miRNA Card

miRNA General Information
miRNA ID hsa-miR-4777-5p
Description Homo sapiens miR-4777 stem-loop
Comment None
Experiment Illumina [1]
Sequence UUCUAGAUGAGAGAUAUAUAUA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr8:117281653|117281807 hsa-miR-4777-5p 1 1 0
chrX:3928004|3928110 hsa-miR-4777-5p 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr3:191397920|191398053 hsa-miR-4777-5p 0 1 0
chr3:9759488|9759691 hsa-miR-4777-5p 0 1 0
chr22:37807182|37807259 hsa-miR-4777-5p 0 1 0
chr17:41822520|41822680 hsa-miR-4777-5p 0 1 0
chr14:87986542|87988164 hsa-miR-4777-5p 0 1 0
chr1:43992589|43993947 hsa-miR-4777-5p 0 1 0
chr4:94252642|94252855 hsa-miR-4777-5p 0 1 0
chr10:27196130|27196348 hsa-miR-4777-5p 0 1 0
chr22:49882947|49883075 hsa-miR-4777-5p 0 1 0
chr8:73324031|73324190 hsa-miR-4777-5p 0 1 0
chr5:154057157|154057257 hsa-miR-4777-5p 0 1 0
chr17:41822544|41822680 hsa-miR-4777-5p 0 1 0
chr8:89772667|89772828 hsa-miR-4777-5p 0 1 0
chr17:43766550|43766742 hsa-miR-4777-5p 0 1 0
chr2:27131035|27131164 hsa-miR-4777-5p 0 1 0
chr20:46361102|46361203 hsa-miR-4777-5p 0 1 0
chr17:59840228|59840444 hsa-miR-4777-5p 0 1 0
chr19:54355131|54355255 hsa-miR-4777-5p 0 1 0
chr12:12475870|12476158 hsa-miR-4777-5p 0 1 0
chr3:47689387|47693258 hsa-miR-4777-5p 0 1 0
chr7:92457739|92458035 hsa-miR-4777-5p 0 1 0
chr11:118494355|118494737 hsa-miR-4777-5p 0 1 0
chr22:40334504|40334778 hsa-miR-4777-5p 0 1 0
chr1:171540940|171541061 hsa-miR-4777-5p 0 1 0
chr15:93026065|93026267 hsa-miR-4777-5p 0 1 0
chr14:99679979|99680129 hsa-miR-4777-5p 0 1 0
chr2:219503730|219503838 hsa-miR-4777-5p 0 1 0
chr2:202275113~202275189 hsa-miR-4777-5p 0 1 0
chr8:73324031~73324190 hsa-miR-4777-5p 0 1 0
chr12:132721403~132721523 hsa-miR-4777-5p 0 1 0
chr14:87986542~87988164 hsa-miR-4777-5p 0 1 0
chr17:3036214~3036316 hsa-miR-4777-5p 0 1 0
chr3:58412322|58412470 hsa-miR-4777-5p 0 1 0
chr11:64769223|64769496 hsa-miR-4777-5p 0 1 0
chr2:177234304|177234538 hsa-miR-4777-5p 0 1 0
chr11:63887731|63887812 hsa-miR-4777-5p 0 1 0
chr5:76464362|76464562 hsa-miR-4777-5p 0 1 0
chr1:193141919|193142066 hsa-miR-4777-5p 0 1 0
chr19:54355056|54355242 hsa-miR-4777-5p 0 1 0
chr12:119680859|119680959 hsa-miR-4777-5p 0 1 0
chr3:41230561|41230748 hsa-miR-4777-5p 0 1 0
chr17:15505282|15505423 hsa-miR-4777-5p 0 1 0
chr9:83971917|83972115 hsa-miR-4777-5p 0 1 0
chr10:79612410|79613266 hsa-miR-4777-5p 0 1 0
chr21:33252660|33252792 hsa-miR-4777-5p 0 1 0
chr17:38322775|38322968 hsa-miR-4777-5p 0 1 0
chr1:154962488|154962717 hsa-miR-4777-5p 0 1 0
chr14:36294665|36294801 hsa-miR-4777-5p 0 1 0
chr1:39851121|39851250 hsa-miR-4777-5p 0 1 0
chr1:171540957|171541061 hsa-miR-4777-5p 0 1 0
chr11:79185996|79186131 hsa-miR-4777-5p 0 1 0
chr5:112163076|112163235 hsa-miR-4777-5p 0 1 0
chr11:5698315|5698417 hsa-miR-4777-5p 0 1 0
chr10:79558052|79558907 hsa-miR-4777-5p 0 1 0
chr21:33263237|33263391 hsa-miR-4777-5p 0 1 0
chr11:5698315|5698545 hsa-miR-4777-5p 0 1 0
chr2:27377927|27378036 hsa-miR-4777-5p 0 1 0
chr22:42585432|42585592 hsa-miR-4777-5p 0 1 0
chr19:54354975|54355242 hsa-miR-4777-5p 0 1 0
chr1:19219610|19220783 hsa-miR-4777-5p 0 1 0
chr1:171540999|171541076 hsa-miR-4777-5p -8 1 0
chr10:79612372|79613266 hsa-miR-4777-5p -4 1 0
chr1:16995228|16995327 hsa-miR-4777-5p 0 1 0
chr19:34451981|34452147 hsa-miR-4777-5p 0 1 0
chr7:73611970|73612067 hsa-miR-4777-5p 0 1 0
chr7:92457795|92457943 hsa-miR-4777-5p 0 1 0
chr3:186677131|186677270 hsa-miR-4777-5p 0 1 0
chrX:14920633|14920758 hsa-miR-4777-5p 0 1 0
chr6:13789542|13789712 hsa-miR-4777-5p 0 1 0
chr17:36599741|36600194 hsa-miR-4777-5p 0 1 0
chr11:59638196|59638406 hsa-miR-4777-5p 0 1 0
chr1:171540920|171541076 hsa-miR-4777-5p 0 1 0
chr5:123025811|123025968 hsa-miR-4777-5p 0 1 0
chr6:89662792|89662896 hsa-miR-4777-5p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4777-5p NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 HGNC:7719 details
hsa-miR-4777-5p TRPV2 transient receptor potential cation channel subfamily V member 2 HGNC:18082 details
hsa-miR-4777-5p HPS4 HPS4 biogenesis of lysosomal organelles complex 3 subunit 2 HGNC:15844 details
hsa-miR-4777-5p NDUFC2-KCTD14 NDUFC2-KCTD14 readthrough HGNC:42956 details
hsa-miR-4777-5p ZBTB5 zinc finger and BTB domain containing 5 HGNC:23836 details
hsa-miR-4777-5p DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 HGNC:6968 details
hsa-miR-4777-5p CYGB cytoglobin HGNC:16505 details
hsa-miR-4777-5p PPP2CA protein phosphatase 2 catalytic subunit alpha HGNC:9299 details
hsa-miR-4777-5p details
hsa-miR-4777-5p AMD1 adenosylmethionine decarboxylase 1 HGNC:457 details
hsa-miR-4777-5p RPRD2 regulation of nuclear pre-mRNA domain containing 2 HGNC:29039 details
hsa-miR-4777-5p CDC5L cell division cycle 5 like HGNC:1743 details
hsa-miR-4777-5p NHSL2 NHS like 2 HGNC:33737 details
hsa-miR-4777-5p PCSK1 proprotein convertase subtilisin/kexin type 1 HGNC:8743 details
hsa-miR-4777-5p HEPHL1 hephaestin like 1 HGNC:30477 details
hsa-miR-4777-5p EIF4H eukaryotic translation initiation factor 4H HGNC:12741 details
hsa-miR-4777-5p BZW1 basic leucine zipper and W2 domains 1 HGNC:18380 details
hsa-miR-4777-5p CBX4 chromobox 4 HGNC:1554 details
hsa-miR-4777-5p CCNG1 cyclin G1 HGNC:1592 details
hsa-miR-4777-5p BEND4 BEN domain containing 4 HGNC:23815 details
hsa-miR-4777-5p PPP1R12A protein phosphatase 1 regulatory subunit 12A HGNC:7618 details
hsa-miR-4777-5p PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 HGNC:9108 details
hsa-miR-4777-5p details
hsa-miR-4777-5p CDC23 cell division cycle 23 HGNC:1724 details
hsa-miR-4777-5p TOB2 transducer of ERBB2, 2 HGNC:11980 details
hsa-miR-4777-5p BBS10 Bardet-Biedl syndrome 10 HGNC:26291 details
hsa-miR-4777-5p TAF7 TATA-box binding protein associated factor 7 HGNC:11541 details
hsa-miR-4777-5p TEF TEF transcription factor, PAR bZIP family member HGNC:11722 details
hsa-miR-4777-5p GTPBP3 GTP binding protein 3, mitochondrial HGNC:14880 details
hsa-miR-4777-5p GRPEL2 GrpE like 2, mitochondrial HGNC:21060 details
hsa-miR-4777-5p AURKA aurora kinase A HGNC:11393 details
hsa-miR-4777-5p USP45 ubiquitin specific peptidase 45 HGNC:20080 details
hsa-miR-4777-5p RPL41 ribosomal protein L41 HGNC:10354 details
hsa-miR-4777-5p TNFRSF10B TNF receptor superfamily member 10b HGNC:11905 details
hsa-miR-4777-5p SLC35G1 solute carrier family 35 member G1 HGNC:26607 details
hsa-miR-4777-5p ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide HGNC:253 details
hsa-miR-4777-5p TNFAIP3 TNF alpha induced protein 3 HGNC:11896 details
hsa-miR-4777-5p TAOK1 TAO kinase 1 HGNC:29259 details
hsa-miR-4777-5p TAS2R30 taste 2 receptor member 30 HGNC:19112 details
hsa-miR-4777-5p details
hsa-miR-4777-5p RABGEF1 RAB guanine nucleotide exchange factor 1 HGNC:17676 details
hsa-miR-4777-5p HOOK3 hook microtubule tethering protein 3 HGNC:23576 details
hsa-miR-4777-5p ATP11A ATPase phospholipid transporting 11A HGNC:13552 details
hsa-miR-4777-5p MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like HGNC:21055 details
hsa-miR-4777-5p RANBP6 RAN binding protein 6 HGNC:9851 details
hsa-miR-4777-5p C10orf105 chromosome 10 open reading frame 105 HGNC:20304 details
hsa-miR-4777-5p PPP1R3E protein phosphatase 1 regulatory subunit 3E HGNC:14943 details
hsa-miR-4777-5p ACACA acetyl-CoA carboxylase alpha HGNC:84 details
hsa-miR-4777-5p GATAD2A GATA zinc finger domain containing 2A HGNC:29989 details
hsa-miR-4777-5p NCAN neurocan HGNC:2465 details
hsa-miR-4777-5p CALM1 calmodulin 1 HGNC:1442 details
hsa-miR-4777-5p OCLN occludin HGNC:8104 details
hsa-miR-4777-5p RPL13A ribosomal protein L13a HGNC:10304 details
hsa-miR-4777-5p SELENON selenoprotein N HGNC:15999 details
hsa-miR-4777-5p details
hsa-miR-4777-5p NFATC3 nuclear factor of activated T cells 3 HGNC:7777 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab