miRNA Card

miRNA General Information
miRNA ID hsa-miR-4789-3p
Description Homo sapiens miR-4789 stem-loop
Comment None
Experiment Illumina [1]
Sequence CACACAUAGCAGGUGUAUAUA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr17:64782043|64782205 hsa-miR-4789-3p 0 1 0
chrX:53233936|53234185 hsa-miR-4789-3p 0 1 0
chr16:89645497|89645644 hsa-miR-4789-3p 0 1 0
chr8:20248419|20248578 hsa-miR-4789-3p 0 1 0
chr22:31345356|31345614 hsa-miR-4789-3p 0 1 0
chr1:231000271|231000443 hsa-miR-4789-3p 0 1 0
chr1:231000318|231000443 hsa-miR-4789-3p 0 1 0
chr11:76385332|76385480 hsa-miR-4789-3p 0 1 0
chr12:120216088|120216321 hsa-miR-4789-3p 0 1 0
chr6:39195963|39229015 hsa-miR-4789-3p 0 1 0
chr19:58549985|58550210 hsa-miR-4789-3p 0 1 0
chr4:184628127|184628277 hsa-miR-4789-3p 0 1 0
chr16:2837735|2837851 hsa-miR-4789-3p 0 1 0
chr7:151378022|151378293 hsa-miR-4789-3p 0 1 0
chr11:124146570|124146741 hsa-miR-4789-3p 0 1 0
chr9:113043290|113043373 hsa-miR-4789-3p 0 1 0
chr3:184572513|184572632 hsa-miR-4789-3p 0 1 0
chr8:142657479|142657626 hsa-miR-4789-3p 1 0 0
chr1:112564062|112564264 hsa-miR-4789-3p 1 0 0
chr2:226732132|226732310 hsa-miR-4789-3p 1 0 0
chr9:133470159|133470283 hsa-miR-4789-3p 0 1 0
chr20:36528002|36528254 hsa-miR-4789-3p 0 1 0
chr13:110523673|110523925 hsa-miR-4789-3p 0 1 0
chr1:155330441|155330605 hsa-miR-4789-3p 0 1 0
chr19:48923183|48923257 hsa-miR-4789-3p 0 1 0
chr1:231000337|231000443 hsa-miR-4789-3p 0 1 0
chr1:1598496|1598696 hsa-miR-4789-3p 0 1 0
chr19:48473931|48474321 hsa-miR-4789-3p 0 1 0
chr14:59368837|59369057 hsa-miR-4789-3p 0 1 0
chr12:120224151|120224306 hsa-miR-4789-3p 0 1 0
chr6:35295318|35295450 hsa-miR-4789-3p 0 1 0
chrX:53405329|53405543 hsa-miR-4789-3p 0 1 0
chr18:26553458|26553607 hsa-miR-4789-3p 0 1 0
chr15:65577396|65577519 hsa-miR-4789-3p 0 1 0
chr11:34662699|34662796 hsa-miR-4789-3p 0 1 0
chr2:39474580|39474698 hsa-miR-4789-3p 0 1 0
chr1:26123386|26123613 hsa-miR-4789-3p 0 1 0
chr1:45627975|45628115 hsa-miR-4789-3p 0 1 0
chr1:231000172|231000443 hsa-miR-4789-3p 0 1 0
chr11:65795828|65795979 hsa-miR-4789-3p 0 1 0
chrX:119663482|119663608 hsa-miR-4789-3p 0 1 0
chr3:65452922|65453178 hsa-miR-4789-3p 0 1 0
chrX:73845176|73845316 hsa-miR-4789-3p 0 1 0
chr11:124146570|124146779 hsa-miR-4789-3p 0 1 0
chr9:2192824|2193031 hsa-miR-4789-3p 0 1 0
chr11:60394363|60394569 hsa-miR-4789-3p 0 1 0
chr11:6600532|6600716 hsa-miR-4789-3p 0 1 0
chr19:46775042|46775159 hsa-miR-4789-3p 0 1 0
chr7:77329966|77330053 hsa-miR-4789-3p 0 1 0
chr3:193849626|193849750 hsa-miR-4789-3p 0 1 0
chr7:158733120~158733242 hsa-miR-4789-3p 0 1 0
chr8:27733821~27734057 hsa-miR-4789-3p 0 1 0
chr9:93121776~93121933 hsa-miR-4789-3p 0 1 0
chr15:65577346~65577519 hsa-miR-4789-3p 0 1 0
chr1:231000318~231000443 hsa-miR-4789-3p 0 1 0
chr11:34662699~34662796 hsa-miR-4789-3p 0 1 0
chr17:79936868~79936966 hsa-miR-4789-3p 0 1 0
chr6:42866813~42866964 hsa-miR-4789-3p 0 1 0
chr6:170283735~170283875 hsa-miR-4789-3p 0 1 0
chr10:102814908~102815044 hsa-miR-4789-3p 0 1 0
chr3:140575786~140575974 hsa-miR-4789-3p 0 1 0
chr11:66286941~66287067 hsa-miR-4789-3p 0 1 0
chr2:226732132~226732310 hsa-miR-4789-3p 0 1 0
chr17:79936845~79936966 hsa-miR-4789-3p 0 1 0
chr17:4733826|4733938 hsa-miR-4789-3p 0 1 0
chr3:128813548~128813727 hsa-miR-4789-3p 0 1 0
chr1:109630715~109631040 hsa-miR-4789-3p 0 1 0
chr6:30492803~30493047 hsa-miR-4789-3p 0 1 0
chr10:95237963~95238080 hsa-miR-4789-3p 0 1 0
chr6:170582846~170582999 hsa-miR-4789-3p 0 1 0
chr16:85801256|85801379 hsa-miR-4789-3p 1 0 0
chr19:45470381|45470700 hsa-miR-4789-3p 0 1 0
chr19:51643567|51643837 hsa-miR-4789-3p 0 1 0
chr9:77753126|77753327 hsa-miR-4789-3p 0 1 0
chr6:30492757|30492930 hsa-miR-4789-3p 0 1 0
chr11:86335557|86335811 hsa-miR-4789-3p 0 1 0
chr20:35628926|35629177 hsa-miR-4789-3p 0 1 0
chr11:1915081|1915478 hsa-miR-4789-3p 0 1 0
chr1:155736281|155736405 hsa-miR-4789-3p 0 1 0
chr7:66283288|66283418 hsa-miR-4789-3p 0 1 0
chr20:46357829|46358030 hsa-miR-4789-3p 0 1 0
chr11:65504665|65504808 hsa-miR-4789-3p 0 1 0
chr17:49827904|49828017 hsa-miR-4789-3p 0 1 0
chr12:75480783|75481967 hsa-miR-4789-3p 0 1 0
chr9:97675422|97675632 hsa-miR-4789-3p 0 1 0
chr19:46382515|46382754 hsa-miR-4789-3p 0 1 0
chr1:12201498|12201624 hsa-miR-4789-3p 1 0 0
chr10:133443777|133443958 hsa-miR-4789-3p 0 1 0
chr1:12311566|12311909 hsa-miR-4789-3p 0 1 0
chr13:113980103|113980221 hsa-miR-4789-3p 0 1 0
chr17:72675339|72675515 hsa-miR-4789-3p 0 1 0
chr11:123058402|123058674 hsa-miR-4789-3p 0 1 0
chr2:157409003|157409166 hsa-miR-4789-3p 0 1 0
chr12:2309353|2309545 hsa-miR-4789-3p 0 1 0
chr3:134541099|134541185 hsa-miR-4789-3p 0 1 0
chr1:156220508|156220744 hsa-miR-4789-3p 0 1 0
chr3:33048386|33048553 hsa-miR-4789-3p 0 1 0
chrX:131794154|131794296 hsa-miR-4789-3p 0 1 0
chr6:36720740|36721010 hsa-miR-4789-3p 0 1 0
chr19:48190994|48191183 hsa-miR-4789-3p 0 1 0
chr14:24179897|24179983 hsa-miR-4789-3p 0 1 0
chr11:791716|791832 hsa-miR-4789-3p 0 1 0
chrX:74106503|74106728 hsa-miR-4789-3p 0 1 0
chr16:79661367|79661698 hsa-miR-4789-3p 0 1 0
chr6:20949388|20949524 hsa-miR-4789-3p 0 1 0
chr22:20064953|20065101 hsa-miR-4789-3p 0 1 0
chr11:76970514|76970716 hsa-miR-4789-3p 0 1 0
chr11:1914751|1914948 hsa-miR-4789-3p 0 1 0
chr19:3956340|3956471 hsa-miR-4789-3p 0 1 0
chr17:76270828|76270952 hsa-miR-4789-3p 0 1 0
chr6:30686132|30686422 hsa-miR-4789-3p 1 0 0
chr2:1529570|1534285 hsa-miR-4789-3p 1 0 0
chr3:194202922|194203014 hsa-miR-4789-3p 1 0 0
chr6:30686138|30686260 hsa-miR-4789-3p 1 0 0
chr11:290838|291162 hsa-miR-4789-3p 1 0 0
chr18:76362073|76362184 hsa-miR-4789-3p 0 1 0
chr9:7798495|7798604 hsa-miR-4789-3p 0 1 0
chr2:119980114|119980377 hsa-miR-4789-3p 0 1 0
chr2:85666105|85666282 hsa-miR-4789-3p 0 1 0
chr11:73409535|73409661 hsa-miR-4789-3p 0 1 0
chr21:41885963|41886111 hsa-miR-4789-3p 0 1 0
chr7:143286822|143286990 hsa-miR-4789-3p 0 1 0
chr17:18209677|18209918 hsa-miR-4789-3p 0 1 0
chr4:54739643|54739740 hsa-miR-4789-3p 0 1 0
chr6:30492803|30492951 hsa-miR-4789-3p 0 1 0
chr1:150111192|150111309 hsa-miR-4789-3p 0 1 0
chr1:51287770|51287945 hsa-miR-4789-3p 0 1 0
chr19:42079568|42079812 hsa-miR-4789-3p 0 1 0
chr7:30446009|30446163 hsa-miR-4789-3p 0 1 0
chr20:36527955|36528135 hsa-miR-4789-3p 0 1 0
chr1:11080764|11081156 hsa-miR-4789-3p 0 1 0
chr12:112971940|112972252 hsa-miR-4789-3p 0 1 0
chr3:31576396|31580096 hsa-miR-4789-3p 0 1 0
chr10:63621419|63621796 hsa-miR-4789-3p 0 1 0
chr15:55834078|55834267 hsa-miR-4789-3p 0 1 0
chr9:7798495|7798595 hsa-miR-4789-3p 0 1 0
chr10:89418064|89418257 hsa-miR-4789-3p 0 1 0
chr17:46548612|46548871 hsa-miR-4789-3p 0 1 0
chr11:67029474|67029595 hsa-miR-4789-3p 0 1 0
chr13:113980040|113980201 hsa-miR-4789-3p 0 1 0
chr1:231000323|231000443 hsa-miR-4789-3p 0 1 0
chr22:41246423|41246570 hsa-miR-4789-3p 0 1 0
chr17:38921485|38921631 hsa-miR-4789-3p 0 1 0
chr21:38301947|38302120 hsa-miR-4789-3p 0 1 0
chr22:23928261|23928387 hsa-miR-4789-3p 0 1 0
chr19:47741687|47741862 hsa-miR-4789-3p 0 1 0
chr14:65048484|65048631 hsa-miR-4789-3p 0 1 0
chr14:35082526|35082648 hsa-miR-4789-3p 0 1 0
chr2:100275714|100276023 hsa-miR-4789-3p 0 1 0
chr10:116887895|116888084 hsa-miR-4789-3p 0 1 0
chr1:117906506|117912015 hsa-miR-4789-3p 0 1 0
chr12:2849553|2849752 hsa-miR-4789-3p 0 1 0
chr1:8011976|8012130 hsa-miR-4789-3p 0 1 0
chr1:151638888|151639119 hsa-miR-4789-3p 0 1 0
chr11:70422193|70422362 hsa-miR-4789-3p 0 1 0
chr5:141825471|141825584 hsa-miR-4789-3p 0 1 0
chr2:217802343|217802511 hsa-miR-4789-3p 0 1 0
chr1:231000316|231000443 hsa-miR-4789-3p 0 1 0
chr1:156465568|156465667 hsa-miR-4789-3p 0 1 0
chr9:93121791|93121935 hsa-miR-4789-3p 0 1 0
chr17:81231213|81231365 hsa-miR-4789-3p 0 1 0
chr2:85666105|85666258 hsa-miR-4789-3p 0 1 0
chr1:231000185|231000443 hsa-miR-4789-3p 0 1 0
chr3:128813424|128813743 hsa-miR-4789-3p 0 1 0
chr12:132950473|132950677 hsa-miR-4789-3p 0 1 0
chr2:188996125|188996461 hsa-miR-4789-3p 0 1 0
chr7:29923247|29923386 hsa-miR-4789-3p 0 1 0
chr16:54113043|54113178 hsa-miR-4789-3p 0 1 0
chr20:58995508|58995598 hsa-miR-4789-3p 0 1 0
chr6:160105650|160105752 hsa-miR-4789-3p 0 1 0
chr20:58995382|58995637 hsa-miR-4789-3p 0 1 0
chr19:2715885|2716019 hsa-miR-4789-3p 0 1 0
chr10:102738927|102739093 hsa-miR-4789-3p 0 1 0
chr3:128813538|128813743 hsa-miR-4789-3p 0 1 0
chr7:101138542|101138734 hsa-miR-4789-3p 0 1 0
chr19:47741679|47741989 hsa-miR-4789-3p 0 1 0
chr11:790987|791293 hsa-miR-4789-3p 0 1 0
chr16:2090381|2090485 hsa-miR-4789-3p 0 1 0
chr17:76270693|76270952 hsa-miR-4789-3p 0 1 0
chr11:70479671|70479915 hsa-miR-4789-3p -2 1 0
chr11:118897437|118897601 hsa-miR-4789-3p -8 1 0
chrX:51897967|51898159 hsa-miR-4789-3p -16 1 0
chr20:38129477|38129726 hsa-miR-4789-3p -9 1 0
chr7:75888301|75888507 hsa-miR-4789-3p 1 0 0
chr9:86300735|86300869 hsa-miR-4789-3p 0 1 0
chr8:23021421|23021574 hsa-miR-4789-3p 0 1 0
chr12:125030849|125030997 hsa-miR-4789-3p 0 1 0
chr21:46193952|46194079 hsa-miR-4789-3p 0 1 0
chr16:77199079|77199230 hsa-miR-4789-3p 0 1 0
chr3:38142286|38142355 hsa-miR-4789-3p 0 1 0
chr2:188996125|188996463 hsa-miR-4789-3p 0 1 0
chr1:45627975|45628119 hsa-miR-4789-3p 0 1 0
chrX:106928154|106928525 hsa-miR-4789-3p 0 1 0
chrX:48819391|48819485 hsa-miR-4789-3p 0 1 0
chr2:96622751|96622888 hsa-miR-4789-3p 0 1 0
chr12:120764226|120764355 hsa-miR-4789-3p 0 1 0
chr3:128813476|128813727 hsa-miR-4789-3p 0 1 0
chr15:40333896|40333975 hsa-miR-4789-3p 0 1 0
chr17:38921521|38921648 hsa-miR-4789-3p 0 1 0
chr2:189578090|189578221 hsa-miR-4789-3p 0 1 0
chr6:160105542|160105744 hsa-miR-4789-3p 0 1 0
chr6:160105601|160105762 hsa-miR-4789-3p 0 1 0
chr12:110534383|110534479 hsa-miR-4789-3p 0 1 0
chr16:77200156|77200326 hsa-miR-4789-3p 0 1 0
chr17:28746292|28746671 hsa-miR-4789-3p 0 1 0
chrX:110195060|110195194 hsa-miR-4789-3p 0 1 0
chr14:22926524|22926781 hsa-miR-4789-3p 0 1 0
chr1:155330428|155330612 hsa-miR-4789-3p 0 1 0
chr19:35123522|35123695 hsa-miR-4789-3p 0 1 0
chr1:45627940|45628121 hsa-miR-4789-3p 0 1 0
chr3:51665281|51665455 hsa-miR-4789-3p 0 1 0
chr2:168774279|168774497 hsa-miR-4789-3p 0 1 0
chr5:72219708|72219948 hsa-miR-4789-3p 0 1 0
chr19:756929|757143 hsa-miR-4789-3p 0 1 0
chr14:35082497|35082650 hsa-miR-4789-3p 0 1 0
chr12:1788046|1788309 hsa-miR-4789-3p 0 1 0
chr11:114520253|114520538 hsa-miR-4789-3p 0 1 0
chr12:74541048|74541199 hsa-miR-4789-3p 0 1 0
chr1:231000229|231000443 hsa-miR-4789-3p 0 1 0
chr1:59761284|59761398 hsa-miR-4789-3p 0 1 0
chr2:85053644|85053767 hsa-miR-4789-3p 0 1 0
chr7:158733120|158733253 hsa-miR-4789-3p 0 1 0
chr16:29780785|29780912 hsa-miR-4789-3p 0 1 0
chr18:80047711|80047835 hsa-miR-4789-3p 0 1 0
chr1:171591970|171592313 hsa-miR-4789-3p 0 1 0
chr12:74541020|74541199 hsa-miR-4789-3p 0 1 0
chr1:231000323|231000418 hsa-miR-4789-3p 0 1 0
chr20:47654788|47654911 hsa-miR-4789-3p 0 1 0
chr1:150111181|150111318 hsa-miR-4789-3p 0 1 0
chr9:7798495|7798590 hsa-miR-4789-3p 0 1 0
chr2:96860205|96860393 hsa-miR-4789-3p 0 1 0
chr8:23021421|23021572 hsa-miR-4789-3p 0 1 0
chr19:756923|757143 hsa-miR-4789-3p 0 1 0
chr11:114520253|114520408 hsa-miR-4789-3p 0 1 0
chr17:42843331|42843478 hsa-miR-4789-3p 0 1 0
chr5:157477419|157477515 hsa-miR-4789-3p 0 1 0
chr9:91410745|91410897 hsa-miR-4789-3p 0 1 0
chr15:78471752|78471896 hsa-miR-4789-3p 0 1 0
chr7:55189063|55189200 hsa-miR-4789-3p 0 1 0
chr8:139748446|139748566 hsa-miR-4789-3p 1 0 0
chr3:47847945|47848088 hsa-miR-4789-3p 1 0 0
chr22:20064953|20065169 hsa-miR-4789-3p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4789-3p PSMA7 proteasome 20S subunit alpha 7 HGNC:9536 details
hsa-miR-4789-3p MFF mitochondrial fission factor HGNC:24858 details
hsa-miR-4789-3p VANGL1 VANGL planar cell polarity protein 1 HGNC:15512 details
hsa-miR-4789-3p SF3B3 splicing factor 3b subunit 3 HGNC:10770 details
hsa-miR-4789-3p PTP4A1 protein tyrosine phosphatase 4A1 HGNC:9634 details
hsa-miR-4789-3p PPP1CC protein phosphatase 1 catalytic subunit gamma HGNC:9283 details
hsa-miR-4789-3p details
hsa-miR-4789-3p G3BP1 G3BP stress granule assembly factor 1 HGNC:30292 details
hsa-miR-4789-3p TNPO1 transportin 1 HGNC:6401 details
hsa-miR-4789-3p IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-4789-3p MORF4L2 mortality factor 4 like 2 HGNC:16849 details
hsa-miR-4789-3p MEF2D myocyte enhancer factor 2D HGNC:6997 details
hsa-miR-4789-3p RPAP2 RNA polymerase II associated protein 2 HGNC:25791 details
hsa-miR-4789-3p NCBP3 nuclear cap binding subunit 3 HGNC:24612 details
hsa-miR-4789-3p SLC25A12 solute carrier family 25 member 12 HGNC:10982 details
hsa-miR-4789-3p COPS8 COP9 signalosome subunit 8 HGNC:24335 details
hsa-miR-4789-3p TUBA1B tubulin alpha 1b HGNC:18809 details
hsa-miR-4789-3p VAMP4 vesicle associated membrane protein 4 HGNC:12645 details
hsa-miR-4789-3p PLEKHA3 pleckstrin homology domain containing A3 HGNC:14338 details
hsa-miR-4789-3p MON1B MON1 homolog B, secretory trafficking associated HGNC:25020 details
hsa-miR-4789-3p RTL6 retrotransposon Gag like 6 HGNC:13343 details
hsa-miR-4789-3p PCLAF PCNA clamp associated factor HGNC:28961 details
hsa-miR-4789-3p ZNF850 zinc finger protein 850 HGNC:27994 details
hsa-miR-4789-3p CREB1 cAMP responsive element binding protein 1 HGNC:2345 details
hsa-miR-4789-3p ENTHD1 ENTH domain containing 1 HGNC:26352 details
hsa-miR-4789-3p CDKL1 cyclin dependent kinase like 1 HGNC:1781 details
hsa-miR-4789-3p CERCAM cerebral endothelial cell adhesion molecule HGNC:23723 details
hsa-miR-4789-3p KCNK1 potassium two pore domain channel subfamily K member 1 HGNC:6272 details
hsa-miR-4789-3p INTU inturned planar cell polarity protein HGNC:29239 details
hsa-miR-4789-3p COL8A1 collagen type VIII alpha 1 chain HGNC:2215 details
hsa-miR-4789-3p STARD8 StAR related lipid transfer domain containing 8 HGNC:19161 details
hsa-miR-4789-3p USP8 ubiquitin specific peptidase 8 HGNC:12631 details
hsa-miR-4789-3p PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 HGNC:8979 details
hsa-miR-4789-3p NDST1 N-deacetylase and N-sulfotransferase 1 HGNC:7680 details
hsa-miR-4789-3p KPNA4 karyopherin subunit alpha 4 HGNC:6397 details
hsa-miR-4789-3p KLHL23 kelch like family member 23 HGNC:27506 details
hsa-miR-4789-3p RBM20 RNA binding motif protein 20 HGNC:27424 details
hsa-miR-4789-3p HOXC11 homeobox C11 HGNC:5123 details
hsa-miR-4789-3p LRRC63 leucine rich repeat containing 63 HGNC:34296 details
hsa-miR-4789-3p SLC35E3 solute carrier family 35 member E3 HGNC:20864 details
hsa-miR-4789-3p WDR72 WD repeat domain 72 HGNC:26790 details
hsa-miR-4789-3p CCT4 chaperonin containing TCP1 subunit 4 HGNC:1617 details
hsa-miR-4789-3p TECRL trans-2,3-enoyl-CoA reductase like HGNC:27365 details
hsa-miR-4789-3p AJAP1 adherens junctions associated protein 1 HGNC:30801 details
hsa-miR-4789-3p CALHM5 calcium homeostasis modulator family member 5 HGNC:21568 details
hsa-miR-4789-3p PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma HGNC:8978 details
hsa-miR-4789-3p VENTX VENT homeobox HGNC:13639 details
hsa-miR-4789-3p SCIN scinderin HGNC:21695 details
hsa-miR-4789-3p NDRG4 NDRG family member 4 HGNC:14466 details
hsa-miR-4789-3p CD180 CD180 molecule HGNC:6726 details
hsa-miR-4789-3p UCHL3 ubiquitin C-terminal hydrolase L3 HGNC:12515 details
hsa-miR-4789-3p PIP4P1 phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 HGNC:19299 details
hsa-miR-4789-3p PURG purine rich element binding protein G HGNC:17930 details
hsa-miR-4789-3p PLAG1 PLAG1 zinc finger HGNC:9045 details
hsa-miR-4789-3p PDCD10 programmed cell death 10 HGNC:8761 details
hsa-miR-4789-3p NR2C2 nuclear receptor subfamily 2 group C member 2 HGNC:7972 details
hsa-miR-4789-3p LONRF3 LON peptidase N-terminal domain and ring finger 3 HGNC:21152 details
hsa-miR-4789-3p CHRM3 cholinergic receptor muscarinic 3 HGNC:1952 details
hsa-miR-4789-3p BRMS1L BRMS1 like transcriptional repressor HGNC:20512 details
hsa-miR-4789-3p BRIX1 biogenesis of ribosomes BRX1 HGNC:24170 details
hsa-miR-4789-3p BACH1 BTB domain and CNC homolog 1 HGNC:935 details
hsa-miR-4789-3p ANKRD44 ankyrin repeat domain 44 HGNC:25259 details
hsa-miR-4789-3p AMMECR1 AMMECR nuclear protein 1 HGNC:467 details
hsa-miR-4789-3p NSFL1C NSFL1 cofactor HGNC:15912 details
hsa-miR-4789-3p PPIL3 peptidylprolyl isomerase like 3 HGNC:9262 details
hsa-miR-4789-3p SLC2A9 solute carrier family 2 member 9 HGNC:13446 details
hsa-miR-4789-3p CYTIP cytohesin 1 interacting protein HGNC:9506 details
hsa-miR-4789-3p ART4 ADP-ribosyltransferase 4 (inactive) (Dombrock blood group) HGNC:726 details
hsa-miR-4789-3p ZNF827 zinc finger protein 827 HGNC:27193 details
hsa-miR-4789-3p TRPC5 transient receptor potential cation channel subfamily C member 5 HGNC:12337 details
hsa-miR-4789-3p FGF2 fibroblast growth factor 2 HGNC:3676 details
hsa-miR-4789-3p BMP2K BMP2 inducible kinase HGNC:18041 details
hsa-miR-4789-3p AFF4 AF4/FMR2 family member 4 HGNC:17869 details
hsa-miR-4789-3p DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 HGNC:24013 details
hsa-miR-4789-3p LILRB2 leukocyte immunoglobulin like receptor B2 HGNC:6606 details
hsa-miR-4789-3p ZC3H6 zinc finger CCCH-type containing 6 HGNC:24762 details
hsa-miR-4789-3p NLRP8 NLR family pyrin domain containing 8 HGNC:22940 details
hsa-miR-4789-3p MGAT4C MGAT4 family member C HGNC:30871 details
hsa-miR-4789-3p PELP1 proline, glutamate and leucine rich protein 1 HGNC:30134 details
hsa-miR-4789-3p details
hsa-miR-4789-3p ZMYM2 zinc finger MYM-type containing 2 HGNC:12989 details
hsa-miR-4789-3p EGR3 early growth response 3 HGNC:3240 details
hsa-miR-4789-3p CSRNP3 cysteine and serine rich nuclear protein 3 HGNC:30729 details
hsa-miR-4789-3p IRS1 insulin receptor substrate 1 HGNC:6125 details
hsa-miR-4789-3p GTF2H1 general transcription factor IIH subunit 1 HGNC:4655 details
hsa-miR-4789-3p SLC6A6 solute carrier family 6 member 6 HGNC:11052 details
hsa-miR-4789-3p HSBP1 heat shock factor binding protein 1 HGNC:5203 details
hsa-miR-4789-3p BHLHB9 basic helix-loop-helix family member b9 HGNC:29353 details
hsa-miR-4789-3p SNCB synuclein beta HGNC:11140 details
hsa-miR-4789-3p HDGFL3 HDGF like 3 HGNC:24937 details
hsa-miR-4789-3p ZNF551 zinc finger protein 551 HGNC:25108 details
hsa-miR-4789-3p DGKH diacylglycerol kinase eta HGNC:2854 details
hsa-miR-4789-3p PIAS1 protein inhibitor of activated STAT 1 HGNC:2752 details
hsa-miR-4789-3p CCND1 cyclin D1 HGNC:1582 details
hsa-miR-4789-3p ASH1L ASH1 like histone lysine methyltransferase HGNC:19088 details
hsa-miR-4789-3p ACSL4 acyl-CoA synthetase long chain family member 4 HGNC:3571 details
hsa-miR-4789-3p RHCG Rh family C glycoprotein HGNC:18140 details
hsa-miR-4789-3p CLEC12A C-type lectin domain family 12 member A HGNC:31713 details
hsa-miR-4789-3p TMEM106C transmembrane protein 106C HGNC:28775 details
hsa-miR-4789-3p PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 HGNC:23148 details
hsa-miR-4789-3p OPN5 opsin 5 HGNC:19992 details
hsa-miR-4789-3p TRIM59 tripartite motif containing 59 HGNC:30834 details
hsa-miR-4789-3p RASSF6 Ras association domain family member 6 HGNC:20796 details
hsa-miR-4789-3p KYNU kynureninase HGNC:6469 details
hsa-miR-4789-3p SART3 spliceosome associated factor 3, U4/U6 recycling protein HGNC:16860 details
hsa-miR-4789-3p ZNF562 zinc finger protein 562 HGNC:25950 details
hsa-miR-4789-3p YY1 YY1 transcription factor HGNC:12856 details
hsa-miR-4789-3p VKORC1L1 vitamin K epoxide reductase complex subunit 1 like 1 HGNC:21492 details
hsa-miR-4789-3p TRAF5 TNF receptor associated factor 5 HGNC:12035 details
hsa-miR-4789-3p TIMM10 translocase of inner mitochondrial membrane 10 HGNC:11814 details
hsa-miR-4789-3p TAOK1 TAO kinase 1 HGNC:29259 details
hsa-miR-4789-3p SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein HGNC:16918 details
hsa-miR-4789-3p RGMB repulsive guidance molecule BMP co-receptor b HGNC:26896 details
hsa-miR-4789-3p details
hsa-miR-4789-3p HHIP hedgehog interacting protein HGNC:14866 details
hsa-miR-4789-3p BLOC1S4 biogenesis of lysosomal organelles complex 1 subunit 4 HGNC:24206 details
hsa-miR-4789-3p BAG4 BAG cochaperone 4 HGNC:940 details
hsa-miR-4789-3p ARF6 ADP ribosylation factor 6 HGNC:659 details
hsa-miR-4789-3p CPEB2 cytoplasmic polyadenylation element binding protein 2 HGNC:21745 details
hsa-miR-4789-3p ZNF749 zinc finger protein 749 HGNC:32783 details
hsa-miR-4789-3p C5orf24 chromosome 5 open reading frame 24 HGNC:26746 details
hsa-miR-4789-3p XIAP X-linked inhibitor of apoptosis HGNC:592 details
hsa-miR-4789-3p WDR45B WD repeat domain 45B HGNC:25072 details
hsa-miR-4789-3p PURA purine rich element binding protein A HGNC:9701 details
hsa-miR-4789-3p PTMA prothymosin alpha HGNC:9623 details
hsa-miR-4789-3p HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 HGNC:5030 details
hsa-miR-4789-3p EIF1AX eukaryotic translation initiation factor 1A X-linked HGNC:3250 details
hsa-miR-4789-3p LYN LYN proto-oncogene, Src family tyrosine kinase HGNC:6735 details
hsa-miR-4789-3p PHAX phosphorylated adaptor for RNA export HGNC:10241 details
hsa-miR-4789-3p C9orf78 chromosome 9 open reading frame 78 HGNC:24932 details
hsa-miR-4789-3p HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1 like 2 HGNC:27067 details
hsa-miR-4789-3p ZNF350 zinc finger protein 350 HGNC:16656 details
hsa-miR-4789-3p HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 HGNC:5031 details
hsa-miR-4789-3p CPSF6 cleavage and polyadenylation specific factor 6 HGNC:13871 details
hsa-miR-4789-3p PHKA1 phosphorylase kinase regulatory subunit alpha 1 HGNC:8925 details
hsa-miR-4789-3p MCTS1 MCTS1 re-initiation and release factor HGNC:23357 details
hsa-miR-4789-3p SYT2 synaptotagmin 2 HGNC:11510 details
hsa-miR-4789-3p RNF152 ring finger protein 152 HGNC:26811 details
hsa-miR-4789-3p STAT5B signal transducer and activator of transcription 5B HGNC:11367 details
hsa-miR-4789-3p NFAT5 nuclear factor of activated T cells 5 HGNC:7774 details
hsa-miR-4789-3p MAP4 microtubule associated protein 4 HGNC:6862 details
hsa-miR-4789-3p KIF5C kinesin family member 5C HGNC:6325 details
hsa-miR-4789-3p PCK1 phosphoenolpyruvate carboxykinase 1 HGNC:8724 details
hsa-miR-4789-3p details
hsa-miR-4789-3p FIG4 FIG4 phosphoinositide 5-phosphatase HGNC:16873 details
hsa-miR-4789-3p TNIP3 TNFAIP3 interacting protein 3 HGNC:19315 details
hsa-miR-4789-3p REEP3 receptor accessory protein 3 HGNC:23711 details
hsa-miR-4789-3p FLT1 fms related receptor tyrosine kinase 1 HGNC:3763 details
hsa-miR-4789-3p MED28 mediator complex subunit 28 HGNC:24628 details
hsa-miR-4789-3p FGF9 fibroblast growth factor 9 HGNC:3687 details
hsa-miR-4789-3p MATN1 matrilin 1 HGNC:6907 details
hsa-miR-4789-3p UGT8 UDP glycosyltransferase 8 HGNC:12555 details
hsa-miR-4789-3p ZNF610 zinc finger protein 610 HGNC:26687 details
hsa-miR-4789-3p ZNF415 zinc finger protein 415 HGNC:20636 details
hsa-miR-4789-3p SOD2 superoxide dismutase 2 HGNC:11180 details
hsa-miR-4789-3p CHEK1 checkpoint kinase 1 HGNC:1925 details
hsa-miR-4789-3p PLRG1 pleiotropic regulator 1 HGNC:9089 details
hsa-miR-4789-3p details
hsa-miR-4789-3p SEL1L3 SEL1L family member 3 HGNC:29108 details
hsa-miR-4789-3p SLC23A3 solute carrier family 23 member 3 HGNC:20601 details
hsa-miR-4789-3p MED24 mediator complex subunit 24 HGNC:22963 details
hsa-miR-4789-3p KRTAP4-9 keratin associated protein 4-9 HGNC:18910 details
hsa-miR-4789-3p PLXDC2 plexin domain containing 2 HGNC:21013 details
hsa-miR-4789-3p PRRG3 proline rich and Gla domain 3 HGNC:30798 details
hsa-miR-4789-3p ARNT aryl hydrocarbon receptor nuclear translocator HGNC:700 details
hsa-miR-4789-3p COL9A1 collagen type IX alpha 1 chain HGNC:2217 details
hsa-miR-4789-3p MRRF mitochondrial ribosome recycling factor HGNC:7234 details
hsa-miR-4789-3p STARD7 StAR related lipid transfer domain containing 7 HGNC:18063 details
hsa-miR-4789-3p CA8 carbonic anhydrase 8 HGNC:1382 details
hsa-miR-4789-3p USF3 upstream transcription factor family member 3 HGNC:30494 details
hsa-miR-4789-3p DDB1 damage specific DNA binding protein 1 HGNC:2717 details
hsa-miR-4789-3p CLEC4D C-type lectin domain family 4 member D HGNC:14554 details
hsa-miR-4789-3p AQP3 aquaporin 3 (Gill blood group) HGNC:636 details
hsa-miR-4789-3p NACC1 nucleus accumbens associated 1 HGNC:20967 details
hsa-miR-4789-3p PLA2G7 phospholipase A2 group VII HGNC:9040 details
hsa-miR-4789-3p ICAM1 intercellular adhesion molecule 1 HGNC:5344 details
hsa-miR-4789-3p NNT nicotinamide nucleotide transhydrogenase HGNC:7863 details
hsa-miR-4789-3p RAB3GAP1 RAB3 GTPase activating protein catalytic subunit 1 HGNC:17063 details
hsa-miR-4789-3p SLC5A7 solute carrier family 5 member 7 HGNC:14025 details
hsa-miR-4789-3p ZNF280B zinc finger protein 280B HGNC:23022 details
hsa-miR-4789-3p TMOD2 tropomodulin 2 HGNC:11872 details
hsa-miR-4789-3p SLITRK4 SLIT and NTRK like family member 4 HGNC:23502 details
hsa-miR-4789-3p RUNX1 RUNX family transcription factor 1 HGNC:10471 details
hsa-miR-4789-3p PLXNA4 plexin A4 HGNC:9102 details
hsa-miR-4789-3p TSPAN1 tetraspanin 1 HGNC:20657 details
hsa-miR-4789-3p NCOA3 nuclear receptor coactivator 3 HGNC:7670 details
hsa-miR-4789-3p MAPKAPK2 MAPK activated protein kinase 2 HGNC:6887 details
hsa-miR-4789-3p IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 HGNC:28866 details
hsa-miR-4789-3p GCK glucokinase HGNC:4195 details
hsa-miR-4789-3p GEMIN6 gem nuclear organelle associated protein 6 HGNC:20044 details
hsa-miR-4789-3p CRIM1 cysteine rich transmembrane BMP regulator 1 HGNC:2359 details
hsa-miR-4789-3p IKBKG inhibitor of nuclear factor kappa B kinase regulatory subunit gamma HGNC:5961 details
hsa-miR-4789-3p LANCL3 LanC like 3 HGNC:24767 details
hsa-miR-4789-3p SGPL1 sphingosine-1-phosphate lyase 1 HGNC:10817 details
hsa-miR-4789-3p TUBD1 tubulin delta 1 HGNC:16811 details
hsa-miR-4789-3p LARP4B La ribonucleoprotein 4B HGNC:28987 details
hsa-miR-4789-3p ADCYAP1R1 ADCYAP receptor type I HGNC:242 details
hsa-miR-4789-3p STK36 serine/threonine kinase 36 HGNC:17209 details
hsa-miR-4789-3p C1orf216 chromosome 1 open reading frame 216 HGNC:26800 details
hsa-miR-4789-3p SLCO1B3 solute carrier organic anion transporter family member 1B3 HGNC:10961 details
hsa-miR-4789-3p TBRG4 transforming growth factor beta regulator 4 HGNC:17443 details
hsa-miR-4789-3p HLF HLF transcription factor, PAR bZIP family member HGNC:4977 details
hsa-miR-4789-3p SLC22A4 solute carrier family 22 member 4 HGNC:10968 details
hsa-miR-4789-3p SLC7A11 solute carrier family 7 member 11 HGNC:11059 details
hsa-miR-4789-3p SLC44A1 solute carrier family 44 member 1 HGNC:18798 details
hsa-miR-4789-3p SEMA4C semaphorin 4C HGNC:10731 details
hsa-miR-4789-3p RTF1 RTF1 homolog, Paf1/RNA polymerase II complex component HGNC:28996 details
hsa-miR-4789-3p PLCE1 phospholipase C epsilon 1 HGNC:17175 details
hsa-miR-4789-3p PARD3B par-3 family cell polarity regulator beta HGNC:14446 details
hsa-miR-4789-3p B4GALT5 beta-1,4-galactosyltransferase 5 HGNC:928 details
hsa-miR-4789-3p ATXN3 ataxin 3 HGNC:7106 details
hsa-miR-4789-3p ADO 2-aminoethanethiol dioxygenase HGNC:23506 details
hsa-miR-4789-3p SYTL4 synaptotagmin like 4 HGNC:15588 details
hsa-miR-4789-3p details
hsa-miR-4789-3p AKAIN1 A-kinase anchor inhibitor 1 HGNC:28285 details
hsa-miR-4789-3p MAPKAPK5 MAPK activated protein kinase 5 HGNC:6889 details
hsa-miR-4789-3p PTDSS1 phosphatidylserine synthase 1 HGNC:9587 details
hsa-miR-4789-3p TANK TRAF family member associated NFKB activator HGNC:11562 details
hsa-miR-4789-3p ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 HGNC:812 details
hsa-miR-4789-3p NMRK1 nicotinamide riboside kinase 1 HGNC:26057 details
hsa-miR-4789-3p MMADHC metabolism of cobalamin associated D HGNC:25221 details
hsa-miR-4789-3p CLSTN3 calsyntenin 3 HGNC:18371 details
hsa-miR-4789-3p SPOCK2 SPARC (osteonectin), cwcv and kazal like domains proteoglycan 2 HGNC:13564 details
hsa-miR-4789-3p SGIP1 SH3GL interacting endocytic adaptor 1 HGNC:25412 details
hsa-miR-4789-3p CTTNBP2NL CTTNBP2 N-terminal like HGNC:25330 details
hsa-miR-4789-3p ATXN7L3B ataxin 7 like 3B HGNC:37931 details
hsa-miR-4789-3p AP5M1 adaptor related protein complex 5 subunit mu 1 HGNC:20192 details
hsa-miR-4789-3p SH3TC2 SH3 domain and tetratricopeptide repeats 2 HGNC:29427 details
hsa-miR-4789-3p LILRB1 leukocyte immunoglobulin like receptor B1 HGNC:6605 details
hsa-miR-4789-3p IL21R interleukin 21 receptor HGNC:6006 details
hsa-miR-4789-3p WDR3 WD repeat domain 3 HGNC:12755 details
hsa-miR-4789-3p TIGIT T cell immunoreceptor with Ig and ITIM domains HGNC:26838 details
hsa-miR-4789-3p GDNF glial cell derived neurotrophic factor HGNC:4232 details
hsa-miR-4789-3p ZNF730 zinc finger protein 730 HGNC:32470 details
hsa-miR-4789-3p ATG10 autophagy related 10 HGNC:20315 details
hsa-miR-4789-3p FOXL1 forkhead box L1 HGNC:3817 details
hsa-miR-4789-3p BMP10 bone morphogenetic protein 10 HGNC:20869 details
hsa-miR-4789-3p NPTXR neuronal pentraxin receptor HGNC:7954 details
hsa-miR-4789-3p FSIP2 fibrous sheath interacting protein 2 HGNC:21675 details
hsa-miR-4789-3p RSF1 remodeling and spacing factor 1 HGNC:18118 details
hsa-miR-4789-3p CASD1 CAS1 domain containing 1 HGNC:16014 details
hsa-miR-4789-3p C3orf33 chromosome 3 open reading frame 33 HGNC:26434 details
hsa-miR-4789-3p CCDC149 coiled-coil domain containing 149 HGNC:25405 details
hsa-miR-4789-3p ZFP1 ZFP1 zinc finger protein HGNC:23328 details
hsa-miR-4789-3p GLI2 GLI family zinc finger 2 HGNC:4318 details
hsa-miR-4789-3p BEX4 brain expressed X-linked 4 HGNC:25475 details
hsa-miR-4789-3p C1orf50 chromosome 1 open reading frame 50 HGNC:28795 details
hsa-miR-4789-3p ZDHHC24 zinc finger DHHC-type containing 24 HGNC:27387 details
hsa-miR-4789-3p AGAP1 ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 HGNC:16922 details
hsa-miR-4789-3p FHOD1 formin homology 2 domain containing 1 HGNC:17905 details
hsa-miR-4789-3p UBE2H ubiquitin conjugating enzyme E2 H HGNC:12484 details
hsa-miR-4789-3p SLC30A4 solute carrier family 30 member 4 HGNC:11015 details
hsa-miR-4789-3p RAP2B RAP2B, member of RAS oncogene family HGNC:9862 details
hsa-miR-4789-3p PTP4A2 protein tyrosine phosphatase 4A2 HGNC:9635 details
hsa-miR-4789-3p LRP8 LDL receptor related protein 8 HGNC:6700 details
hsa-miR-4789-3p KLF7 Kruppel like factor 7 HGNC:6350 details
hsa-miR-4789-3p KCNA4 potassium voltage-gated channel subfamily A member 4 HGNC:6222 details
hsa-miR-4789-3p ACOT2 acyl-CoA thioesterase 2 HGNC:18431 details
hsa-miR-4789-3p JPH2 junctophilin 2 HGNC:14202 details
hsa-miR-4789-3p DENND2C DENN domain containing 2C HGNC:24748 details
hsa-miR-4789-3p LSM14A LSM14A mRNA processing body assembly factor HGNC:24489 details
hsa-miR-4789-3p MMS22L MMS22 like, DNA repair protein HGNC:21475 details
hsa-miR-4789-3p PCDH7 protocadherin 7 HGNC:8659 details
hsa-miR-4789-3p STX16 syntaxin 16 HGNC:11431 details
hsa-miR-4789-3p ITGBL1 integrin subunit beta like 1 HGNC:6164 details
hsa-miR-4789-3p TGFBR1 transforming growth factor beta receptor 1 HGNC:11772 details
hsa-miR-4789-3p SOS1 SOS Ras/Rac guanine nucleotide exchange factor 1 HGNC:11187 details
hsa-miR-4789-3p CEP135 centrosomal protein 135 HGNC:29086 details
hsa-miR-4789-3p CNTNAP5 contactin associated protein family member 5 HGNC:18748 details
hsa-miR-4789-3p WDR17 WD repeat domain 17 HGNC:16661 details
hsa-miR-4789-3p STAM signal transducing adaptor molecule HGNC:11357 details
hsa-miR-4789-3p SIK3 SIK family kinase 3 HGNC:29165 details
hsa-miR-4789-3p NBPF10 NBPF member 10 HGNC:31992 details
hsa-miR-4789-3p MVB12B multivesicular body subunit 12B HGNC:23368 details
hsa-miR-4789-3p SVIP small VCP interacting protein HGNC:25238 details
hsa-miR-4789-3p WDTC1 WD and tetratricopeptide repeats 1 HGNC:29175 details
hsa-miR-4789-3p CHAF1B chromatin assembly factor 1 subunit B HGNC:1911 details
hsa-miR-4789-3p ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif 9 HGNC:13202 details
hsa-miR-4789-3p FAM47E-STBD1 FAM47E-STBD1 readthrough HGNC:44667 details
hsa-miR-4789-3p ZNF264 zinc finger protein 264 HGNC:13057 details
hsa-miR-4789-3p ZBED3 zinc finger BED-type containing 3 HGNC:20711 details
hsa-miR-4789-3p UNK unk zinc finger HGNC:29369 details
hsa-miR-4789-3p SNRK SNF related kinase HGNC:30598 details
hsa-miR-4789-3p RSBN1L round spermatid basic protein 1 like HGNC:24765 details
hsa-miR-4789-3p PAPPA pappalysin 1 HGNC:8602 details
hsa-miR-4789-3p C18orf32 chromosome 18 open reading frame 32 HGNC:31690 details
hsa-miR-4789-3p B4GALT6 beta-1,4-galactosyltransferase 6 HGNC:929 details
hsa-miR-4789-3p ZNF343 zinc finger protein 343 HGNC:16017 details
hsa-miR-4789-3p UBN2 ubinuclein 2 HGNC:21931 details
hsa-miR-4789-3p PPARGC1A PPARG coactivator 1 alpha HGNC:9237 details
hsa-miR-4789-3p YRDC yrdC N6-threonylcarbamoyltransferase domain containing HGNC:28905 details
hsa-miR-4789-3p FOXL2NB FOXL2 neighbor HGNC:34428 details
hsa-miR-4789-3p KCNJ12 potassium inwardly rectifying channel subfamily J member 12 HGNC:6258 details
hsa-miR-4789-3p RORA RAR related orphan receptor A HGNC:10258 details
hsa-miR-4789-3p BTBD9 BTB domain containing 9 HGNC:21228 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab