTNBP2 N-terminal like HGNC:25330 details
hsa-miR-4719 CDKL2 cyclin dependent kinase like 2 HGNC:1782 details
hsa-miR-4719 details
hsa-miR-4719 HUNK hormonally up-regulated Neu-associated kinase HGNC:13326 details
hsa-miR-4719 QSOX2 quiescin sulfhydryl oxidase 2 HGNC:30249 details
hsa-miR-4719 ZKSCAN4 zinc finger with KRAB and SCAN domains 4 HGNC:13854 details
hsa-miR-4719 WDR72 WD repeat domain 72 HGNC:26790 details
hsa-miR-4719 ZC3H12C zinc finger CCCH-type containing 12C HGNC:29362 details
hsa-miR-4719 ZDHHC5 zinc finger DHHC-type palmitoyltransferase 5 HGNC:18472 details
hsa-miR-4719 ZNF80 zinc finger protein 80 HGNC:13155 details
hsa-miR-4719 PSD4 pleckstrin and Sec7 domain containing 4 HGNC:19096 details
hsa-miR-4719 ABCC12 ATP binding cassette subfamily C member 12 HGNC:14640 details
hsa-miR-4719 NKX3-2 NK3 homeobox 2 HGNC:951 details
hsa-miR-4719 LANCL3 LanC like 3 HGNC:24767 details
hsa-miR-4719 DHRS3 dehydrogenase/reductase 3 HGNC:17693 details
hsa-miR-4719 C12orf29 chromosome 12 open reading frame 29 HGNC:25322 details
hsa-miR-4719 RBM25 RNA binding motif protein 25 HGNC:23244 details
hsa-miR-4719 MSI1 musashi RNA binding protein 1 HGNC:7330 details
hsa-miR-4719 ZPR1 ZPR1 zinc finger HGNC:13051 details
hsa-miR-4719 VPS52 VPS52 subunit of GARP complex HGNC:10518 details
hsa-miR-4719 SOS2 SOS Ras/Rho guanine nucleotide exchange factor 2 HGNC:11188 details
hsa-miR-4719 PRLR prolactin receptor HGNC:9446 details
hsa-miR-4719 PRKAA2 protein kinase AMP-activated catalytic subunit alpha 2 HGNC:9377 details
hsa-miR-4719 MAPK14 mitogen-activated protein kinase 14 HGNC:6876 details
hsa-miR-4719 KIAA1958 KIAA1958 HGNC:23427 details
hsa-miR-4719 HBEGF heparin binding EGF like growth factor HGNC:3059 details
hsa-miR-4719 DOCK5 dedicator of cytokinesis 5 HGNC:23476 details
hsa-miR-4719 details
hsa-miR-4719 PHKA1 phosphorylase kinase regulatory subunit alpha 1 HGNC:8925 details
hsa-miR-4719 TAL1 TAL bHLH transcription factor 1, erythroid differentiation factor HGNC:11556 details
hsa-miR-4719 TMC7 transmembrane channel like 7 HGNC:23000 details
hsa-miR-4719 NECAB1 N-terminal EF-hand calcium binding protein 1 HGNC:20983 details
hsa-miR-4719 details
hsa-miR-4719 RS1 retinoschisin 1 HGNC:10457 details
hsa-miR-4719 OLR1 oxidized low density lipoprotein receptor 1 HGNC:8133 details
hsa-miR-4719 details
hsa-miR-4719 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1 like 2 HGNC:27067 details
hsa-miR-4719 MAL2 mal, T cell differentiation protein 2 HGNC:13634 details
hsa-miR-4719 PACRGL parkin coregulated like HGNC:28442 details
hsa-miR-4719 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 HGNC:5031 details
hsa-miR-4719 CPNE8 copine 8 HGNC:23498 details
hsa-miR-4719 GREB1L GREB1 like retinoic acid receptor coactivator HGNC:31042 details
hsa-miR-4719 RAD54L2 RAD54 like 2 HGNC:29123 details
hsa-miR-4719 LMBR1 limb development membrane protein 1 HGNC:13243 details
hsa-miR-4719 RNF145 ring finger protein 145 HGNC:20853 details
hsa-miR-4719 CCNO cyclin O HGNC:18576 details
hsa-miR-4719 SETDB2 SET domain bifurcated histone lysine methyltransferase 2 HGNC:20263 details
hsa-miR-4719 DCC DCC netrin 1 receptor HGNC:2701 details
hsa-miR-4719 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 HGNC:19123 details
hsa-miR-4719 SIGLEC14 sialic acid binding Ig like lectin 14 HGNC:32926 details
hsa-miR-4719 ZWILCH zwilch kinetochore protein HGNC:25468 details
hsa-miR-4719 CDH7 cadherin 7 HGNC:1766 details
hsa-miR-4719 CCDC127 coiled-coil domain containing 127 HGNC:30520 details
hsa-miR-4719 CDKN1A cyclin dependent kinase inhibitor 1A HGNC:1784 details
hsa-miR-4719 SMG8 SMG8 nonsense mediated mRNA decay factor HGNC:25551 details
hsa-miR-4719 TUBB tubulin beta class I HGNC:20778 details
hsa-miR-4719 ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 HGNC:697 details
hsa-miR-4719 ATL2 atlastin GTPase 2 HGNC:24047 details
hsa-miR-4719 details
hsa-miR-4719 COX8A cytochrome c oxidase subunit 8A HGNC:2294 details
hsa-miR-4719 GNL3L G protein nucleolar 3 like HGNC:25553 details
hsa-miR-4719 RPL41 ribosomal protein L41 HGNC:10354 details
hsa-miR-4719 IGF2R insulin like growth factor 2 receptor HGNC:5467 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab