miRNA Card

miRNA General Information
miRNA ID hsa-miR-4799-5p
Description Homo sapiens miR-4799 stem-loop
Comment None
Experiment Illumina [1]
Sequence AUCUAAAUGCAGCAUGCCAGUC
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr1:205714704|205714832 hsa-miR-4799-5p 0 1 0
chr1:203743185|203743288 hsa-miR-4799-5p 0 1 0
chr12:88522968|88523092 hsa-miR-4799-5p 0 1 0
chr1:203743132|203743288 hsa-miR-4799-5p 0 1 0
chr4:143513554|143513678 hsa-miR-4799-5p 0 1 0
chr22:29299269|29299667 hsa-miR-4799-5p 0 1 0
chr1:209786076|209786187 hsa-miR-4799-5p 0 1 0
chr22:43166956|43167109 hsa-miR-4799-5p 1 0 0
chr10:5510944|5511052 hsa-miR-4799-5p 1 0 0
chr12:26990450|26995257 hsa-miR-4799-5p 0 1 0
chr1:205714713|205714807 hsa-miR-4799-5p 0 1 0
chr12:42159307|42159554 hsa-miR-4799-5p 0 1 0
chr2:219374864|219374987 hsa-miR-4799-5p 0 1 0
chr1:147620032|147620412 hsa-miR-4799-5p 0 1 0
chr6:32831273|32831434 hsa-miR-4799-5p 0 1 0
chr17:48060225|48060493 hsa-miR-4799-5p 0 1 0
chr19:52384716|52385051 hsa-miR-4799-5p 0 1 0
chr3:160411933|160412028 hsa-miR-4799-5p 0 1 0
chr10:73779618|73779754 hsa-miR-4799-5p 0 1 0
chr14:26446690~26446835 hsa-miR-4799-5p 0 1 0
chr4:77164305~77164457 hsa-miR-4799-5p 0 1 0
chr4:77164303~77164487 hsa-miR-4799-5p 0 1 0
chr10:102814908~102815044 hsa-miR-4799-5p 0 1 0
chr11:62524681~62524807 hsa-miR-4799-5p 0 1 0
chr11:61313893~61314173 hsa-miR-4799-5p 0 1 0
chr19:52384716~52385051 hsa-miR-4799-5p 0 1 0
chr10:100553124~100553308 hsa-miR-4799-5p 0 1 0
chr1:203743185~203743288 hsa-miR-4799-5p 0 1 0
chr1:70244699|70246907 hsa-miR-4799-5p 1 0 0
chr6:28128315|28128487 hsa-miR-4799-5p 0 1 0
chr5:143048539|143048639 hsa-miR-4799-5p 0 1 0
chr5:172767008|172767140 hsa-miR-4799-5p 0 1 0
chr19:1398636|1398808 hsa-miR-4799-5p 0 1 0
chr2:134452663|134452914 hsa-miR-4799-5p 0 1 0
chr11:59211452|59211605 hsa-miR-4799-5p 0 1 0
chr1:247201943|247202121 hsa-miR-4799-5p 0 1 0
chr5:76902475|76902601 hsa-miR-4799-5p 0 1 0
chr12:26990450|26990611 hsa-miR-4799-5p 0 1 0
chr11:125052284|125052443 hsa-miR-4799-5p 0 1 0
chr2:74882240|74882411 hsa-miR-4799-5p 0 1 0
chr1:70246820|70246907 hsa-miR-4799-5p 1 0 0
chr7:2614546|2614677 hsa-miR-4799-5p 0 1 0
chr7:127703284|127704945 hsa-miR-4799-5p 0 1 0
chr21:33252660|33252792 hsa-miR-4799-5p 0 1 0
chr1:116575079|116575201 hsa-miR-4799-5p 0 1 0
chr22:23891997|23892205 hsa-miR-4799-5p 0 1 0
chr10:100553145|100553324 hsa-miR-4799-5p 0 1 0
chr11:62519972|62520174 hsa-miR-4799-5p 0 1 0
chr6:15522684|15522792 hsa-miR-4799-5p 0 1 0
chr1:46194282|46194578 hsa-miR-4799-5p 0 1 0
chr22:41398512|41398634 hsa-miR-4799-5p 0 1 0
chr1:147620311|147620412 hsa-miR-4799-5p 0 1 0
chr4:151663689|151663821 hsa-miR-4799-5p 0 1 0
chr20:49849579|49855581 hsa-miR-4799-5p 0 1 0
chr13:28174272|28177935 hsa-miR-4799-5p 0 1 0
chr18:62348168|62349937 hsa-miR-4799-5p 0 1 0
chr8:42403008|42403198 hsa-miR-4799-5p 0 1 0
chr16:1700604|1700819 hsa-miR-4799-5p 0 1 0
chr8:56010034|56010220 hsa-miR-4799-5p 0 1 0
chr16:3486233|3486498 hsa-miR-4799-5p 0 1 0
chr4:77164305|77164457 hsa-miR-4799-5p 0 1 0
chr16:1699388|1699506 hsa-miR-4799-5p 0 1 0
chr10:100553181|100553345 hsa-miR-4799-5p 0 1 0
chr20:435684|435827 hsa-miR-4799-5p -12 1 0
chr1:116584749|116584895 hsa-miR-4799-5p -8 1 0
chr4:119029852|119030072 hsa-miR-4799-5p 0 1 0
chr7:24798072|24798248 hsa-miR-4799-5p 0 1 0
chr5:141511757|141511894 hsa-miR-4799-5p 0 1 0
chr6:33203977|33204103 hsa-miR-4799-5p 0 1 0
chrX:119539665|119539751 hsa-miR-4799-5p 0 1 0
chr1:70147914|70148005 hsa-miR-4799-5p 0 1 0
chr9:130489341|130489435 hsa-miR-4799-5p 0 1 0
chr1:207371028|207371133 hsa-miR-4799-5p 0 1 0
chr15:90998759|90998874 hsa-miR-4799-5p 0 1 0
chr20:46061239|46061391 hsa-miR-4799-5p 0 1 0
chr6:33204014|33204126 hsa-miR-4799-5p 0 1 0
chr9:130489358|130489435 hsa-miR-4799-5p 0 1 0
chr6:127289901|127290205 hsa-miR-4799-5p 0 1 0
chr12:120211165|120211333 hsa-miR-4799-5p 0 1 0
chr6:33203977|33204107 hsa-miR-4799-5p 0 1 0
chr12:120498256|120498375 hsa-miR-4799-5p 0 1 0
chr22:29299264|29299646 hsa-miR-4799-5p 0 1 0
chr1:205714665|205714807 hsa-miR-4799-5p 0 1 0
chr19:10259617|10259800 hsa-miR-4799-5p 0 1 0
chr17:58354827|58355038 hsa-miR-4799-5p 0 1 0
chr16:1700641|1700819 hsa-miR-4799-5p 0 1 0
chr9:136800119|136800472 hsa-miR-4799-5p 0 1 0
chr7:127703226|127704872 hsa-miR-4799-5p 0 1 0
chr11:125584431|125584548 hsa-miR-4799-5p 1 0 0
chr7:135164059|135164205 hsa-miR-4799-5p 1 0 0
chr10:32267953|32268072 hsa-miR-4799-5p 1 0 0
chr2:233152710|233152870 hsa-miR-4799-5p 1 0 0
chr6:116278006|116278271 hsa-miR-4799-5p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4799-5p TLX3 T cell leukemia homeobox 3 HGNC:13532 details
hsa-miR-4799-5p SLC10A7 solute carrier family 10 member 7 HGNC:23088 details
hsa-miR-4799-5p CLIC4 chloride intracellular channel 4 HGNC:13518 details
hsa-miR-4799-5p NYAP2 neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2 HGNC:29291 details
hsa-miR-4799-5p SREK1IP1 SREK1 interacting protein 1 HGNC:26716 details
hsa-miR-4799-5p KIAA0408 KIAA0408 HGNC:21636 details
hsa-miR-4799-5p ZNF555 zinc finger protein 555 HGNC:28382 details
hsa-miR-4799-5p ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-4799-5p SERBP1 SERPINE1 mRNA binding protein 1 HGNC:17860 details
hsa-miR-4799-5p POU2F1 POU class 2 homeobox 1 HGNC:9212 details
hsa-miR-4799-5p GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 HGNC:19980 details
hsa-miR-4799-5p DCAF7 DDB1 and CUL4 associated factor 7 HGNC:30915 details
hsa-miR-4799-5p NDUFA4P1 NDUFA4 pseudogene 1 HGNC:29835 details
hsa-miR-4799-5p PARP1 poly(ADP-ribose) polymerase 1 HGNC:270 details
hsa-miR-4799-5p PI4K2B phosphatidylinositol 4-kinase type 2 beta HGNC:18215 details
hsa-miR-4799-5p KIF23 kinesin family member 23 HGNC:6392 details
hsa-miR-4799-5p CREBRF CREB3 regulatory factor HGNC:24050 details
hsa-miR-4799-5p C18orf25 chromosome 18 open reading frame 25 HGNC:28172 details
hsa-miR-4799-5p CSNK2A1 casein kinase 2 alpha 1 HGNC:2457 details
hsa-miR-4799-5p AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-4799-5p ZNF347 zinc finger protein 347 HGNC:16447 details
hsa-miR-4799-5p UBB ubiquitin B HGNC:12463 details
hsa-miR-4799-5p IMPG2 interphotoreceptor matrix proteoglycan 2 HGNC:18362 details
hsa-miR-4799-5p BMP2 bone morphogenetic protein 2 HGNC:1069 details
hsa-miR-4799-5p C4orf17 chromosome 4 open reading frame 17 HGNC:25274 details
hsa-miR-4799-5p SGO1 shugoshin 1 HGNC:25088 details
hsa-miR-4799-5p NOL9 nucleolar protein 9 HGNC:26265 details
hsa-miR-4799-5p ZNF75D zinc finger protein 75D HGNC:13145 details
hsa-miR-4799-5p TIPARP TCDD inducible poly(ADP-ribose) polymerase HGNC:23696 details
hsa-miR-4799-5p KDR kinase insert domain receptor HGNC:6307 details
hsa-miR-4799-5p RAF1 Raf-1 proto-oncogene, serine/threonine kinase HGNC:9829 details
hsa-miR-4799-5p TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D HGNC:28759 details
hsa-miR-4799-5p PAK2 p21 (RAC1) activated kinase 2 HGNC:8591 details
hsa-miR-4799-5p ADAT2 adenosine deaminase tRNA specific 2 HGNC:21172 details
hsa-miR-4799-5p ACVR2B activin A receptor type 2B HGNC:174 details
hsa-miR-4799-5p DAPK2 death associated protein kinase 2 HGNC:2675 details
hsa-miR-4799-5p NDFIP2 Nedd4 family interacting protein 2 HGNC:18537 details
hsa-miR-4799-5p TBCEL tubulin folding cofactor E like HGNC:28115 details
hsa-miR-4799-5p SERTAD2 SERTA domain containing 2 HGNC:30784 details
hsa-miR-4799-5p PLEKHB2 pleckstrin homology domain containing B2 HGNC:19236 details
hsa-miR-4799-5p HIF1A hypoxia inducible factor 1 subunit alpha HGNC:4910 details
hsa-miR-4799-5p DR1 down-regulator of transcription 1 HGNC:3017 details
hsa-miR-4799-5p ZNF107 zinc finger protein 107 HGNC:12887 details
hsa-miR-4799-5p ZBTB18 zinc finger and BTB domain containing 18 HGNC:13030 details
hsa-miR-4799-5p ZBTB10 zinc finger and BTB domain containing 10 HGNC:30953 details
hsa-miR-4799-5p TMEM170A transmembrane protein 170A HGNC:29577 details
hsa-miR-4799-5p TJP1 tight junction protein 1 HGNC:11827 details
hsa-miR-4799-5p SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone HGNC:16987 details
hsa-miR-4799-5p RAP1A RAP1A, member of RAS oncogene family HGNC:9855 details
hsa-miR-4799-5p OTUD7B OTU deubiquitinase 7B HGNC:16683 details
hsa-miR-4799-5p NUBP1 nucleotide binding protein 1 HGNC:8041 details
hsa-miR-4799-5p HPRT1 hypoxanthine phosphoribosyltransferase 1 HGNC:5157 details
hsa-miR-4799-5p EIF5A2 eukaryotic translation initiation factor 5A2 HGNC:3301 details
hsa-miR-4799-5p RDH11 retinol dehydrogenase 11 HGNC:17964 details
hsa-miR-4799-5p details
hsa-miR-4799-5p LEPROT leptin receptor overlapping transcript HGNC:29477 details
hsa-miR-4799-5p ACTR2 actin related protein 2 HGNC:169 details
hsa-miR-4799-5p SCN1A sodium voltage-gated channel alpha subunit 1 HGNC:10585 details
hsa-miR-4799-5p ORAI1 ORAI calcium release-activated calcium modulator 1 HGNC:25896 details
hsa-miR-4799-5p details
hsa-miR-4799-5p VN1R1 vomeronasal 1 receptor 1 HGNC:13548 details
hsa-miR-4799-5p AAGAB alpha and gamma adaptin binding protein HGNC:25662 details
hsa-miR-4799-5p ALDH18A1 aldehyde dehydrogenase 18 family member A1 HGNC:9722 details
hsa-miR-4799-5p C3orf33 chromosome 3 open reading frame 33 HGNC:26434 details
hsa-miR-4799-5p CCDC90B coiled-coil domain containing 90B HGNC:28108 details
hsa-miR-4799-5p CD55 CD55 molecule (Cromer blood group) HGNC:2665 details
hsa-miR-4799-5p ATIC 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase HGNC:794 details
hsa-miR-4799-5p STX7 syntaxin 7 HGNC:11442 details
hsa-miR-4799-5p SMU1 SMU1 DNA replication regulator and spliceosomal factor HGNC:18247 details
hsa-miR-4799-5p SMAD4 SMAD family member 4 HGNC:6770 details
hsa-miR-4799-5p SKIL SKI like proto-oncogene HGNC:10897 details
hsa-miR-4799-5p PRICKLE1 prickle planar cell polarity protein 1 HGNC:17019 details
hsa-miR-4799-5p ITGA1 integrin subunit alpha 1 HGNC:6134 details
hsa-miR-4799-5p EFNA5 ephrin A5 HGNC:3225 details
hsa-miR-4799-5p CPA4 carboxypeptidase A4 HGNC:15740 details
hsa-miR-4799-5p TK1 thymidine kinase 1 HGNC:11830 details
hsa-miR-4799-5p SARAF store-operated calcium entry associated regulatory factor HGNC:28789 details
hsa-miR-4799-5p TMEM30A transmembrane protein 30A HGNC:16667 details
hsa-miR-4799-5p STX6 syntaxin 6 HGNC:11441 details
hsa-miR-4799-5p KLF10 Kruppel like factor 10 HGNC:11810 details
hsa-miR-4799-5p KITLG KIT ligand HGNC:6343 details
hsa-miR-4799-5p FAM126B family with sequence similarity 126 member B HGNC:28593 details
hsa-miR-4799-5p EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 HGNC:16787 details
hsa-miR-4799-5p ADAM9 ADAM metallopeptidase domain 9 HGNC:216 details
hsa-miR-4799-5p HNF4G hepatocyte nuclear factor 4 gamma HGNC:5026 details
hsa-miR-4799-5p ARHGAP32 Rho GTPase activating protein 32 HGNC:17399 details
hsa-miR-4799-5p KRTAP4-9 keratin associated protein 4-9 HGNC:18910 details
hsa-miR-4799-5p DKK3 dickkopf WNT signaling pathway inhibitor 3 HGNC:2893 details
hsa-miR-4799-5p PPP1CB protein phosphatase 1 catalytic subunit beta HGNC:9282 details
hsa-miR-4799-5p GCK glucokinase HGNC:4195 details
hsa-miR-4799-5p ATXN3 ataxin 3 HGNC:7106 details
hsa-miR-4799-5p CCDC141 coiled-coil domain containing 141 HGNC:26821 details
hsa-miR-4799-5p NDUFA7 NADH:ubiquinone oxidoreductase subunit A7 HGNC:7691 details
hsa-miR-4799-5p SLC12A7 solute carrier family 12 member 7 HGNC:10915 details
hsa-miR-4799-5p C21orf91 chromosome 21 open reading frame 91 HGNC:16459 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab