CircNet

miRNA General Information

Basic
Network

miRNA ID	hsa-miR-519a-3p
Description	Homo sapiens miR-519a-1 stem-loop
Comment	None
Experiment	array-cloned [1], cloned [2]
Sequence	AAAGUGCAUCCUUUUAGAGUGU

miRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan
chr12:55994113\|55994293	hsa-miR-519a-3p	1	1	0
chr12:116952244\|116952511	hsa-miR-519a-3p	1	1	0

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr5:96773957\|96774129	hsa-miR-519a-3p	1	0
chr12:6591956\|6592057	hsa-miR-519a-3p	0	1
chr1:203743185\|203743288	hsa-miR-519a-3p	0	1
chr10:68338670\|68339469	hsa-miR-519a-3p	0	1
chr13:42322589\|42322753	hsa-miR-519a-3p	0	1
chr1:203743132\|203743288	hsa-miR-519a-3p	0	1
chr14:74510091\|74510213	hsa-miR-519a-3p	0	1
chr11:62629892\|62630394	hsa-miR-519a-3p	0	1
chr9:83069181\|83069349	hsa-miR-519a-3p	0	1
chr17:63834181\|63834544	hsa-miR-519a-3p	0	1
chr12:89626562\|89627704	hsa-miR-519a-3p	0	1
chr2:105386361\|105386540	hsa-miR-519a-3p	0	1
chr11:57801974\|57802166	hsa-miR-519a-3p	0	1
chr1:36334849\|36335176	hsa-miR-519a-3p	0	1
chr5:168414424\|168414546	hsa-miR-519a-3p	0	1
chr6:127970122\|127970277	hsa-miR-519a-3p	0	1
chr11:66849087\|66849347	hsa-miR-519a-3p	0	1
chr3:129369668\|129369791	hsa-miR-519a-3p	1	0
chr9:83069049\|83069349	hsa-miR-519a-3p	0	1
chr17:63834181\|63834548	hsa-miR-519a-3p	0	1
chr9:136440727\|136440978	hsa-miR-519a-3p	0	1
chr7:143139083\|143139163	hsa-miR-519a-3p	0	1
chr12:107733686\|107733967	hsa-miR-519a-3p	0	1
chr6:127970122\|127973042	hsa-miR-519a-3p	0	1
chr19:40396438\|40396692	hsa-miR-519a-3p	0	1
chr20:45943147\|45943690	hsa-miR-519a-3p	0	1
chr17:76009515\|76009871	hsa-miR-519a-3p	0	1
chr16:69462462\|69462617	hsa-miR-519a-3p	0	1
chr16:2767022\|2767132	hsa-miR-519a-3p	0	1
chr15:58879144\|58879286	hsa-miR-519a-3p	0	1
chr7:44876576\|44876773	hsa-miR-519a-3p	0	1
chr15:59663493\|59663652	hsa-miR-519a-3p	0	1
chr10:103599524\|103599655	hsa-miR-519a-3p	0	1
chr6:131949408\|131949557	hsa-miR-519a-3p	0	1
chr9:129739684\|129739836	hsa-miR-519a-3p	0	1
chr2:75136403\|75136573	hsa-miR-519a-3p	0	1
chr4:2926944\|2927045	hsa-miR-519a-3p	0	1
chr10:68338670\|68339484	hsa-miR-519a-3p	0	1
chr10:60869697\|60869880	hsa-miR-519a-3p	0	1
chr14:21091411\|21091886	hsa-miR-519a-3p	0	1
chr10:68339140\|68339478	hsa-miR-519a-3p	0	1
chr1:6252899\|6253035	hsa-miR-519a-3p	0	1
chr1:36335111\|36335176	hsa-miR-519a-3p	0	1
chr9:129739604\|129739853	hsa-miR-519a-3p	0	1
chr10:73779618\|73779754	hsa-miR-519a-3p	0	1
chr13:20066960~20067352	hsa-miR-519a-3p	0	1
chr2:217801594~217801707	hsa-miR-519a-3p	0	1
chr2:105386361~105386540	hsa-miR-519a-3p	0	1
chr17:63834181~63834544	hsa-miR-519a-3p	0	1
chr17:63834181~63834548	hsa-miR-519a-3p	0	1
chr9:121283020~121283136	hsa-miR-519a-3p	0	1
chr10:133362701~133362831	hsa-miR-519a-3p	0	1
chr6:89326631~89326888	hsa-miR-519a-3p	0	1
chr6:131949408~131949557	hsa-miR-519a-3p	0	1
chr11:44124865~44124975	hsa-miR-519a-3p	0	1
chr19:47209700~47209842	hsa-miR-519a-3p	0	1
chr11:66531951~66532126	hsa-miR-519a-3p	0	1
chr12:49763986~49764188	hsa-miR-519a-3p	0	1
chr1:90939786~90939882	hsa-miR-519a-3p	0	1
chr1:203743185~203743288	hsa-miR-519a-3p	0	1
chr1:53210485~53210625	hsa-miR-519a-3p	0	1
chr17:64369778\|64370005	hsa-miR-519a-3p	0	1
chr21:33263648\|33263829	hsa-miR-519a-3p	0	1
chr1:92475667\|92475890	hsa-miR-519a-3p	0	1
chr20:18527920\|18528103	hsa-miR-519a-3p	0	1
chr1:234430286\|234433502	hsa-miR-519a-3p	0	1
chr19:13006147\|13006430	hsa-miR-519a-3p	0	1
chr9:2120579\|2120761	hsa-miR-519a-3p	0	1
chr1:6097387\|6097555	hsa-miR-519a-3p	0	1
chr2:218396272\|218396453	hsa-miR-519a-3p	0	1
chr12:56428460\|56428672	hsa-miR-519a-3p	0	1
chr15:48342193\|48342360	hsa-miR-519a-3p	0	1
chr20:35001024\|35001137	hsa-miR-519a-3p	0	1
chr11:46746282\|46746502	hsa-miR-519a-3p	0	1
chr2:168241354\|168241611	hsa-miR-519a-3p	0	1
chr2:203240622\|203240735	hsa-miR-519a-3p	0	1
chr19:55232812\|55232934	hsa-miR-519a-3p	0	1
chr1:245994186\|245994390	hsa-miR-519a-3p	0	1
chr12:94209590\|94220163	hsa-miR-519a-3p	0	1
chr15:90211368\|90211602	hsa-miR-519a-3p	0	1
chr11:62602775\|62602917	hsa-miR-519a-3p	0	1
chr11:62625032\|62625364	hsa-miR-519a-3p	1	0
chr11:62625113\|62625250	hsa-miR-519a-3p	1	0
chr11:62625032\|62625380	hsa-miR-519a-3p	1	0
chr17:76009602\|76009724	hsa-miR-519a-3p	0	1
chr4:42078307\|42078597	hsa-miR-519a-3p	0	1
chr1:36093666\|36093806	hsa-miR-519a-3p	0	1
chr16:2767030\|2767129	hsa-miR-519a-3p	0	1
chr9:128258121\|128258517	hsa-miR-519a-3p	0	1
chr15:39591284\|39591601	hsa-miR-519a-3p	0	1
chr1:36093649\|36093806	hsa-miR-519a-3p	0	1
chr19:40396384\|40396638	hsa-miR-519a-3p	0	1
chr4:20589644\|20595722	hsa-miR-519a-3p	0	1
chr20:32236946\|32237030	hsa-miR-519a-3p	0	1
chr2:201380802\|201380992	hsa-miR-519a-3p	0	1
chr1:46813509\|46813933	hsa-miR-519a-3p	0	1
chr17:76009515\|76009652	hsa-miR-519a-3p	0	1
chr8:29069366\|29069488	hsa-miR-519a-3p	0	1
chr10:133362765\|133364701	hsa-miR-519a-3p	0	1
chr7:93890291\|93890688	hsa-miR-519a-3p	0	1
chr2:85551531\|85551871	hsa-miR-519a-3p	0	1
chr20:15636604\|15636772	hsa-miR-519a-3p	0	1
chr7:25656727\|25656889	hsa-miR-519a-3p	0	1
chr4:139701473\|139701641	hsa-miR-519a-3p	0	1
chr7:93890300\|93890688	hsa-miR-519a-3p	0	1
chr7:44484968\|44485092	hsa-miR-519a-3p	0	1
chr6:47129615\|47129864	hsa-miR-519a-3p	0	1
chr7:93890267\|93890617	hsa-miR-519a-3p	0	1
chr12:49763986\|49764188	hsa-miR-519a-3p	0	1
chr9:128258121\|128258478	hsa-miR-519a-3p	0	1
chr18:68897219\|68897682	hsa-miR-519a-3p	0	1
chr8:28750657\|28750761	hsa-miR-519a-3p	0	1
chr1:36093631\|36093806	hsa-miR-519a-3p	0	1
chr12:122143092\|122143189	hsa-miR-519a-3p	0	1
chr5:177338488\|177351193	hsa-miR-519a-3p	0	1
chr9:120902364\|120902449	hsa-miR-519a-3p	0	1
chr9:3223334\|3223452	hsa-miR-519a-3p	0	1
chr20:2838432\|2838682	hsa-miR-519a-3p	0	1
chr7:87182150\|87182337	hsa-miR-519a-3p	0	1
chr12:124011702\|124011862	hsa-miR-519a-3p	0	1
chr12:48134739\|48135019	hsa-miR-519a-3p	0	1
chr3:41294317\|41294625	hsa-miR-519a-3p	0	1
chr10:68339140\|68339469	hsa-miR-519a-3p	0	1
chr12:57601981\|57602209	hsa-miR-519a-3p	0	1
chr9:128258121\|128258520	hsa-miR-519a-3p	-4	1
chr12:57601981\|57602085	hsa-miR-519a-3p	-14	1
chr10:68339149\|68339484	hsa-miR-519a-3p	-12	1
chr9:132679584\|132679691	hsa-miR-519a-3p	-11	1
chr15:43403335\|43403537	hsa-miR-519a-3p	-8	1
chr6:122724389\|122724599	hsa-miR-519a-3p	-5	1
chr17:64214066\|64214240	hsa-miR-519a-3p	-4	1
chr4:73418188\|73419623	hsa-miR-519a-3p	1	0
chr13:110879412\|110879696	hsa-miR-519a-3p	0	1
chr11:14259674\|14260724	hsa-miR-519a-3p	0	1
chr2:86505407\|86505667	hsa-miR-519a-3p	0	1
chr17:78126531\|78126880	hsa-miR-519a-3p	0	1
chr7:134933973\|134935765	hsa-miR-519a-3p	0	1
chr20:10672860\|10673006	hsa-miR-519a-3p	0	1
chr3:123585647\|123585801	hsa-miR-519a-3p	0	1
chr12:51994526\|51994686	hsa-miR-519a-3p	0	1
chr1:44637586\|44637738	hsa-miR-519a-3p	0	1
chr10:49018854\|49019142	hsa-miR-519a-3p	0	1
chr12:1787952\|1788140	hsa-miR-519a-3p	0	1
chr10:42519268\|42519394	hsa-miR-519a-3p	0	1
chr2:159433141\|159433265	hsa-miR-519a-3p	0	1
chr16:69462477\|69462749	hsa-miR-519a-3p	0	1
chr22:38685878\|38686078	hsa-miR-519a-3p	0	1
chr4:75048456\|75048619	hsa-miR-519a-3p	0	1
chr6:127970098\|127970280	hsa-miR-519a-3p	0	1
chr12:1788046\|1788309	hsa-miR-519a-3p	0	1
chr5:168414385\|168414546	hsa-miR-519a-3p	0	1
chr7:44876576\|44876691	hsa-miR-519a-3p	0	1
chr17:76009515\|76009662	hsa-miR-519a-3p	0	1
chr12:51994474\|51994686	hsa-miR-519a-3p	0	1
chr2:226796876\|226797079	hsa-miR-519a-3p	0	1
chr10:133362765\|133362888	hsa-miR-519a-3p	0	1
chrX:136207016\|136207190	hsa-miR-519a-3p	0	1
chr5:9549877\|9549995	hsa-miR-519a-3p	0	1
chr1:32895367\|32895693	hsa-miR-519a-3p	0	1
chr1:53210469\|53210625	hsa-miR-519a-3p	0	1
chr1:84501826\|84501970	hsa-miR-519a-3p	0	1
chr9:86024981\|86025132	hsa-miR-519a-3p	0	1
chr15:41770525\|41770641	hsa-miR-519a-3p	0	1
chr7:134933355\|134935765	hsa-miR-519a-3p	0	1
chr8:102649217\|102649358	hsa-miR-519a-3p	0	1
chr4:8601224\|8601382	hsa-miR-519a-3p	1	0
chr17:47680520\|47680665	hsa-miR-519a-3p	1	0

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-miR-519a-3p	ELAVL1	ELAV like RNA binding protein 1	HGNC:3312	details
hsa-miR-519a-3p	YES1	YES proto-oncogene 1, Src family tyrosine kinase	HGNC:12841	details
hsa-miR-519a-3p	DICER1	dicer 1, ribonuclease III	HGNC:17098	details
hsa-miR-519a-3p	PTEN	phosphatase and tensin homolog	HGNC:9588	details
hsa-miR-519a-3p	CDKN1A	cyclin dependent kinase inhibitor 1A	HGNC:1784	details
hsa-miR-519a-3p	TIMP1	TIMP metallopeptidase inhibitor 1	HGNC:11820	details
hsa-miR-519a-3p	FAM9C	family with sequence similarity 9 member C	HGNC:18405	details
hsa-miR-519a-3p	PRNP	prion protein	HGNC:9449	details
hsa-miR-519a-3p				details
hsa-miR-519a-3p	WNK3	WNK lysine deficient protein kinase 3	HGNC:14543	details
hsa-miR-519a-3p	CDADC1	cytidine and dCMP deaminase domain containing 1	HGNC:20299	details
hsa-miR-519a-3p	TAX1BP1	Tax1 binding protein 1	HGNC:11575	details
hsa-miR-519a-3p	COX10	cytochrome c oxidase assembly factor heme A:farnesyltransferase COX10	HGNC:2260	details
hsa-miR-519a-3p	MPDU1	mannose-P-dolichol utilization defect 1	HGNC:7207	details
hsa-miR-519a-3p	NTN1	netrin 1	HGNC:8029	details
hsa-miR-519a-3p	ZFYVE9	zinc finger FYVE-type containing 9	HGNC:6775	details
hsa-miR-519a-3p	ZBTB5	zinc finger and BTB domain containing 5	HGNC:23836	details
hsa-miR-519a-3p	ZBTB34	zinc finger and BTB domain containing 34	HGNC:31446	details
hsa-miR-519a-3p	UBTF	upstream binding transcription factor	HGNC:12511	details
hsa-miR-519a-3p	RPS27A	ribosomal protein S27a	HGNC:10417	details
hsa-miR-519a-3p	TRIP10	thyroid hormone receptor interactor 10	HGNC:12304	details
hsa-miR-519a-3p	TFAM	transcription factor A, mitochondrial	HGNC:11741	details
hsa-miR-519a-3p	STX6	syntaxin 6	HGNC:11441	details
hsa-miR-519a-3p	SPTY2D1	SPT2 chromatin protein domain containing 1	HGNC:26818	details
hsa-miR-519a-3p	SHOC2	SHOC2 leucine rich repeat scaffold protein	HGNC:15454	details
hsa-miR-519a-3p	SGMS1	sphingomyelin synthase 1	HGNC:29799	details
hsa-miR-519a-3p	RAB5B	RAB5B, member RAS oncogene family	HGNC:9784	details
hsa-miR-519a-3p	PXK	PX domain containing serine/threonine kinase like	HGNC:23326	details
hsa-miR-519a-3p	PITPNA	phosphatidylinositol transfer protein alpha	HGNC:9001	details
hsa-miR-519a-3p	PAQR5	progestin and adipoQ receptor family member 5	HGNC:29645	details
hsa-miR-519a-3p	NRBP1	nuclear receptor binding protein 1	HGNC:7993	details
hsa-miR-519a-3p	NR1D2	nuclear receptor subfamily 1 group D member 2	HGNC:7963	details
hsa-miR-519a-3p	NIN	ninein	HGNC:14906	details
hsa-miR-519a-3p	NFIB	nuclear factor I B	HGNC:7785	details
hsa-miR-519a-3p	NETO2	neuropilin and tolloid like 2	HGNC:14644	details
hsa-miR-519a-3p	MLLT1	MLLT1 super elongation complex subunit	HGNC:7134	details
hsa-miR-519a-3p	MIDN	midnolin	HGNC:16298	details
hsa-miR-519a-3p	MARK2	microtubule affinity regulating kinase 2	HGNC:3332	details
hsa-miR-519a-3p	MAPKBP1	mitogen-activated protein kinase binding protein 1	HGNC:29536	details
hsa-miR-519a-3p	MAP3K2	mitogen-activated protein kinase kinase kinase 2	HGNC:6854	details
hsa-miR-519a-3p	LASP1	LIM and SH3 protein 1	HGNC:6513	details
hsa-miR-519a-3p	KLHL28	kelch like family member 28	HGNC:19741	details
hsa-miR-519a-3p	KIF13A	kinesin family member 13A	HGNC:14566	details
hsa-miR-519a-3p	KCTD10	potassium channel tetramerization domain containing 10	HGNC:23236	details
hsa-miR-519a-3p	HSPA8	heat shock protein family A (Hsp70) member 8	HGNC:5241	details
hsa-miR-519a-3p	GPR157	G protein-coupled receptor 157	HGNC:23687	details
hsa-miR-519a-3p	GNS	glucosamine (N-acetyl)-6-sulfatase	HGNC:4422	details
hsa-miR-519a-3p	FZD6	frizzled class receptor 6	HGNC:4044	details
hsa-miR-519a-3p	MIGA2	mitoguardin 2	HGNC:23621	details
hsa-miR-519a-3p	F3	coagulation factor III, tissue factor	HGNC:3541	details
hsa-miR-519a-3p	DLG5	discs large MAGUK scaffold protein 5	HGNC:2904	details
hsa-miR-519a-3p	CSNK1A1	casein kinase 1 alpha 1	HGNC:2451	details
hsa-miR-519a-3p	CNOT6L	CCR4-NOT transcription complex subunit 6 like	HGNC:18042	details
hsa-miR-519a-3p	CASP2	caspase 2	HGNC:1503	details
hsa-miR-519a-3p	CAPRIN2	caprin family member 2	HGNC:21259	details
hsa-miR-519a-3p	EMSY	EMSY transcriptional repressor, BRCA2 interacting	HGNC:18071	details
hsa-miR-519a-3p	BLCAP	BLCAP apoptosis inducing factor	HGNC:1055	details
hsa-miR-519a-3p	BBX	BBX high mobility group box domain containing	HGNC:14422	details
hsa-miR-519a-3p	ATL3	atlastin GTPase 3	HGNC:24526	details
hsa-miR-519a-3p	ARHGAP1	Rho GTPase activating protein 1	HGNC:673	details
hsa-miR-519a-3p	APH1A	aph-1 homolog A, gamma-secretase subunit	HGNC:29509	details
hsa-miR-519a-3p	ANKRD50	ankyrin repeat domain 50	HGNC:29223	details
hsa-miR-519a-3p	ADAR	adenosine deaminase RNA specific	HGNC:225	details
hsa-miR-519a-3p	ZNF652	zinc finger protein 652	HGNC:29147	details
hsa-miR-519a-3p	SOX4	SRY-box transcription factor 4	HGNC:11200	details
hsa-miR-519a-3p	SLC30A1	solute carrier family 30 member 1	HGNC:11012	details
hsa-miR-519a-3p	NFAT5	nuclear factor of activated T cells 5	HGNC:7774	details
hsa-miR-519a-3p	LDLR	low density lipoprotein receptor	HGNC:6547	details
hsa-miR-519a-3p	FOXQ1	forkhead box Q1	HGNC:20951	details
hsa-miR-519a-3p	FBXL5	F-box and leucine rich repeat protein 5	HGNC:13602	details
hsa-miR-519a-3p	DAZAP2	DAZ associated protein 2	HGNC:2684	details
hsa-miR-519a-3p	ARID4B	AT-rich interaction domain 4B	HGNC:15550	details
hsa-miR-519a-3p	ANKH	ANKH inorganic pyrophosphate transport regulator	HGNC:15492	details
hsa-miR-519a-3p	CNOT4	CCR4-NOT transcription complex subunit 4	HGNC:7880	details
hsa-miR-519a-3p	ZDHHC20	zinc finger DHHC-type palmitoyltransferase 20	HGNC:20749	details
hsa-miR-519a-3p	MPLKIP	M-phase specific PLK1 interacting protein	HGNC:16002	details
hsa-miR-519a-3p	PDRG1	p53 and DNA damage regulated 1	HGNC:16119	details
hsa-miR-519a-3p	TSG101	tumor susceptibility 101	HGNC:15971	details
hsa-miR-519a-3p	TAOK1	TAO kinase 1	HGNC:29259	details
hsa-miR-519a-3p	SEMA7A	semaphorin 7A (John Milton Hagen blood group)	HGNC:10741	details
hsa-miR-519a-3p	PDGFB	platelet derived growth factor subunit B	HGNC:8800	details
hsa-miR-519a-3p	LAPTM4A	lysosomal protein transmembrane 4 alpha	HGNC:6924	details
hsa-miR-519a-3p	HMGB3	high mobility group box 3	HGNC:5004	details
hsa-miR-519a-3p	HBP1	HMG-box transcription factor 1	HGNC:23200	details
hsa-miR-519a-3p				details
hsa-miR-519a-3p	BTF3L4	basic transcription factor 3 like 4	HGNC:30547	details
hsa-miR-519a-3p	ANKRD33B	ankyrin repeat domain 33B	HGNC:35240	details
hsa-miR-519a-3p	DDR2	discoidin domain receptor tyrosine kinase 2	HGNC:2731	details
hsa-miR-519a-3p	SNX5	sorting nexin 5	HGNC:14969	details
hsa-miR-519a-3p	C3orf38	chromosome 3 open reading frame 38	HGNC:28384	details
hsa-miR-519a-3p	KIAA1191	KIAA1191	HGNC:29209	details
hsa-miR-519a-3p	ZBTB4	zinc finger and BTB domain containing 4	HGNC:23847	details
hsa-miR-519a-3p	TRIM37	tripartite motif containing 37	HGNC:7523	details
hsa-miR-519a-3p	TMEM127	transmembrane protein 127	HGNC:26038	details
hsa-miR-519a-3p	SKIL	SKI like proto-oncogene	HGNC:10897	details
hsa-miR-519a-3p	RBBP6	RB binding protein 6, ubiquitin ligase	HGNC:9889	details
hsa-miR-519a-3p	PTPN4	protein tyrosine phosphatase non-receptor type 4	HGNC:9656	details
hsa-miR-519a-3p	PPP1R15B	protein phosphatase 1 regulatory subunit 15B	HGNC:14951	details
hsa-miR-519a-3p	POC1B-GALNT4	POC1B-GALNT4 readthrough	HGNC:42957	details
hsa-miR-519a-3p	MAPRE3	microtubule associated protein RP/EB family member 3	HGNC:6892	details
hsa-miR-519a-3p	MAPK1	mitogen-activated protein kinase 1	HGNC:6871	details
hsa-miR-519a-3p	MAP7	microtubule associated protein 7	HGNC:6869	details
hsa-miR-519a-3p	LAMTOR1	late endosomal/lysosomal adaptor, MAPK and MTOR activator 1	HGNC:26068	details
hsa-miR-519a-3p	GALNT4	polypeptide N-acetylgalactosaminyltransferase 4	HGNC:4126	details
hsa-miR-519a-3p	DNAJB9	DnaJ heat shock protein family (Hsp40) member B9	HGNC:6968	details
hsa-miR-519a-3p	CAMSAP2	calmodulin regulated spectrin associated protein family member 2	HGNC:29188	details
hsa-miR-519a-3p	TMEM242	transmembrane protein 242	HGNC:17206	details
hsa-miR-519a-3p	PARP1	poly(ADP-ribose) polymerase 1	HGNC:270	details
hsa-miR-519a-3p	ZNF417	zinc finger protein 417	HGNC:20646	details
hsa-miR-519a-3p	ZNF202	zinc finger protein 202	HGNC:12994	details
hsa-miR-519a-3p	UBN2	ubinuclein 2	HGNC:21931	details
hsa-miR-519a-3p	SRSF2	serine and arginine rich splicing factor 2	HGNC:10783	details
hsa-miR-519a-3p				details
hsa-miR-519a-3p	POLR1B	RNA polymerase I subunit B	HGNC:20454	details
hsa-miR-519a-3p	QKI	QKI, KH domain containing RNA binding	HGNC:21100	details
hsa-miR-519a-3p	PHTF2	putative homeodomain transcription factor 2	HGNC:13411	details
hsa-miR-519a-3p	NUFIP2	nuclear FMR1 interacting protein 2	HGNC:17634	details
hsa-miR-519a-3p	NAGK	N-acetylglucosamine kinase	HGNC:17174	details
hsa-miR-519a-3p	NACC2	NACC family member 2	HGNC:23846	details
hsa-miR-519a-3p	LZIC	leucine zipper and CTNNBIP1 domain containing	HGNC:17497	details
hsa-miR-519a-3p	KIF23	kinesin family member 23	HGNC:6392	details
hsa-miR-519a-3p	PCLAF	PCNA clamp associated factor	HGNC:28961	details
hsa-miR-519a-3p				details
hsa-miR-519a-3p	CREBRF	CREB3 regulatory factor	HGNC:24050	details
hsa-miR-519a-3p	CMPK1	cytidine/uridine monophosphate kinase 1	HGNC:18170	details
hsa-miR-519a-3p	BNIP2	BCL2 interacting protein 2	HGNC:1083	details
hsa-miR-519a-3p	SMAD4	SMAD family member 4	HGNC:6770	details
hsa-miR-519a-3p	MCM7	minichromosome maintenance complex component 7	HGNC:6950	details
hsa-miR-519a-3p	ZNF317	zinc finger protein 317	HGNC:13507	details
hsa-miR-519a-3p	RAN	RAN, member RAS oncogene family	HGNC:9846	details
hsa-miR-519a-3p	NIPA1	NIPA magnesium transporter 1	HGNC:17043	details
hsa-miR-519a-3p	NABP1	nucleic acid binding protein 1	HGNC:26232	details
hsa-miR-519a-3p	KLHL36	kelch like family member 36	HGNC:17844	details
hsa-miR-519a-3p	IFNAR2	interferon alpha and beta receptor subunit 2	HGNC:5433	details
hsa-miR-519a-3p	FNBP1L	formin binding protein 1 like	HGNC:20851	details
hsa-miR-519a-3p	RBM20	RNA binding motif protein 20	HGNC:27424	details
hsa-miR-519a-3p	PKNOX1	PBX/knotted 1 homeobox 1	HGNC:9022	details
hsa-miR-519a-3p	CEP97	centrosomal protein 97	HGNC:26244	details
hsa-miR-519a-3p	CENPQ	centromere protein Q	HGNC:21347	details
hsa-miR-519a-3p	EPS15L1	epidermal growth factor receptor pathway substrate 15 like 1	HGNC:24634	details
hsa-miR-519a-3p	MFAP2	microfibril associated protein 2	HGNC:7033	details
hsa-miR-519a-3p	ZNFX1	zinc finger NFX1-type containing 1	HGNC:29271	details
hsa-miR-519a-3p	RRAGD	Ras related GTP binding D	HGNC:19903	details
hsa-miR-519a-3p	RPP14	ribonuclease P/MRP subunit p14	HGNC:30327	details
hsa-miR-519a-3p	PRKAA1	protein kinase AMP-activated catalytic subunit alpha 1	HGNC:9376	details
hsa-miR-519a-3p	PPIG	peptidylprolyl isomerase G	HGNC:14650	details
hsa-miR-519a-3p	NR2C2	nuclear receptor subfamily 2 group C member 2	HGNC:7972	details
hsa-miR-519a-3p	CLIC4	chloride intracellular channel 4	HGNC:13518	details
hsa-miR-519a-3p	BTG3	BTG anti-proliferation factor 3	HGNC:1132	details
hsa-miR-519a-3p	NHSL2	NHS like 2	HGNC:33737	details
hsa-miR-519a-3p	RPRD2	regulation of nuclear pre-mRNA domain containing 2	HGNC:29039	details
hsa-miR-519a-3p	TMEM196	transmembrane protein 196	HGNC:22431	details
hsa-miR-519a-3p	CLEC12B	C-type lectin domain family 12 member B	HGNC:31966	details
hsa-miR-519a-3p	RABGAP1	RAB GTPase activating protein 1	HGNC:17155	details
hsa-miR-519a-3p	ICMT	isoprenylcysteine carboxyl methyltransferase	HGNC:5350	details
hsa-miR-519a-3p	HADHB	hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit beta	HGNC:4803	details
hsa-miR-519a-3p	RAG1	recombination activating 1	HGNC:9831	details
hsa-miR-519a-3p	PEX13	peroxisomal biogenesis factor 13	HGNC:8855	details
hsa-miR-519a-3p	U2SURP	U2 snRNP associated SURP domain containing	HGNC:30855	details
hsa-miR-519a-3p	SLC12A7	solute carrier family 12 member 7	HGNC:10915	details
hsa-miR-519a-3p	SLAIN2	SLAIN motif family member 2	HGNC:29282	details
hsa-miR-519a-3p	SALL3	spalt like transcription factor 3	HGNC:10527	details
hsa-miR-519a-3p	RASGEF1A	RasGEF domain family member 1A	HGNC:24246	details
hsa-miR-519a-3p	PLEKHB2	pleckstrin homology domain containing B2	HGNC:19236	details
hsa-miR-519a-3p	PIGA	phosphatidylinositol glycan anchor biosynthesis class A	HGNC:8957	details
hsa-miR-519a-3p	PER1	period circadian regulator 1	HGNC:8845	details
hsa-miR-519a-3p	PAK2	p21 (RAC1) activated kinase 2	HGNC:8591	details
hsa-miR-519a-3p				details
hsa-miR-519a-3p	MCUR1	mitochondrial calcium uniporter regulator 1	HGNC:21097	details
hsa-miR-519a-3p	MBNL1	muscleblind like splicing regulator 1	HGNC:6923	details
hsa-miR-519a-3p	MAP1B	microtubule associated protein 1B	HGNC:6836	details
hsa-miR-519a-3p	LEFTY1	left-right determination factor 1	HGNC:6552	details
hsa-miR-519a-3p	KREMEN1	kringle containing transmembrane protein 1	HGNC:17550	details
hsa-miR-519a-3p	KMT2B	lysine methyltransferase 2B	HGNC:15840	details
hsa-miR-519a-3p	IRF2	interferon regulatory factor 2	HGNC:6117	details
hsa-miR-519a-3p	INO80D	INO80 complex subunit D	HGNC:25997	details
hsa-miR-519a-3p	HIVEP2	HIVEP zinc finger 2	HGNC:4921	details
hsa-miR-519a-3p	HAS3	hyaluronan synthase 3	HGNC:4820	details
hsa-miR-519a-3p	GALNT3	polypeptide N-acetylgalactosaminyltransferase 3	HGNC:4125	details
hsa-miR-519a-3p	FAM102B	family with sequence similarity 102 member B	HGNC:27637	details
hsa-miR-519a-3p	ETNK1	ethanolamine kinase 1	HGNC:24649	details
hsa-miR-519a-3p	ELAVL2	ELAV like RNA binding protein 2	HGNC:3313	details
hsa-miR-519a-3p	DPYSL2	dihydropyrimidinase like 2	HGNC:3014	details
hsa-miR-519a-3p	DPP8	dipeptidyl peptidase 8	HGNC:16490	details
hsa-miR-519a-3p	DNAJB6	DnaJ heat shock protein family (Hsp40) member B6	HGNC:14888	details
hsa-miR-519a-3p	CUL3	cullin 3	HGNC:2553	details
hsa-miR-519a-3p	CLCN3	chloride voltage-gated channel 3	HGNC:2021	details
hsa-miR-519a-3p	CCSAP	centriole, cilia and spindle associated protein	HGNC:29578	details
hsa-miR-519a-3p	CCND2	cyclin D2	HGNC:1583	details
hsa-miR-519a-3p	BMT2	base methyltransferase of 25S rRNA 2 homolog	HGNC:26475	details
hsa-miR-519a-3p	BTG1	BTG anti-proliferation factor 1	HGNC:1130	details
hsa-miR-519a-3p	BRI3BP	BRI3 binding protein	HGNC:14251	details
hsa-miR-519a-3p	ATP6V1C1	ATPase H+ transporting V1 subunit C1	HGNC:856	details
hsa-miR-519a-3p	ATMIN	ATM interactor	HGNC:29034	details
hsa-miR-519a-3p	ARL10	ADP ribosylation factor like GTPase 10	HGNC:22042	details
hsa-miR-519a-3p	ADARB2	adenosine deaminase RNA specific B2 (inactive)	HGNC:227	details
hsa-miR-519a-3p	RLIM	ring finger protein, LIM domain interacting	HGNC:13429	details
hsa-miR-519a-3p	MSMO1	methylsterol monooxygenase 1	HGNC:10545	details
hsa-miR-519a-3p	GDF11	growth differentiation factor 11	HGNC:4216	details
hsa-miR-519a-3p	SKA2	spindle and kinetochore associated complex subunit 2	HGNC:28006	details
hsa-miR-519a-3p	FICD	FIC domain protein adenylyltransferase	HGNC:18416	details
hsa-miR-519a-3p	RPF2	ribosome production factor 2 homolog	HGNC:20870	details
hsa-miR-519a-3p	IPMK	inositol polyphosphate multikinase	HGNC:20739	details
hsa-miR-519a-3p	CSDE1	cold shock domain containing E1	HGNC:29905	details
hsa-miR-519a-3p	ZNF224	zinc finger protein 224	HGNC:13017	details
hsa-miR-519a-3p	MFF	mitochondrial fission factor	HGNC:24858	details
hsa-miR-519a-3p	TPRG1L	tumor protein p63 regulated 1 like	HGNC:27007	details
hsa-miR-519a-3p	TNFRSF21	TNF receptor superfamily member 21	HGNC:13469	details
hsa-miR-519a-3p	TMEM30A	transmembrane protein 30A	HGNC:16667	details
hsa-miR-519a-3p	TMEM200C	transmembrane protein 200C	HGNC:37208	details
hsa-miR-519a-3p	TGFBR2	transforming growth factor beta receptor 2	HGNC:11773	details
hsa-miR-519a-3p	SMOC1	SPARC related modular calcium binding 1	HGNC:20318	details
hsa-miR-519a-3p	SLC5A3	solute carrier family 5 member 3	HGNC:11038	details
hsa-miR-519a-3p	SLC25A44	solute carrier family 25 member 44	HGNC:29036	details
hsa-miR-519a-3p	SATB2	SATB homeobox 2	HGNC:21637	details
hsa-miR-519a-3p	RAP2C	RAP2C, member of RAS oncogene family	HGNC:21165	details
hsa-miR-519a-3p	RAB10	RAB10, member RAS oncogene family	HGNC:9759	details
hsa-miR-519a-3p	POGZ	pogo transposable element derived with ZNF domain	HGNC:18801	details
hsa-miR-519a-3p	MBNL3	muscleblind like splicing regulator 3	HGNC:20564	details
hsa-miR-519a-3p	LCLAT1	lysocardiolipin acyltransferase 1	HGNC:26756	details
hsa-miR-519a-3p	KATNAL1	katanin catalytic subunit A1 like 1	HGNC:28361	details
hsa-miR-519a-3p	HSPA13	heat shock protein family A (Hsp70) member 13	HGNC:11375	details
hsa-miR-519a-3p	FJX1	four-jointed box kinase 1	HGNC:17166	details
hsa-miR-519a-3p	EPHA4	EPH receptor A4	HGNC:3388	details
hsa-miR-519a-3p	ENPP5	ectonucleotide pyrophosphatase/phosphodiesterase family member 5	HGNC:13717	details
hsa-miR-519a-3p	EGLN3	egl-9 family hypoxia inducible factor 3	HGNC:14661	details
hsa-miR-519a-3p	DNAJB14	DnaJ heat shock protein family (Hsp40) member B14	HGNC:25881	details
hsa-miR-519a-3p	CERCAM	cerebral endothelial cell adhesion molecule	HGNC:23723	details
hsa-miR-519a-3p	CHEK2	checkpoint kinase 2	HGNC:16627	details
hsa-miR-519a-3p	ARHGAP12	Rho GTPase activating protein 12	HGNC:16348	details
hsa-miR-519a-3p	ACSL4	acyl-CoA synthetase long chain family member 4	HGNC:3571	details
hsa-miR-519a-3p	MAVS	mitochondrial antiviral signaling protein	HGNC:29233	details
hsa-miR-519a-3p	PVR	PVR cell adhesion molecule	HGNC:9705	details
hsa-miR-519a-3p	ZNF681	zinc finger protein 681	HGNC:26457	details
hsa-miR-519a-3p	HABP4	hyaluronan binding protein 4	HGNC:17062	details
hsa-miR-519a-3p	ZNF107	zinc finger protein 107	HGNC:12887	details
hsa-miR-519a-3p	DCTPP1	dCTP pyrophosphatase 1	HGNC:28777	details
hsa-miR-519a-3p	FANCM	FA complementation group M	HGNC:23168	details
hsa-miR-519a-3p	DAD1	defender against cell death 1	HGNC:2664	details
hsa-miR-519a-3p	ZBTB18	zinc finger and BTB domain containing 18	HGNC:13030	details
hsa-miR-519a-3p	WIPF2	WAS/WASL interacting protein family member 2	HGNC:30923	details
hsa-miR-519a-3p	WASL	WASP like actin nucleation promoting factor	HGNC:12735	details
hsa-miR-519a-3p	UEVLD	UEV and lactate/malate dehyrogenase domains	HGNC:30866	details
hsa-miR-519a-3p	UBXN2A	UBX domain protein 2A	HGNC:27265	details
hsa-miR-519a-3p	TFAP4	transcription factor AP-4	HGNC:11745	details
hsa-miR-519a-3p	TCF7L2	transcription factor 7 like 2	HGNC:11641	details
hsa-miR-519a-3p	STK11IP	serine/threonine kinase 11 interacting protein	HGNC:19184	details
hsa-miR-519a-3p	SOCS7	suppressor of cytokine signaling 7	HGNC:29846	details
hsa-miR-519a-3p	SAMD8	sterile alpha motif domain containing 8	HGNC:26320	details
hsa-miR-519a-3p	RPS6KA5	ribosomal protein S6 kinase A5	HGNC:10434	details
hsa-miR-519a-3p	REEP3	receptor accessory protein 3	HGNC:23711	details
hsa-miR-519a-3p	RDH11	retinol dehydrogenase 11	HGNC:17964	details
hsa-miR-519a-3p	RB1	RB transcriptional corepressor 1	HGNC:9884	details
hsa-miR-519a-3p	PPP6R3	protein phosphatase 6 regulatory subunit 3	HGNC:1173	details
hsa-miR-519a-3p	MECP2	methyl-CpG binding protein 2	HGNC:6990	details
hsa-miR-519a-3p	MCC	MCC regulator of WNT signaling pathway	HGNC:6935	details
hsa-miR-519a-3p	LIN52	lin-52 DREAM MuvB core complex component	HGNC:19856	details
hsa-miR-519a-3p	KLHL21	kelch like family member 21	HGNC:29041	details
hsa-miR-519a-3p	HOXB3	homeobox B3	HGNC:5114	details
hsa-miR-519a-3p	GNPTAB	N-acetylglucosamine-1-phosphate transferase subunits alpha and beta	HGNC:29670	details
hsa-miR-519a-3p	GLCE	glucuronic acid epimerase	HGNC:17855	details
hsa-miR-519a-3p	GATA6	GATA binding protein 6	HGNC:4174	details
hsa-miR-519a-3p	FRS2	fibroblast growth factor receptor substrate 2	HGNC:16971	details
hsa-miR-519a-3p	FEM1B	fem-1 homolog B	HGNC:3649	details
hsa-miR-519a-3p	FCHO2	FCH and mu domain containing endocytic adaptor 2	HGNC:25180	details
hsa-miR-519a-3p	ENPP4	ectonucleotide pyrophosphatase/phosphodiesterase 4	HGNC:3359	details
hsa-miR-519a-3p	EFCAB14	EF-hand calcium binding domain 14	HGNC:29051	details
hsa-miR-519a-3p	DYNC1LI2	dynein cytoplasmic 1 light intermediate chain 2	HGNC:2966	details
hsa-miR-519a-3p	DNAJC28	DnaJ heat shock protein family (Hsp40) member C28	HGNC:1297	details
hsa-miR-519a-3p	CFL2	cofilin 2	HGNC:1875	details
hsa-miR-519a-3p				details
hsa-miR-519a-3p	ASB6	ankyrin repeat and SOCS box containing 6	HGNC:17181	details
hsa-miR-519a-3p	ZBTB37	zinc finger and BTB domain containing 37	HGNC:28365	details
hsa-miR-519a-3p	RUNX3	RUNX family transcription factor 3	HGNC:10473	details
hsa-miR-519a-3p	CCDC71L	coiled-coil domain containing 71 like	HGNC:26685	details
hsa-miR-519a-3p	LRPAP1	LDL receptor related protein associated protein 1	HGNC:6701	details
hsa-miR-519a-3p	CCDC137	coiled-coil domain containing 137	HGNC:33451	details
hsa-miR-519a-3p	ZNF35	zinc finger protein 35	HGNC:13099	details
hsa-miR-519a-3p	SESN3	sestrin 3	HGNC:23060	details
hsa-miR-519a-3p	SCAMP2	secretory carrier membrane protein 2	HGNC:10564	details
hsa-miR-519a-3p	RACGAP1	Rac GTPase activating protein 1	HGNC:9804	details
hsa-miR-519a-3p	PRRG4	proline rich and Gla domain 4	HGNC:30799	details
hsa-miR-519a-3p	KCNB1	potassium voltage-gated channel subfamily B member 1	HGNC:6231	details
hsa-miR-519a-3p	KBTBD2	kelch repeat and BTB domain containing 2	HGNC:21751	details
hsa-miR-519a-3p				details
hsa-miR-519a-3p	FAM210A	family with sequence similarity 210 member A	HGNC:28346	details
hsa-miR-519a-3p	CLIP4	CAP-Gly domain containing linker protein family member 4	HGNC:26108	details
hsa-miR-519a-3p	BICD2	BICD cargo adaptor 2	HGNC:17208	details
hsa-miR-519a-3p	ZNF70	zinc finger protein 70	HGNC:13140	details
hsa-miR-519a-3p	TSKU	tsukushi, small leucine rich proteoglycan	HGNC:28850	details
hsa-miR-519a-3p	PSD3	pleckstrin and Sec7 domain containing 3	HGNC:19093	details
hsa-miR-519a-3p	POU2F1	POU class 2 homeobox 1	HGNC:9212	details
hsa-miR-519a-3p	NKIRAS1	NFKB inhibitor interacting Ras like 1	HGNC:17899	details
hsa-miR-519a-3p	LIMA1	LIM domain and actin binding 1	HGNC:24636	details
hsa-miR-519a-3p	TMEM109	transmembrane protein 109	HGNC:28771	details
hsa-miR-519a-3p	NR2F2	nuclear receptor subfamily 2 group F member 2	HGNC:7976	details
hsa-miR-519a-3p	ATAT1	alpha tubulin acetyltransferase 1	HGNC:21186	details
hsa-miR-519a-3p	ESR1	estrogen receptor 1	HGNC:3467	details
hsa-miR-519a-3p	CBX8	chromobox 8	HGNC:15962	details
hsa-miR-519a-3p	SLC35C2	solute carrier family 35 member C2	HGNC:17117	details
hsa-miR-519a-3p	PTPN9	protein tyrosine phosphatase non-receptor type 9	HGNC:9661	details
hsa-miR-519a-3p	USP32	ubiquitin specific peptidase 32	HGNC:19143	details
hsa-miR-519a-3p	SEC23B	SEC23 homolog B, COPII coat complex component	HGNC:10702	details
hsa-miR-519a-3p	GRK3	G protein-coupled receptor kinase 3	HGNC:290	details
hsa-miR-519a-3p	PRPF4	pre-mRNA processing factor 4	HGNC:17349	details
hsa-miR-519a-3p				details
hsa-miR-519a-3p	PURB	purine rich element binding protein B	HGNC:9702	details
hsa-miR-519a-3p	KLF10	Kruppel like factor 10	HGNC:11810	details
hsa-miR-519a-3p				details
hsa-miR-519a-3p	MOCS2	molybdenum cofactor synthesis 2	HGNC:7193	details
hsa-miR-519a-3p	C3orf18	chromosome 3 open reading frame 18	HGNC:24837	details
hsa-miR-519a-3p	KBTBD6	kelch repeat and BTB domain containing 6	HGNC:25340	details
hsa-miR-519a-3p	CDCA4	cell division cycle associated 4	HGNC:14625	details
hsa-miR-519a-3p	IFNLR1	interferon lambda receptor 1	HGNC:18584	details
hsa-miR-519a-3p	RFXAP	regulatory factor X associated protein	HGNC:9988	details
hsa-miR-519a-3p	KLRD1	killer cell lectin like receptor D1	HGNC:6378	details
hsa-miR-519a-3p	MED8	mediator complex subunit 8	HGNC:19971	details
hsa-miR-519a-3p	IGF2R	insulin like growth factor 2 receptor	HGNC:5467	details
hsa-miR-519a-3p	TMTC1	transmembrane O-mannosyltransferase targeting cadherins 1	HGNC:24099	details
hsa-miR-519a-3p	FKTN	fukutin	HGNC:3622	details
hsa-miR-519a-3p	TRAF3IP1	TRAF3 interacting protein 1	HGNC:17861	details
hsa-miR-519a-3p	FAM114A1	family with sequence similarity 114 member A1	HGNC:25087	details
hsa-miR-519a-3p	CHERP	calcium homeostasis endoplasmic reticulum protein	HGNC:16930	details
hsa-miR-519a-3p	FOXF2	forkhead box F2	HGNC:3810	details
hsa-miR-519a-3p	STAT3	signal transducer and activator of transcription 3	HGNC:11364	details
hsa-miR-519a-3p	CELF1	CUGBP Elav-like family member 1	HGNC:2549	details
hsa-miR-519a-3p	COX6C	cytochrome c oxidase subunit 6C	HGNC:2285	details
hsa-miR-519a-3p	DCBLD2	discoidin, CUB and LCCL domain containing 2	HGNC:24627	details
hsa-miR-519a-3p	EREG	epiregulin	HGNC:3443	details
hsa-miR-519a-3p	KDM6B	lysine demethylase 6B	HGNC:29012	details
hsa-miR-519a-3p	KLHDC10	kelch domain containing 10	HGNC:22194	details
hsa-miR-519a-3p	KLHL8	kelch like family member 8	HGNC:18644	details
hsa-miR-519a-3p				details
hsa-miR-519a-3p	NBL1	NBL1, DAN family BMP antagonist	HGNC:7650	details
hsa-miR-519a-3p	PKMYT1	protein kinase, membrane associated tyrosine/threonine 1	HGNC:29650	details
hsa-miR-519a-3p	SEC16A	SEC16 homolog A, endoplasmic reticulum export factor	HGNC:29006	details
hsa-miR-519a-3p	SLCO5A1	solute carrier organic anion transporter family member 5A1	HGNC:19046	details
hsa-miR-519a-3p	TNFRSF10B	TNF receptor superfamily member 10b	HGNC:11905	details
hsa-miR-519a-3p	UBC	ubiquitin C	HGNC:12468	details
hsa-miR-519a-3p	ABHD12	abhydrolase domain containing 12, lysophospholipase	HGNC:15868	details
hsa-miR-519a-3p	ATP6V0E1	ATPase H+ transporting V0 subunit e1	HGNC:863	details
hsa-miR-519a-3p	FAM83F	family with sequence similarity 83 member F	HGNC:25148	details
hsa-miR-519a-3p	GRB10	growth factor receptor bound protein 10	HGNC:4564	details
hsa-miR-519a-3p	HNRNPUL1	heterogeneous nuclear ribonucleoprotein U like 1	HGNC:17011	details
hsa-miR-519a-3p	LIMK1	LIM domain kinase 1	HGNC:6613	details
hsa-miR-519a-3p	LRCH3	leucine rich repeats and calponin homology domain containing 3	HGNC:28637	details
hsa-miR-519a-3p	NDUFAF3	NADH:ubiquinone oxidoreductase complex assembly factor 3	HGNC:29918	details
hsa-miR-519a-3p	PRR5-ARHGAP8	PRR5-ARHGAP8 readthrough	HGNC:34512	details
hsa-miR-519a-3p	STX3	syntaxin 3	HGNC:11438	details
hsa-miR-519a-3p	VAMP3	vesicle associated membrane protein 3	HGNC:12644	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)