miRNA Card

miRNA General Information
miRNA ID hsa-miR-4795-3p
Description Homo sapiens miR-4795 stem-loop
Comment None
Experiment Illumina [1]
Sequence AUAUUAUUAGCCACUUCUGGAU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr2:30562146|30568176 hsa-miR-4795-3p 1 0 1

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr7:94413726|94414240 hsa-miR-4795-3p 0 1 0
chr8:115410129|115410227 hsa-miR-4795-3p 0 1 0
chr6:10730659|10730877 hsa-miR-4795-3p 1 0 0
chr1:43363942|43364064 hsa-miR-4795-3p 1 0 0
chr12:56639188|56639289 hsa-miR-4795-3p 0 1 0
chr11:126263493|126263666 hsa-miR-4795-3p 0 1 0
chr1:160028462|160028577 hsa-miR-4795-3p 0 1 0
chr1:207886105|207886219 hsa-miR-4795-3p 0 1 0
chr1:43363942~43364064 hsa-miR-4795-3p 0 1 0
chr11:126263473~126263609 hsa-miR-4795-3p 0 1 0
chr11:112061038~112061174 hsa-miR-4795-3p 0 1 0
chr1:116404416~116404581 hsa-miR-4795-3p 0 1 0
chr7:94413726~94414240 hsa-miR-4795-3p 0 1 0
chr1:43363931~43364084 hsa-miR-4795-3p 0 1 0
chr12:113176858|113177093 hsa-miR-4795-3p 0 1 0
chr11:126263493|126263604 hsa-miR-4795-3p 0 1 0
chr12:113176858~113177093 hsa-miR-4795-3p 0 1 0
chr13:79381166|79381293 hsa-miR-4795-3p 1 0 0
chrX:102878219|102878494 hsa-miR-4795-3p 0 1 0
chr3:40493769|40493857 hsa-miR-4795-3p 0 1 0
chr14:74809762|74809978 hsa-miR-4795-3p 0 1 0
chr9:596389|596539 hsa-miR-4795-3p 0 1 0
chr4:2689575|2689666 hsa-miR-4795-3p 0 1 0
chr11:126263473|126263609 hsa-miR-4795-3p 0 1 0
chr16:10530840|10530945 hsa-miR-4795-3p 0 1 0
chr16:74622428|74622671 hsa-miR-4795-3p 0 1 0
chr22:20951354|20951548 hsa-miR-4795-3p 0 1 0
chr5:168488602|168494650 hsa-miR-4795-3p 0 1 0
chr9:4823548|4827033 hsa-miR-4795-3p 0 1 0
chr11:126263493|126263703 hsa-miR-4795-3p 0 1 0
chr9:109050283|109050692 hsa-miR-4795-3p 0 1 0
chr19:57261352|57261515 hsa-miR-4795-3p 0 1 0
chr7:47514374|47514548 hsa-miR-4795-3p 0 1 0
chr11:126263493|126263609 hsa-miR-4795-3p 0 1 0
chr21:37201636|37201823 hsa-miR-4795-3p 0 1 0
chr6:10730777|10730877 hsa-miR-4795-3p 1 0 0
chr6:10730655|10730877 hsa-miR-4795-3p 1 0 0
chr19:56528991|56529202 hsa-miR-4795-3p 0 1 0
chr16:10530810|10530965 hsa-miR-4795-3p 0 1 0
chr2:131149384|131149442 hsa-miR-4795-3p 0 1 0
chr12:56639188|56639307 hsa-miR-4795-3p 0 1 0
chr4:109815546|109815748 hsa-miR-4795-3p 0 1 0
chr1:116403884|116404462 hsa-miR-4795-3p 0 1 0
chr11:126263491|126263666 hsa-miR-4795-3p 0 1 0
chr12:69587982|69588222 hsa-miR-4795-3p 0 1 0
chr12:113176840|113177093 hsa-miR-4795-3p 0 1 0
chr3:36989158|36989383 hsa-miR-4795-3p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4795-3p PLEKHA2 pleckstrin homology domain containing A2 HGNC:14336 details
hsa-miR-4795-3p CREBZF CREB/ATF bZIP transcription factor HGNC:24905 details
hsa-miR-4795-3p HINT1 histidine triad nucleotide binding protein 1 HGNC:4912 details
hsa-miR-4795-3p ERP44 endoplasmic reticulum protein 44 HGNC:18311 details
hsa-miR-4795-3p SRSF3 serine and arginine rich splicing factor 3 HGNC:10785 details
hsa-miR-4795-3p USP46 ubiquitin specific peptidase 46 HGNC:20075 details
hsa-miR-4795-3p TNRC6A trinucleotide repeat containing adaptor 6A HGNC:11969 details
hsa-miR-4795-3p SMG1 SMG1 nonsense mediated mRNA decay associated PI3K related kinase HGNC:30045 details
hsa-miR-4795-3p COASY Coenzyme A synthase HGNC:29932 details
hsa-miR-4795-3p NAA50 N-alpha-acetyltransferase 50, NatE catalytic subunit HGNC:29533 details
hsa-miR-4795-3p MRPS14 mitochondrial ribosomal protein S14 HGNC:14049 details
hsa-miR-4795-3p AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-4795-3p RGL2 ral guanine nucleotide dissociation stimulator like 2 HGNC:9769 details
hsa-miR-4795-3p BRWD3 bromodomain and WD repeat domain containing 3 HGNC:17342 details
hsa-miR-4795-3p COQ10B coenzyme Q10B HGNC:25819 details
hsa-miR-4795-3p AVPR1A arginine vasopressin receptor 1A HGNC:895 details
hsa-miR-4795-3p MBD2 methyl-CpG binding domain protein 2 HGNC:6917 details
hsa-miR-4795-3p MAPK8 mitogen-activated protein kinase 8 HGNC:6881 details
hsa-miR-4795-3p ZFP36 ZFP36 ring finger protein HGNC:12862 details
hsa-miR-4795-3p SCAMP1 secretory carrier membrane protein 1 HGNC:10563 details
hsa-miR-4795-3p ZNF180 zinc finger protein 180 HGNC:12970 details
hsa-miR-4795-3p TMEM100 transmembrane protein 100 HGNC:25607 details
hsa-miR-4795-3p ELK4 ETS transcription factor ELK4 HGNC:3326 details
hsa-miR-4795-3p CSRNP3 cysteine and serine rich nuclear protein 3 HGNC:30729 details
hsa-miR-4795-3p ATXN1 ataxin 1 HGNC:10548 details
hsa-miR-4795-3p RPL41 ribosomal protein L41 HGNC:10354 details
hsa-miR-4795-3p ZNF703 zinc finger protein 703 HGNC:25883 details
hsa-miR-4795-3p C18orf25 chromosome 18 open reading frame 25 HGNC:28172 details
hsa-miR-4795-3p GRIK5 glutamate ionotropic receptor kainate type subunit 5 HGNC:4583 details
hsa-miR-4795-3p RPL5 ribosomal protein L5 HGNC:10360 details
hsa-miR-4795-3p XKR6 XK related 6 HGNC:27806 details
hsa-miR-4795-3p L2HGDH L-2-hydroxyglutarate dehydrogenase HGNC:20499 details
hsa-miR-4795-3p ZXDA zinc finger X-linked duplicated A HGNC:13198 details
hsa-miR-4795-3p ZFP62 ZFP62 zinc finger protein HGNC:23241 details
hsa-miR-4795-3p VMA21 vacuolar ATPase assembly factor VMA21 HGNC:22082 details
hsa-miR-4795-3p PLAG1 PLAG1 zinc finger HGNC:9045 details
hsa-miR-4795-3p NR2C2 nuclear receptor subfamily 2 group C member 2 HGNC:7972 details
hsa-miR-4795-3p DVL3 dishevelled segment polarity protein 3 HGNC:3087 details
hsa-miR-4795-3p SERF1B small EDRK-rich factor 1B HGNC:10756 details
hsa-miR-4795-3p SPIN4 spindlin family member 4 HGNC:27040 details
hsa-miR-4795-3p ZNF326 zinc finger protein 326 HGNC:14104 details
hsa-miR-4795-3p SERF1A small EDRK-rich factor 1A HGNC:10755 details
hsa-miR-4795-3p ARGFX arginine-fifty homeobox HGNC:30146 details
hsa-miR-4795-3p TMED3 transmembrane p24 trafficking protein 3 HGNC:28889 details
hsa-miR-4795-3p SOCS3 suppressor of cytokine signaling 3 HGNC:19391 details
hsa-miR-4795-3p PIGM phosphatidylinositol glycan anchor biosynthesis class M HGNC:18858 details
hsa-miR-4795-3p MYCN MYCN proto-oncogene, bHLH transcription factor HGNC:7559 details
hsa-miR-4795-3p ERGIC2 ERGIC and golgi 2 HGNC:30208 details
hsa-miR-4795-3p BCLAF3 BCLAF1 and THRAP3 family member 3 HGNC:27413 details
hsa-miR-4795-3p COL19A1 collagen type XIX alpha 1 chain HGNC:2196 details
hsa-miR-4795-3p CCT5 chaperonin containing TCP1 subunit 5 HGNC:1618 details
hsa-miR-4795-3p BTBD1 BTB domain containing 1 HGNC:1120 details
hsa-miR-4795-3p AMOTL1 angiomotin like 1 HGNC:17811 details
hsa-miR-4795-3p ZBTB18 zinc finger and BTB domain containing 18 HGNC:13030 details
hsa-miR-4795-3p HOXC8 homeobox C8 HGNC:5129 details
hsa-miR-4795-3p SNX10 sorting nexin 10 HGNC:14974 details
hsa-miR-4795-3p FOXO3 forkhead box O3 HGNC:3821 details
hsa-miR-4795-3p C8orf33 chromosome 8 open reading frame 33 HGNC:26104 details
hsa-miR-4795-3p LNPK lunapark, ER junction formation factor HGNC:21610 details
hsa-miR-4795-3p SAR1A secretion associated Ras related GTPase 1A HGNC:10534 details
hsa-miR-4795-3p PANK3 pantothenate kinase 3 HGNC:19365 details
hsa-miR-4795-3p NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-4795-3p ZNF223 zinc finger protein 223 HGNC:13016 details
hsa-miR-4795-3p TTC8 tetratricopeptide repeat domain 8 HGNC:20087 details
hsa-miR-4795-3p ZBTB41 zinc finger and BTB domain containing 41 HGNC:24819 details
hsa-miR-4795-3p YY1 YY1 transcription factor HGNC:12856 details
hsa-miR-4795-3p TRIM8 tripartite motif containing 8 HGNC:15579 details
hsa-miR-4795-3p PGAM4 phosphoglycerate mutase family member 4 HGNC:21731 details
hsa-miR-4795-3p LONRF3 LON peptidase N-terminal domain and ring finger 3 HGNC:21152 details
hsa-miR-4795-3p CSNK1G3 casein kinase 1 gamma 3 HGNC:2456 details
hsa-miR-4795-3p CHMP2B charged multivesicular body protein 2B HGNC:24537 details
hsa-miR-4795-3p CBX5 chromobox 5 HGNC:1555 details
hsa-miR-4795-3p ARID5B AT-rich interaction domain 5B HGNC:17362 details
hsa-miR-4795-3p ARGLU1 arginine and glutamate rich 1 HGNC:25482 details
hsa-miR-4795-3p AGO3 argonaute RISC catalytic component 3 HGNC:18421 details
hsa-miR-4795-3p ATRAID all-trans retinoic acid induced differentiation factor HGNC:24090 details
hsa-miR-4795-3p ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-4795-3p SON SON DNA and RNA binding protein HGNC:11183 details
hsa-miR-4795-3p PPIF peptidylprolyl isomerase F HGNC:9259 details
hsa-miR-4795-3p NPTX1 neuronal pentraxin 1 HGNC:7952 details
hsa-miR-4795-3p MYLIP myosin regulatory light chain interacting protein HGNC:21155 details
hsa-miR-4795-3p TNIP2 TNFAIP3 interacting protein 2 HGNC:19118 details
hsa-miR-4795-3p NOLC1 nucleolar and coiled-body phosphoprotein 1 HGNC:15608 details
hsa-miR-4795-3p DSPP dentin sialophosphoprotein HGNC:3054 details
hsa-miR-4795-3p SETD5 SET domain containing 5 HGNC:25566 details
hsa-miR-4795-3p MASTL microtubule associated serine/threonine kinase like HGNC:19042 details
hsa-miR-4795-3p RPS16 ribosomal protein S16 HGNC:10396 details
hsa-miR-4795-3p PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 HGNC:9108 details
hsa-miR-4795-3p KIF1B kinesin family member 1B HGNC:16636 details
hsa-miR-4795-3p ZNF638 zinc finger protein 638 HGNC:17894 details
hsa-miR-4795-3p MIA3 MIA SH3 domain ER export factor 3 HGNC:24008 details
hsa-miR-4795-3p HOXB6 homeobox B6 HGNC:5117 details
hsa-miR-4795-3p NCOA3 nuclear receptor coactivator 3 HGNC:7670 details
hsa-miR-4795-3p FYB1 FYN binding protein 1 HGNC:4036 details
hsa-miR-4795-3p AKIP1 A-kinase interacting protein 1 HGNC:1170 details
hsa-miR-4795-3p SLC25A32 solute carrier family 25 member 32 HGNC:29683 details
hsa-miR-4795-3p HNRNPDL heterogeneous nuclear ribonucleoprotein D like HGNC:5037 details
hsa-miR-4795-3p AFF4 AF4/FMR2 family member 4 HGNC:17869 details
hsa-miR-4795-3p VAPA VAMP associated protein A HGNC:12648 details
hsa-miR-4795-3p AP5M1 adaptor related protein complex 5 subunit mu 1 HGNC:20192 details
hsa-miR-4795-3p NR3C1 nuclear receptor subfamily 3 group C member 1 HGNC:7978 details
hsa-miR-4795-3p WNK1 WNK lysine deficient protein kinase 1 HGNC:14540 details
hsa-miR-4795-3p TFRC transferrin receptor HGNC:11763 details
hsa-miR-4795-3p SLC12A6 solute carrier family 12 member 6 HGNC:10914 details
hsa-miR-4795-3p MYBL1 MYB proto-oncogene like 1 HGNC:7547 details
hsa-miR-4795-3p CDKN2AIPNL CDKN2A interacting protein N-terminal like HGNC:30545 details
hsa-miR-4795-3p ZBTB7A zinc finger and BTB domain containing 7A HGNC:18078 details
hsa-miR-4795-3p IFIT1 interferon induced protein with tetratricopeptide repeats 1 HGNC:5407 details
hsa-miR-4795-3p ZNF292 zinc finger protein 292 HGNC:18410 details
hsa-miR-4795-3p RLN1 relaxin 1 HGNC:10026 details
hsa-miR-4795-3p MYCBP2 MYC binding protein 2 HGNC:23386 details
hsa-miR-4795-3p details
hsa-miR-4795-3p ZPBP zona pellucida binding protein HGNC:15662 details
hsa-miR-4795-3p METTL8 methyltransferase 8, methylcytidine HGNC:25856 details
hsa-miR-4795-3p CDH7 cadherin 7 HGNC:1766 details
hsa-miR-4795-3p RSPO1 R-spondin 1 HGNC:21679 details
hsa-miR-4795-3p ANGEL2 angel homolog 2 HGNC:30534 details
hsa-miR-4795-3p DTWD1 DTW domain containing 1 HGNC:30926 details
hsa-miR-4795-3p IL6R interleukin 6 receptor HGNC:6019 details
hsa-miR-4795-3p BRD3 bromodomain containing 3 HGNC:1104 details
hsa-miR-4795-3p GABRA4 gamma-aminobutyric acid type A receptor subunit alpha4 HGNC:4078 details
hsa-miR-4795-3p MR1 major histocompatibility complex, class I-related HGNC:4975 details
hsa-miR-4795-3p TMEM182 transmembrane protein 182 HGNC:26391 details
hsa-miR-4795-3p CNRIP1 cannabinoid receptor interacting protein 1 HGNC:24546 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab