miRNA Card

miRNA General Information
miRNA ID hsa-miR-4803
Description Homo sapiens miR-4803 stem-loop
Comment None
Experiment Illumina [1]
Sequence UAACAUAAUAGUGUGGAUUGA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr3:149965241|149965367 hsa-miR-4803 0 1 0
chr12:13081336|13081472 hsa-miR-4803 0 1 0
chr16:17107398|17107567 hsa-miR-4803 0 1 0
chr17:75129883|75130026 hsa-miR-4803 0 1 0
chr1:109264253|109264483 hsa-miR-4803 0 1 0
chr15:63071455|63071678 hsa-miR-4803 1 0 0
chr1:150968143|150968472 hsa-miR-4803 0 1 0
chr2:121766141|121766381 hsa-miR-4803 0 1 0
chrX:65741245|65741417 hsa-miR-4803 0 1 0
chr17:75129867|75130026 hsa-miR-4803 0 1 0
chr5:141135930~141136050 hsa-miR-4803 0 1 0
chr19:58568494~58568796 hsa-miR-4803 0 1 0
chr5:137752878~137752974 hsa-miR-4803 0 1 0
chr16:88715695~88715838 hsa-miR-4803 0 1 0
chr3:148827791~148828077 hsa-miR-4803 0 1 0
chrX:65741245~65741403 hsa-miR-4803 0 1 0
chr10:5765869~5766023 hsa-miR-4803 0 1 0
chr15:63071455~63071678 hsa-miR-4803 0 1 0
chr8:128092390|128092497 hsa-miR-4803 0 1 0
chr9:128756452|128756601 hsa-miR-4803 0 1 0
chr2:63879787|63879933 hsa-miR-4803 0 1 0
chr14:100128447|100128542 hsa-miR-4803 0 1 0
chr1:109605496|109605612 hsa-miR-4803 0 1 0
chr3:146193080|146193213 hsa-miR-4803 0 1 0
chr3:20147968|20148300 hsa-miR-4803 0 1 0
chrX:65741245|65741403 hsa-miR-4803 0 1 0
chrX:65741211|65741323 hsa-miR-4803 0 1 0
chr5:137752878|137752974 hsa-miR-4803 0 1 0
chr12:70347752|70347905 hsa-miR-4803 0 1 0
chr16:88715695|88715838 hsa-miR-4803 0 1 0
chr2:238044186|238044368 hsa-miR-4803 0 1 0
chr2:121766221|121766343 hsa-miR-4803 0 1 0
chr12:76052277|76052400 hsa-miR-4803 0 1 0
chr12:110532689|110532865 hsa-miR-4803 0 1 0
chr14:74495031|74495140 hsa-miR-4803 0 1 0
chr11:314994|315232 hsa-miR-4803 0 1 0
chr11:314978|315191 hsa-miR-4803 0 1 0
chr17:75129891|75130026 hsa-miR-4803 0 1 0
chr11:315065|315191 hsa-miR-4803 0 1 0
chr1:109281957|109282552 hsa-miR-4803 0 1 0
chr3:33797371|33797530 hsa-miR-4803 0 1 0
chr10:5765859|5766004 hsa-miR-4803 0 1 0
chrX:65741142|65741403 hsa-miR-4803 1 0 0
chr15:63071498|63071678 hsa-miR-4803 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-4803 PABPC4L poly(A) binding protein cytoplasmic 4 like HGNC:31955 details
hsa-miR-4803 ZNF646 zinc finger protein 646 HGNC:29004 details
hsa-miR-4803 CEP170 centrosomal protein 170 HGNC:28920 details
hsa-miR-4803 NCOA3 nuclear receptor coactivator 3 HGNC:7670 details
hsa-miR-4803 ZNF84 zinc finger protein 84 HGNC:13159 details
hsa-miR-4803 SGK1 serum/glucocorticoid regulated kinase 1 HGNC:10810 details
hsa-miR-4803 SAR1B secretion associated Ras related GTPase 1B HGNC:10535 details
hsa-miR-4803 NEK7 NIMA related kinase 7 HGNC:13386 details
hsa-miR-4803 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 HGNC:6180 details
hsa-miR-4803 CDC25A cell division cycle 25A HGNC:1725 details
hsa-miR-4803 PTP4A1 protein tyrosine phosphatase 4A1 HGNC:9634 details
hsa-miR-4803 TSEN34 tRNA splicing endonuclease subunit 34 HGNC:15506 details
hsa-miR-4803 BMPER BMP binding endothelial regulator HGNC:24154 details
hsa-miR-4803 RNF6 ring finger protein 6 HGNC:10069 details
hsa-miR-4803 TSKU tsukushi, small leucine rich proteoglycan HGNC:28850 details
hsa-miR-4803 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 HGNC:17882 details
hsa-miR-4803 SECISBP2L SECIS binding protein 2 like HGNC:28997 details
hsa-miR-4803 PTPN4 protein tyrosine phosphatase non-receptor type 4 HGNC:9656 details
hsa-miR-4803 CHEK2 checkpoint kinase 2 HGNC:16627 details
hsa-miR-4803 CCNL1 cyclin L1 HGNC:20569 details
hsa-miR-4803 ZNF711 zinc finger protein 711 HGNC:13128 details
hsa-miR-4803 KMO kynurenine 3-monooxygenase HGNC:6381 details
hsa-miR-4803 NFIB nuclear factor I B HGNC:7785 details
hsa-miR-4803 EPS15L1 epidermal growth factor receptor pathway substrate 15 like 1 HGNC:24634 details
hsa-miR-4803 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 HGNC:24013 details
hsa-miR-4803 DEPTOR DEP domain containing MTOR interacting protein HGNC:22953 details
hsa-miR-4803 RNF11 ring finger protein 11 HGNC:10056 details
hsa-miR-4803 SOD2 superoxide dismutase 2 HGNC:11180 details
hsa-miR-4803 GMDS GDP-mannose 4,6-dehydratase HGNC:4369 details
hsa-miR-4803 PRKD3 protein kinase D3 HGNC:9408 details
hsa-miR-4803 TBC1D22B TBC1 domain family member 22B HGNC:21602 details
hsa-miR-4803 TLL2 tolloid like 2 HGNC:11844 details
hsa-miR-4803 MAPK7 mitogen-activated protein kinase 7 HGNC:6880 details
hsa-miR-4803 details
hsa-miR-4803 MRPL36 mitochondrial ribosomal protein L36 HGNC:14490 details
hsa-miR-4803 UBN2 ubinuclein 2 HGNC:21931 details
hsa-miR-4803 TMED7 transmembrane p24 trafficking protein 7 HGNC:24253 details
hsa-miR-4803 LDLR low density lipoprotein receptor HGNC:6547 details
hsa-miR-4803 KCTD10 potassium channel tetramerization domain containing 10 HGNC:23236 details
hsa-miR-4803 ELOVL7 ELOVL fatty acid elongase 7 HGNC:26292 details
hsa-miR-4803 BTG2 BTG anti-proliferation factor 2 HGNC:1131 details
hsa-miR-4803 SLC25A36 solute carrier family 25 member 36 HGNC:25554 details
hsa-miR-4803 RLIM ring finger protein, LIM domain interacting HGNC:13429 details
hsa-miR-4803 GLO1 glyoxalase I HGNC:4323 details
hsa-miR-4803 SV2B synaptic vesicle glycoprotein 2B HGNC:16874 details
hsa-miR-4803 METTL8 methyltransferase 8, methylcytidine HGNC:25856 details
hsa-miR-4803 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 HGNC:29923 details
hsa-miR-4803 FYCO1 FYVE and coiled-coil domain autophagy adaptor 1 HGNC:14673 details
hsa-miR-4803 FANCM FA complementation group M HGNC:23168 details
hsa-miR-4803 ZCCHC2 zinc finger CCHC-type containing 2 HGNC:22916 details
hsa-miR-4803 XIAP X-linked inhibitor of apoptosis HGNC:592 details
hsa-miR-4803 UBE2H ubiquitin conjugating enzyme E2 H HGNC:12484 details
hsa-miR-4803 SS18 SS18 subunit of BAF chromatin remodeling complex HGNC:11340 details
hsa-miR-4803 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 HGNC:1297 details
hsa-miR-4803 details
hsa-miR-4803 TUBB2A tubulin beta 2A class IIa HGNC:12412 details
hsa-miR-4803 FLVCR1 FLVCR heme transporter 1 HGNC:24682 details
hsa-miR-4803 ALYREF Aly/REF export factor HGNC:19071 details
hsa-miR-4803 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 HGNC:30449 details
hsa-miR-4803 NRARP NOTCH regulated ankyrin repeat protein HGNC:33843 details
hsa-miR-4803 NAP1L1 nucleosome assembly protein 1 like 1 HGNC:7637 details
hsa-miR-4803 NAMPT nicotinamide phosphoribosyltransferase HGNC:30092 details
hsa-miR-4803 GRPEL2 GrpE like 2, mitochondrial HGNC:21060 details
hsa-miR-4803 DYNLL2 dynein light chain LC8-type 2 HGNC:24596 details
hsa-miR-4803 CBX2 chromobox 2 HGNC:1552 details
hsa-miR-4803 AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-4803 RPL17-C18orf32 RPL17-C18orf32 readthrough HGNC:44661 details
hsa-miR-4803 C18orf32 chromosome 18 open reading frame 32 HGNC:31690 details
hsa-miR-4803 BAG4 BAG cochaperone 4 HGNC:940 details
hsa-miR-4803 NPY2R neuropeptide Y receptor Y2 HGNC:7957 details
hsa-miR-4803 RAPGEFL1 Rap guanine nucleotide exchange factor like 1 HGNC:17428 details
hsa-miR-4803 GOLGA7B golgin A7 family member B HGNC:31668 details
hsa-miR-4803 GALM galactose mutarotase HGNC:24063 details
hsa-miR-4803 ADCYAP1 adenylate cyclase activating polypeptide 1 HGNC:241 details
hsa-miR-4803 C3orf33 chromosome 3 open reading frame 33 HGNC:26434 details
hsa-miR-4803 GPR151 G protein-coupled receptor 151 HGNC:23624 details
hsa-miR-4803 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 HGNC:689 details
hsa-miR-4803 SLC6A5 solute carrier family 6 member 5 HGNC:11051 details
hsa-miR-4803 ZNF800 zinc finger protein 800 HGNC:27267 details
hsa-miR-4803 SHOC2 SHOC2 leucine rich repeat scaffold protein HGNC:15454 details
hsa-miR-4803 EFHB EF-hand domain family member B HGNC:26330 details
hsa-miR-4803 PRKAB2 protein kinase AMP-activated non-catalytic subunit beta 2 HGNC:9379 details
hsa-miR-4803 ASB11 ankyrin repeat and SOCS box containing 11 HGNC:17186 details
hsa-miR-4803 OTUD3 OTU deubiquitinase 3 HGNC:29038 details
hsa-miR-4803 ATP9A ATPase phospholipid transporting 9A (putative) HGNC:13540 details
hsa-miR-4803 TMEM218 transmembrane protein 218 HGNC:27344 details
hsa-miR-4803 TAF2 TATA-box binding protein associated factor 2 HGNC:11536 details
hsa-miR-4803 CCND1 cyclin D1 HGNC:1582 details
hsa-miR-4803 PKNOX1 PBX/knotted 1 homeobox 1 HGNC:9022 details
hsa-miR-4803 RETSAT retinol saturase HGNC:25991 details
hsa-miR-4803 TBC1D28 TBC1 domain family member 28 HGNC:26858 details
hsa-miR-4803 TMEM178B transmembrane protein 178B HGNC:44112 details
hsa-miR-4803 SOGA3 SOGA family member 3 HGNC:21494 details
hsa-miR-4803 ZYG11B zyg-11 family member B, cell cycle regulator HGNC:25820 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab