miRNA Card

miRNA General Information
miRNA ID hsa-miR-4775
Description Homo sapiens miR-4775 stem-loop
Comment None
Experiment Illumina [1]
Sequence UUAAUUUUUUGUUUCGGUCACU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr13:31137383|31137502 hsa-miR-4775 0 1 0
chr15:44413719|44413937 hsa-miR-4775 0 1 0
chr1:1786377|1786521 hsa-miR-4775 0 1 0
chr4:107952401|107952609 hsa-miR-4775 0 1 0
chr16:17107398|17107567 hsa-miR-4775 0 1 0
chr14:20456708|20457042 hsa-miR-4775 0 1 0
chr1:220253708|220253843 hsa-miR-4775 0 1 0
chr1:1786377|1786528 hsa-miR-4775 0 1 0
chr4:79906609|79906819 hsa-miR-4775 0 1 0
chr6:122788596|122788712 hsa-miR-4775 0 1 0
chr10:62007388|62007513 hsa-miR-4775 0 1 0
chr16:72085511~72085663 hsa-miR-4775 0 1 0
chr19:34221518~34221659 hsa-miR-4775 0 1 0
chr14:105010084~105010301 hsa-miR-4775 0 1 0
chr13:31137383~31137502 hsa-miR-4775 0 1 0
chr1:151774193~151774745 hsa-miR-4775 0 1 0
chr15:101183399|101183547 hsa-miR-4775 0 1 0
chrX:54585389|54585521 hsa-miR-4775 0 1 0
chr16:10450268|10450464 hsa-miR-4775 0 1 0
chr15:90390848|90390945 hsa-miR-4775 0 1 0
chr1:43166484|43166598 hsa-miR-4775 0 1 0
chr11:95808719|95808838 hsa-miR-4775 0 1 0
chr1:220253685|220253843 hsa-miR-4775 0 1 0
chr1:156036304|156036486 hsa-miR-4775 0 1 0
chr22:36140378|36140479 hsa-miR-4775 0 1 0
chr6:7288636|7288833 hsa-miR-4775 0 1 0
chr20:44498694|44498846 hsa-miR-4775 0 1 0
chr2:85658606|85658800 hsa-miR-4775 0 1 0
chr9:131506114|131506453 hsa-miR-4775 0 1 0
chr7:22573613|22573766 hsa-miR-4775 0 1 0
chr6:130840380|130840562 hsa-miR-4775 0 1 0
chr3:183840281|183840439 hsa-miR-4775 0 1 0
chr2:85658561|85658649 hsa-miR-4775 0 1 0
chr6:131596656|131598381 hsa-miR-4775 0 1 0
chr1:220253703|220253843 hsa-miR-4775 0 1 0
chrX:48577703|48577861 hsa-miR-4775 0 1 0
chr20:44498694|44498808 hsa-miR-4775 -3 1 0
chr14:20456710|20457042 hsa-miR-4775 -9 1 0
chr1:153614846|153615016 hsa-miR-4775 0 1 0
chr16:70320518|70320884 hsa-miR-4775 0 1 0
chr1:220253681|220253843 hsa-miR-4775 0 1 0
chrX:100862263|100862469 hsa-miR-4775 0 1 0
chrX:100843536|100843659 hsa-miR-4775 0 1 0
chr1:52084115|52084287 hsa-miR-4775 0 1 0
chr10:112422017|112422408 hsa-miR-4775 0 1 0
chr12:47757407|47757504 hsa-miR-4775 0 1 0
chr13:31137356|31137490 hsa-miR-4775 0 1 0
chr19:34221518|34221659 hsa-miR-4775 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4775 AGTPBP1 ATP/GTP binding carboxypeptidase 1 HGNC:17258 details
hsa-miR-4775 DENND4C DENN domain containing 4C HGNC:26079 details
hsa-miR-4775 SLC7A14 solute carrier family 7 member 14 HGNC:29326 details
hsa-miR-4775 ZFP37 ZFP37 zinc finger protein HGNC:12863 details
hsa-miR-4775 KIF1C kinesin family member 1C HGNC:6317 details
hsa-miR-4775 NUP205 nucleoporin 205 HGNC:18658 details
hsa-miR-4775 CISD2 CDGSH iron sulfur domain 2 HGNC:24212 details
hsa-miR-4775 NCALD neurocalcin delta HGNC:7655 details
hsa-miR-4775 TM6SF1 transmembrane 6 superfamily member 1 HGNC:11860 details
hsa-miR-4775 RABGEF1 RAB guanine nucleotide exchange factor 1 HGNC:17676 details
hsa-miR-4775 details
hsa-miR-4775 RAD51 RAD51 recombinase HGNC:9817 details
hsa-miR-4775 ZDHHC20 zinc finger DHHC-type palmitoyltransferase 20 HGNC:20749 details
hsa-miR-4775 UHMK1 U2AF homology motif kinase 1 HGNC:19683 details
hsa-miR-4775 TMOD3 tropomodulin 3 HGNC:11873 details
hsa-miR-4775 SPNS1 sphingolipid transporter 1 (putative) HGNC:30621 details
hsa-miR-4775 SOCS7 suppressor of cytokine signaling 7 HGNC:29846 details
hsa-miR-4775 SGMS1 sphingomyelin synthase 1 HGNC:29799 details
hsa-miR-4775 RNF141 ring finger protein 141 HGNC:21159 details
hsa-miR-4775 MAP2K6 mitogen-activated protein kinase kinase 6 HGNC:6846 details
hsa-miR-4775 GSE1 Gse1 coiled-coil protein HGNC:28979 details
hsa-miR-4775 DDIT4 DNA damage inducible transcript 4 HGNC:24944 details
hsa-miR-4775 DDAH1 dimethylarginine dimethylaminohydrolase 1 HGNC:2715 details
hsa-miR-4775 AHR aryl hydrocarbon receptor HGNC:348 details
hsa-miR-4775 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 HGNC:20886 details
hsa-miR-4775 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 HGNC:9108 details
hsa-miR-4775 VPS4A vacuolar protein sorting 4 homolog A HGNC:13488 details
hsa-miR-4775 SCARB2 scavenger receptor class B member 2 HGNC:1665 details
hsa-miR-4775 HNRNPF heterogeneous nuclear ribonucleoprotein F HGNC:5039 details
hsa-miR-4775 GPATCH11 G-patch domain containing 11 HGNC:26768 details
hsa-miR-4775 TTC9 tetratricopeptide repeat domain 9 HGNC:20267 details
hsa-miR-4775 details
hsa-miR-4775 TET2 tet methylcytosine dioxygenase 2 HGNC:25941 details
hsa-miR-4775 ITPRIPL1 ITPRIP like 1 HGNC:29371 details
hsa-miR-4775 KHSRP KH-type splicing regulatory protein HGNC:6316 details
hsa-miR-4775 NFIB nuclear factor I B HGNC:7785 details
hsa-miR-4775 CENPQ centromere protein Q HGNC:21347 details
hsa-miR-4775 PGPEP1 pyroglutamyl-peptidase I HGNC:13568 details
hsa-miR-4775 ZNF519 zinc finger protein 519 HGNC:30574 details
hsa-miR-4775 GDPGP1 GDP-D-glucose phosphorylase 1 HGNC:34360 details
hsa-miR-4775 SLC25A45 solute carrier family 25 member 45 HGNC:27442 details
hsa-miR-4775 LYRM7 LYR motif containing 7 HGNC:28072 details
hsa-miR-4775 GPR141 G protein-coupled receptor 141 HGNC:19997 details
hsa-miR-4775 FAM120AOS family with sequence similarity 120A opposite strand HGNC:23389 details
hsa-miR-4775 details
hsa-miR-4775 FBXL13 F-box and leucine rich repeat protein 13 HGNC:21658 details
hsa-miR-4775 ALOX5AP arachidonate 5-lipoxygenase activating protein HGNC:436 details
hsa-miR-4775 GPN2 GPN-loop GTPase 2 HGNC:25513 details
hsa-miR-4775 RAB3B RAB3B, member RAS oncogene family HGNC:9778 details
hsa-miR-4775 PIGP phosphatidylinositol glycan anchor biosynthesis class P HGNC:3046 details
hsa-miR-4775 CTSB cathepsin B HGNC:2527 details
hsa-miR-4775 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 HGNC:7719 details
hsa-miR-4775 VHLL VHL like HGNC:30666 details
hsa-miR-4775 NRIP2 nuclear receptor interacting protein 2 HGNC:23078 details
hsa-miR-4775 TRIM72 tripartite motif containing 72 HGNC:32671 details
hsa-miR-4775 ZNF366 zinc finger protein 366 HGNC:18316 details
hsa-miR-4775 ZMIZ2 zinc finger MIZ-type containing 2 HGNC:22229 details
hsa-miR-4775 ABHD15 abhydrolase domain containing 15 HGNC:26971 details
hsa-miR-4775 CCL5 C-C motif chemokine ligand 5 HGNC:10632 details
hsa-miR-4775 THAP8 THAP domain containing 8 HGNC:23191 details
hsa-miR-4775 details
hsa-miR-4775 FAM161B FAM161 centrosomal protein B HGNC:19854 details
hsa-miR-4775 CASP10 caspase 10 HGNC:1500 details
hsa-miR-4775 FARSB phenylalanyl-tRNA synthetase subunit beta HGNC:17800 details
hsa-miR-4775 NOM1 nucleolar protein with MIF4G domain 1 HGNC:13244 details
hsa-miR-4775 NOA1 nitric oxide associated 1 HGNC:28473 details
hsa-miR-4775 CACNG1 calcium voltage-gated channel auxiliary subunit gamma 1 HGNC:1405 details
hsa-miR-4775 PNPLA3 patatin like phospholipase domain containing 3 HGNC:18590 details
hsa-miR-4775 MRPS10 mitochondrial ribosomal protein S10 HGNC:14502 details
hsa-miR-4775 SSBP2 single stranded DNA binding protein 2 HGNC:15831 details
hsa-miR-4775 SLC25A32 solute carrier family 25 member 32 HGNC:29683 details
hsa-miR-4775 SLC24A2 solute carrier family 24 member 2 HGNC:10976 details
hsa-miR-4775 PPARGC1A PPARG coactivator 1 alpha HGNC:9237 details
hsa-miR-4775 PHC3 polyhomeotic homolog 3 HGNC:15682 details
hsa-miR-4775 NPFFR1 neuropeptide FF receptor 1 HGNC:17425 details
hsa-miR-4775 MON1B MON1 homolog B, secretory trafficking associated HGNC:25020 details
hsa-miR-4775 MANEAL mannosidase endo-alpha like HGNC:26452 details
hsa-miR-4775 LRRC58 leucine rich repeat containing 58 HGNC:26968 details
hsa-miR-4775 GLO1 glyoxalase I HGNC:4323 details
hsa-miR-4775 GGCX gamma-glutamyl carboxylase HGNC:4247 details
hsa-miR-4775 DMXL1 Dmx like 1 HGNC:2937 details
hsa-miR-4775 CEP170 centrosomal protein 170 HGNC:28920 details
hsa-miR-4775 SPIC Spi-C transcription factor HGNC:29549 details
hsa-miR-4775 FBLN2 fibulin 2 HGNC:3601 details
hsa-miR-4775 KRTAP13-2 keratin associated protein 13-2 HGNC:18923 details
hsa-miR-4775 DCAF16 DDB1 and CUL4 associated factor 16 HGNC:25987 details
hsa-miR-4775 NUP58 nucleoporin 58 HGNC:20261 details
hsa-miR-4775 METTL8 methyltransferase 8, methylcytidine HGNC:25856 details
hsa-miR-4775 RAB13 RAB13, member RAS oncogene family HGNC:9762 details
hsa-miR-4775 KRBOX4 KRAB box domain containing 4 HGNC:26007 details
hsa-miR-4775 SKP1 S-phase kinase associated protein 1 HGNC:10899 details
hsa-miR-4775 MALT1 MALT1 paracaspase HGNC:6819 details
hsa-miR-4775 ZFP14 ZFP14 zinc finger protein HGNC:29312 details
hsa-miR-4775 TTR transthyretin HGNC:12405 details
hsa-miR-4775 TCN2 transcobalamin 2 HGNC:11653 details
hsa-miR-4775 TNPO1 transportin 1 HGNC:6401 details
hsa-miR-4775 TMEM67 transmembrane protein 67 HGNC:28396 details
hsa-miR-4775 SPRY4 sprouty RTK signaling antagonist 4 HGNC:15533 details
hsa-miR-4775 SLC38A9 solute carrier family 38 member 9 HGNC:26907 details
hsa-miR-4775 PLCL1 phospholipase C like 1 (inactive) HGNC:9063 details
hsa-miR-4775 PIWIL2 piwi like RNA-mediated gene silencing 2 HGNC:17644 details
hsa-miR-4775 MED13 mediator complex subunit 13 HGNC:22474 details
hsa-miR-4775 MBNL1 muscleblind like splicing regulator 1 HGNC:6923 details
hsa-miR-4775 MAPK8 mitogen-activated protein kinase 8 HGNC:6881 details
hsa-miR-4775 KLF12 Kruppel like factor 12 HGNC:6346 details
hsa-miR-4775 HABP4 hyaluronan binding protein 4 HGNC:17062 details
hsa-miR-4775 EPB41L1 erythrocyte membrane protein band 4.1 like 1 HGNC:3378 details
hsa-miR-4775 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 HGNC:24637 details
hsa-miR-4775 ANP32E acidic nuclear phosphoprotein 32 family member E HGNC:16673 details
hsa-miR-4775 HOXA10 homeobox A10 HGNC:5100 details
hsa-miR-4775 TNFRSF11A TNF receptor superfamily member 11a HGNC:11908 details
hsa-miR-4775 JCAD junctional cadherin 5 associated HGNC:29283 details
hsa-miR-4775 SEC23B SEC23 homolog B, COPII coat complex component HGNC:10702 details
hsa-miR-4775 DCTPP1 dCTP pyrophosphatase 1 HGNC:28777 details
hsa-miR-4775 TUB TUB bipartite transcription factor HGNC:12406 details
hsa-miR-4775 IL7R interleukin 7 receptor HGNC:6024 details
hsa-miR-4775 ZNF507 zinc finger protein 507 HGNC:23783 details
hsa-miR-4775 PTP4A1 protein tyrosine phosphatase 4A1 HGNC:9634 details
hsa-miR-4775 PARP1 poly(ADP-ribose) polymerase 1 HGNC:270 details
hsa-miR-4775 EPHA7 EPH receptor A7 HGNC:3390 details
hsa-miR-4775 CTTNBP2NL CTTNBP2 N-terminal like HGNC:25330 details
hsa-miR-4775 TRUB1 TruB pseudouridine synthase family member 1 HGNC:16060 details
hsa-miR-4775 MED10 mediator complex subunit 10 HGNC:28760 details
hsa-miR-4775 TVP23C trans-golgi network vesicle protein 23 homolog C HGNC:30453 details
hsa-miR-4775 TMEM30A transmembrane protein 30A HGNC:16667 details
hsa-miR-4775 TBX18 T-box transcription factor 18 HGNC:11595 details
hsa-miR-4775 SLC8A1 solute carrier family 8 member A1 HGNC:11068 details
hsa-miR-4775 SIAH2 siah E3 ubiquitin protein ligase 2 HGNC:10858 details
hsa-miR-4775 MFSD9 major facilitator superfamily domain containing 9 HGNC:28158 details
hsa-miR-4775 CRAMP1 cramped chromatin regulator homolog 1 HGNC:14122 details
hsa-miR-4775 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 HGNC:3093 details
hsa-miR-4775 TMEM120B transmembrane protein 120B HGNC:32008 details
hsa-miR-4775 SMIM9 small integral membrane protein 9 HGNC:41915 details
hsa-miR-4775 TNFSF14 TNF superfamily member 14 HGNC:11930 details
hsa-miR-4775 SRSF10 serine and arginine rich splicing factor 10 HGNC:16713 details
hsa-miR-4775 PAXBP1 PAX3 and PAX7 binding protein 1 HGNC:13579 details
hsa-miR-4775 LIMA1 LIM domain and actin binding 1 HGNC:24636 details
hsa-miR-4775 PBOV1 prostate and breast cancer overexpressed 1 HGNC:21079 details
hsa-miR-4775 NSD2 nuclear receptor binding SET domain protein 2 HGNC:12766 details
hsa-miR-4775 RDH11 retinol dehydrogenase 11 HGNC:17964 details
hsa-miR-4775 SVIP small VCP interacting protein HGNC:25238 details
hsa-miR-4775 HUWE1 HECT, UBA and WWE domain containing E3 ubiquitin protein ligase 1 HGNC:30892 details
hsa-miR-4775 PPWD1 peptidylprolyl isomerase domain and WD repeat containing 1 HGNC:28954 details
hsa-miR-4775 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon HGNC:12851 details
hsa-miR-4775 WTAP WT1 associated protein HGNC:16846 details
hsa-miR-4775 UBN2 ubinuclein 2 HGNC:21931 details
hsa-miR-4775 NHS NHS actin remodeling regulator HGNC:7820 details
hsa-miR-4775 RORA RAR related orphan receptor A HGNC:10258 details
hsa-miR-4775 RACGAP1 Rac GTPase activating protein 1 HGNC:9804 details
hsa-miR-4775 PTBP2 polypyrimidine tract binding protein 2 HGNC:17662 details
hsa-miR-4775 MYADM myeloid associated differentiation marker HGNC:7544 details
hsa-miR-4775 ALG10B ALG10 alpha-1,2-glucosyltransferase B HGNC:31088 details
hsa-miR-4775 MRPL19 mitochondrial ribosomal protein L19 HGNC:14052 details
hsa-miR-4775 LZIC leucine zipper and CTNNBIP1 domain containing HGNC:17497 details
hsa-miR-4775 FAM104A family with sequence similarity 104 member A HGNC:25918 details
hsa-miR-4775 ATF7IP2 activating transcription factor 7 interacting protein 2 HGNC:20397 details
hsa-miR-4775 MFSD14A major facilitator superfamily domain containing 14A HGNC:23363 details
hsa-miR-4775 PLA2G7 phospholipase A2 group VII HGNC:9040 details
hsa-miR-4775 LUC7L2 LUC7 like 2, pre-mRNA splicing factor HGNC:21608 details
hsa-miR-4775 SH3KBP1 SH3 domain containing kinase binding protein 1 HGNC:13867 details
hsa-miR-4775 PDE4C phosphodiesterase 4C HGNC:8782 details
hsa-miR-4775 details
hsa-miR-4775 TEAD3 TEA domain transcription factor 3 HGNC:11716 details
hsa-miR-4775 NECTIN4 nectin cell adhesion molecule 4 HGNC:19688 details
hsa-miR-4775 GNG12 G protein subunit gamma 12 HGNC:19663 details
hsa-miR-4775 ZNF383 zinc finger protein 383 HGNC:18609 details
hsa-miR-4775 FSD2 fibronectin type III and SPRY domain containing 2 HGNC:18024 details
hsa-miR-4775 details
hsa-miR-4775 SLC25A4 solute carrier family 25 member 4 HGNC:10990 details
hsa-miR-4775 details
hsa-miR-4775 ZNF573 zinc finger protein 573 HGNC:26420 details
hsa-miR-4775 CTU1 cytosolic thiouridylase subunit 1 HGNC:29590 details
hsa-miR-4775 PIGM phosphatidylinositol glycan anchor biosynthesis class M HGNC:18858 details
hsa-miR-4775 WNK1 WNK lysine deficient protein kinase 1 HGNC:14540 details
hsa-miR-4775 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 HGNC:220 details
hsa-miR-4775 GRIK4 glutamate ionotropic receptor kainate type subunit 4 HGNC:4582 details
hsa-miR-4775 PRR15L proline rich 15 like HGNC:28149 details
hsa-miR-4775 SSPN sarcospan HGNC:11322 details
hsa-miR-4775 ZBTB7A zinc finger and BTB domain containing 7A HGNC:18078 details
hsa-miR-4775 YIPF4 Yip1 domain family member 4 HGNC:28145 details
hsa-miR-4775 PLEKHA2 pleckstrin homology domain containing A2 HGNC:14336 details
hsa-miR-4775 PPIL2 peptidylprolyl isomerase like 2 HGNC:9261 details
hsa-miR-4775 CTNNBL1 catenin beta like 1 HGNC:15879 details
hsa-miR-4775 PPP2R1A protein phosphatase 2 scaffold subunit Aalpha HGNC:9302 details
hsa-miR-4775 FAM8A1 family with sequence similarity 8 member A1 HGNC:16372 details
hsa-miR-4775 RAB9B RAB9B, member RAS oncogene family HGNC:14090 details
hsa-miR-4775 PRKD2 protein kinase D2 HGNC:17293 details
hsa-miR-4775 HYPK huntingtin interacting protein K HGNC:18418 details
hsa-miR-4775 POLR3A RNA polymerase III subunit A HGNC:30074 details
hsa-miR-4775 TSHZ2 teashirt zinc finger homeobox 2 HGNC:13010 details
hsa-miR-4775 SLC35E4 solute carrier family 35 member E4 HGNC:17058 details
hsa-miR-4775 THG1L tRNA-histidine guanylyltransferase 1 like HGNC:26053 details
hsa-miR-4775 MXI1 MAX interactor 1, dimerization protein HGNC:7534 details
hsa-miR-4775 EPGN epithelial mitogen HGNC:17470 details
hsa-miR-4775 PCDH11X protocadherin 11 X-linked HGNC:8656 details
hsa-miR-4775 TRIM38 tripartite motif containing 38 HGNC:10059 details
hsa-miR-4775 OR9Q1 olfactory receptor family 9 subfamily Q member 1 HGNC:14724 details
hsa-miR-4775 IREB2 iron responsive element binding protein 2 HGNC:6115 details
hsa-miR-4775 USP37 ubiquitin specific peptidase 37 HGNC:20063 details
hsa-miR-4775 details
hsa-miR-4775 TMEM33 transmembrane protein 33 HGNC:25541 details
hsa-miR-4775 SPPL3 signal peptide peptidase like 3 HGNC:30424 details
hsa-miR-4775 SMU1 SMU1 DNA replication regulator and spliceosomal factor HGNC:18247 details
hsa-miR-4775 RWDD1 RWD domain containing 1 HGNC:20993 details
hsa-miR-4775 PCYOX1 prenylcysteine oxidase 1 HGNC:20588 details
hsa-miR-4775 PCDH11Y protocadherin 11 Y-linked HGNC:15813 details
hsa-miR-4775 OIP5 Opa interacting protein 5 HGNC:20300 details
hsa-miR-4775 GMEB1 glucocorticoid modulatory element binding protein 1 HGNC:4370 details
hsa-miR-4775 BBX BBX high mobility group box domain containing HGNC:14422 details
hsa-miR-4775 KCNT2 potassium sodium-activated channel subfamily T member 2 HGNC:18866 details
hsa-miR-4775 RHOBTB3 Rho related BTB domain containing 3 HGNC:18757 details
hsa-miR-4775 KREMEN1 kringle containing transmembrane protein 1 HGNC:17550 details
hsa-miR-4775 KIAA0930 KIAA0930 HGNC:1314 details
hsa-miR-4775 GRAP2 GRB2 related adaptor protein 2 HGNC:4563 details
hsa-miR-4775 AEBP2 AE binding protein 2 HGNC:24051 details
hsa-miR-4775 NFRKB nuclear factor related to kappaB binding protein HGNC:7802 details
hsa-miR-4775 RAB10 RAB10, member RAS oncogene family HGNC:9759 details
hsa-miR-4775 SLC35F6 solute carrier family 35 member F6 HGNC:26055 details
hsa-miR-4775 OGFOD3 2-oxoglutarate and iron dependent oxygenase domain containing 3 HGNC:26174 details
hsa-miR-4775 ERVV-1 endogenous retrovirus group V member 1, envelope HGNC:26501 details
hsa-miR-4775 C9orf64 chromosome 9 open reading frame 64 HGNC:28144 details
hsa-miR-4775 KIAA1614 KIAA1614 HGNC:29327 details
hsa-miR-4775 SELENOI selenoprotein I HGNC:29361 details
hsa-miR-4775 C21orf58 chromosome 21 open reading frame 58 HGNC:1300 details
hsa-miR-4775 RHOH ras homolog family member H HGNC:686 details
hsa-miR-4775 TTC38 tetratricopeptide repeat domain 38 HGNC:26082 details
hsa-miR-4775 LINC00632 long intergenic non-protein coding RNA 632 HGNC:27865 details
hsa-miR-4775 NPR1 natriuretic peptide receptor 1 HGNC:7943 details
hsa-miR-4775 NQO2 N-ribosyldihydronicotinamide:quinone reductase 2 HGNC:7856 details
hsa-miR-4775 CHRNB1 cholinergic receptor nicotinic beta 1 subunit HGNC:1961 details
hsa-miR-4775 TK1 thymidine kinase 1 HGNC:11830 details
hsa-miR-4775 WDR59 WD repeat domain 59 HGNC:25706 details
hsa-miR-4775 WASL WASP like actin nucleation promoting factor HGNC:12735 details
hsa-miR-4775 TM4SF1 transmembrane 4 L six family member 1 HGNC:11853 details
hsa-miR-4775 SMNDC1 survival motor neuron domain containing 1 HGNC:16900 details
hsa-miR-4775 details
hsa-miR-4775 NHLRC2 NHL repeat containing 2 HGNC:24731 details
hsa-miR-4775 NEO1 neogenin 1 HGNC:7754 details
hsa-miR-4775 MOGAT1 monoacylglycerol O-acyltransferase 1 HGNC:18210 details
hsa-miR-4775 GSR glutathione-disulfide reductase HGNC:4623 details
hsa-miR-4775 APOL4 apolipoprotein L4 HGNC:14867 details
hsa-miR-4775 ZNF260 zinc finger protein 260 HGNC:13499 details
hsa-miR-4775 NMNAT1 nicotinamide nucleotide adenylyltransferase 1 HGNC:17877 details
hsa-miR-4775 SPN sialophorin HGNC:11249 details
hsa-miR-4775 KIAA1958 KIAA1958 HGNC:23427 details
hsa-miR-4775 ZNF71 zinc finger protein 71 HGNC:13141 details
hsa-miR-4775 AMOTL2 angiomotin like 2 HGNC:17812 details
hsa-miR-4775 SYT13 synaptotagmin 13 HGNC:14962 details
hsa-miR-4775 SGIP1 SH3GL interacting endocytic adaptor 1 HGNC:25412 details
hsa-miR-4775 NCKAP1 NCK associated protein 1 HGNC:7666 details
hsa-miR-4775 SNED1 sushi, nidogen and EGF like domains 1 HGNC:24696 details
hsa-miR-4775 ZNF264 zinc finger protein 264 HGNC:13057 details
hsa-miR-4775 LAPTM4B lysosomal protein transmembrane 4 beta HGNC:13646 details
hsa-miR-4775 FHL2 four and a half LIM domains 2 HGNC:3703 details
hsa-miR-4775 GPR155 G protein-coupled receptor 155 HGNC:22951 details
hsa-miR-4775 MUC20 mucin 20, cell surface associated HGNC:23282 details
hsa-miR-4775 CHORDC1 cysteine and histidine rich domain containing 1 HGNC:14525 details
hsa-miR-4775 ARPC2 actin related protein 2/3 complex subunit 2 HGNC:705 details
hsa-miR-4775 MSH3 mutS homolog 3 HGNC:7326 details
hsa-miR-4775 DKK3 dickkopf WNT signaling pathway inhibitor 3 HGNC:2893 details
hsa-miR-4775 VKORC1L1 vitamin K epoxide reductase complex subunit 1 like 1 HGNC:21492 details
hsa-miR-4775 PEX11A peroxisomal biogenesis factor 11 alpha HGNC:8852 details
hsa-miR-4775 LMBRD2 LMBR1 domain containing 2 HGNC:25287 details
hsa-miR-4775 SMIM14 small integral membrane protein 14 HGNC:27321 details
hsa-miR-4775 TIMM29 translocase of inner mitochondrial membrane 29 HGNC:25152 details
hsa-miR-4775 PALLD palladin, cytoskeletal associated protein HGNC:17068 details
hsa-miR-4775 PYROXD1 pyridine nucleotide-disulphide oxidoreductase domain 1 HGNC:26162 details
hsa-miR-4775 MAPK14 mitogen-activated protein kinase 14 HGNC:6876 details
hsa-miR-4775 WTIP WT1 interacting protein HGNC:20964 details
hsa-miR-4775 SMAD7 SMAD family member 7 HGNC:6773 details
hsa-miR-4775 CHDH choline dehydrogenase HGNC:24288 details
hsa-miR-4775 HMGA2 high mobility group AT-hook 2 HGNC:5009 details
hsa-miR-4775 PRRC2B proline rich coiled-coil 2B HGNC:28121 details
hsa-miR-4775 RTN3 reticulon 3 HGNC:10469 details
hsa-miR-4775 MAGEA3 MAGE family member A3 HGNC:6801 details
hsa-miR-4775 MAGEA6 MAGE family member A6 HGNC:6804 details
hsa-miR-4775 MAP3K5 mitogen-activated protein kinase kinase kinase 5 HGNC:6857 details
hsa-miR-4775 MRPL50 mitochondrial ribosomal protein L50 HGNC:16654 details
hsa-miR-4775 RAP2C RAP2C, member of RAS oncogene family HGNC:21165 details
hsa-miR-4775 RIMS4 regulating synaptic membrane exocytosis 4 HGNC:16183 details
hsa-miR-4775 ACOT2 acyl-CoA thioesterase 2 HGNC:18431 details
hsa-miR-4775 DSN1 DSN1 component of MIS12 kinetochore complex HGNC:16165 details
hsa-miR-4775 EPB42 erythrocyte membrane protein band 4.2 HGNC:3381 details
hsa-miR-4775 GSKIP GSK3B interacting protein HGNC:20343 details
hsa-miR-4775 details
hsa-miR-4775 INTU inturned planar cell polarity protein HGNC:29239 details
hsa-miR-4775 LETMD1 LETM1 domain containing 1 HGNC:24241 details
hsa-miR-4775 LILRB1 leukocyte immunoglobulin like receptor B1 HGNC:6605 details
hsa-miR-4775 MIXL1 Mix paired-like homeobox HGNC:13363 details
hsa-miR-4775 NUCB1 nucleobindin 1 HGNC:8043 details
hsa-miR-4775 POU2F1 POU class 2 homeobox 1 HGNC:9212 details
hsa-miR-4775 RASA4 RAS p21 protein activator 4 HGNC:23181 details
hsa-miR-4775 SOGA3 SOGA family member 3 HGNC:21494 details
hsa-miR-4775 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 HGNC:15663 details
hsa-miR-4775 WAC WW domain containing adaptor with coiled-coil HGNC:17327 details
hsa-miR-4775 ZNF276 zinc finger protein 276 HGNC:23330 details
hsa-miR-4775 FANCF FA complementation group F HGNC:3587 details
hsa-miR-4775 GNAQ G protein subunit alpha q HGNC:4390 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab