miRNA Card

miRNA General Information
miRNA ID hsa-miR-4760-3p
Description Homo sapiens miR-4760 stem-loop
Comment None
Experiment Illumina [1]
Sequence AAAUUCAUGUUCAAUCUAAACC
miRNA Expression in different cancers


circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4760-3p NHS NHS actin remodeling regulator HGNC:7820 details
hsa-miR-4760-3p SLC35G1 solute carrier family 35 member G1 HGNC:26607 details
hsa-miR-4760-3p RIOX2 ribosomal oxygenase 2 HGNC:19441 details
hsa-miR-4760-3p CD55 CD55 molecule (Cromer blood group) HGNC:2665 details
hsa-miR-4760-3p ZFHX3 zinc finger homeobox 3 HGNC:777 details
hsa-miR-4760-3p TOR2A torsin family 2 member A HGNC:11996 details
hsa-miR-4760-3p TMED5 transmembrane p24 trafficking protein 5 HGNC:24251 details
hsa-miR-4760-3p TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D HGNC:28759 details
hsa-miR-4760-3p TAF13 TATA-box binding protein associated factor 13 HGNC:11546 details
hsa-miR-4760-3p PDE4D phosphodiesterase 4D HGNC:8783 details
hsa-miR-4760-3p OTUD4 OTU deubiquitinase 4 HGNC:24949 details
hsa-miR-4760-3p details
hsa-miR-4760-3p GNS glucosamine (N-acetyl)-6-sulfatase HGNC:4422 details
hsa-miR-4760-3p AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 HGNC:20886 details
hsa-miR-4760-3p CALCR calcitonin receptor HGNC:1440 details
hsa-miR-4760-3p ARL6IP6 ADP ribosylation factor like GTPase 6 interacting protein 6 HGNC:24048 details
hsa-miR-4760-3p details
hsa-miR-4760-3p TPD52 tumor protein D52 HGNC:12005 details
hsa-miR-4760-3p RAN RAN, member RAS oncogene family HGNC:9846 details
hsa-miR-4760-3p FBXL3 F-box and leucine rich repeat protein 3 HGNC:13599 details
hsa-miR-4760-3p CREBZF CREB/ATF bZIP transcription factor HGNC:24905 details
hsa-miR-4760-3p MAGEL2 MAGE family member L2 HGNC:6814 details
hsa-miR-4760-3p EXOC8 exocyst complex component 8 HGNC:24659 details
hsa-miR-4760-3p POF1B POF1B actin binding protein HGNC:13711 details
hsa-miR-4760-3p BARD1 BRCA1 associated RING domain 1 HGNC:952 details
hsa-miR-4760-3p SYT4 synaptotagmin 4 HGNC:11512 details
hsa-miR-4760-3p TPR translocated promoter region, nuclear basket protein HGNC:12017 details
hsa-miR-4760-3p LRIG3 leucine rich repeats and immunoglobulin like domains 3 HGNC:30991 details
hsa-miR-4760-3p ANKRD50 ankyrin repeat domain 50 HGNC:29223 details
hsa-miR-4760-3p ADO 2-aminoethanethiol dioxygenase HGNC:23506 details
hsa-miR-4760-3p details
hsa-miR-4760-3p GDF11 growth differentiation factor 11 HGNC:4216 details
hsa-miR-4760-3p VANGL2 VANGL planar cell polarity protein 2 HGNC:15511 details
hsa-miR-4760-3p CLSPN claspin HGNC:19715 details
hsa-miR-4760-3p CALM1 calmodulin 1 HGNC:1442 details
hsa-miR-4760-3p BCL2L11 BCL2 like 11 HGNC:994 details
hsa-miR-4760-3p ZNF146 zinc finger protein 146 HGNC:12931 details
hsa-miR-4760-3p LIFR LIF receptor subunit alpha HGNC:6597 details
hsa-miR-4760-3p ELOA elongin A HGNC:11620 details
hsa-miR-4760-3p EIF4E eukaryotic translation initiation factor 4E HGNC:3287 details
hsa-miR-4760-3p CBX6 chromobox 6 HGNC:1556 details
hsa-miR-4760-3p DSPP dentin sialophosphoprotein HGNC:3054 details
hsa-miR-4760-3p SERTAD3 SERTA domain containing 3 HGNC:17931 details
hsa-miR-4760-3p KLHL28 kelch like family member 28 HGNC:19741 details
hsa-miR-4760-3p CLDN12 claudin 12 HGNC:2034 details
hsa-miR-4760-3p MAP1B microtubule associated protein 1B HGNC:6836 details
hsa-miR-4760-3p TFAP2A transcription factor AP-2 alpha HGNC:11742 details
hsa-miR-4760-3p BROX BRO1 domain and CAAX motif containing HGNC:26512 details
hsa-miR-4760-3p ZNF25 zinc finger protein 25 HGNC:13043 details
hsa-miR-4760-3p KCNQ3 potassium voltage-gated channel subfamily Q member 3 HGNC:6297 details
hsa-miR-4760-3p CXCR6 C-X-C motif chemokine receptor 6 HGNC:16647 details
hsa-miR-4760-3p CREB1 cAMP responsive element binding protein 1 HGNC:2345 details
hsa-miR-4760-3p GTF2H5 general transcription factor IIH subunit 5 HGNC:21157 details
hsa-miR-4760-3p SERINC3 serine incorporator 3 HGNC:11699 details
hsa-miR-4760-3p RHOBTB3 Rho related BTB domain containing 3 HGNC:18757 details
hsa-miR-4760-3p LEPROT leptin receptor overlapping transcript HGNC:29477 details
hsa-miR-4760-3p HIPK3 homeodomain interacting protein kinase 3 HGNC:4915 details
hsa-miR-4760-3p GATAD2B GATA zinc finger domain containing 2B HGNC:30778 details
hsa-miR-4760-3p CENPQ centromere protein Q HGNC:21347 details
hsa-miR-4760-3p DYNC2LI1 dynein cytoplasmic 2 light intermediate chain 1 HGNC:24595 details
hsa-miR-4760-3p UBE2W ubiquitin conjugating enzyme E2 W HGNC:25616 details
hsa-miR-4760-3p CUBN cubilin HGNC:2548 details
hsa-miR-4760-3p NIPBL NIPBL cohesin loading factor HGNC:28862 details
hsa-miR-4760-3p TNPO3 transportin 3 HGNC:17103 details
hsa-miR-4760-3p MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like HGNC:21055 details
hsa-miR-4760-3p PICALM phosphatidylinositol binding clathrin assembly protein HGNC:15514 details
hsa-miR-4760-3p RBM41 RNA binding motif protein 41 HGNC:25617 details
hsa-miR-4760-3p ATG2A autophagy related 2A HGNC:29028 details
hsa-miR-4760-3p PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 HGNC:30263 details
hsa-miR-4760-3p SEMA3E semaphorin 3E HGNC:10727 details
hsa-miR-4760-3p UQCRFS1 ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 HGNC:12587 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab