miRNA Card

miRNA General Information
miRNA ID hsa-miR-548ac
Description Homo sapiens miR-548ac stem-loop
Comment None
Experiment Illumina [1]
Sequence CAAAAACCGGCAAUUACUUUUG
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr19:18307214|18307373 hsa-miR-548ac 0 1 0
chr15:56701173|56704148 hsa-miR-548ac 0 1 0
chr6:49472063|49472183 hsa-miR-548ac 0 1 0
chr14:22836575|22836749 hsa-miR-548ac 0 1 0
chr6:7882432|7882659 hsa-miR-548ac 0 1 0
chr21:36375855|36375967 hsa-miR-548ac 0 1 0
chr10:37392228|37392320 hsa-miR-548ac 0 1 0
chr6:7882538|7882659 hsa-miR-548ac 0 1 0
chr1:20500847|20501232 hsa-miR-548ac 0 1 0
chr6:49472063~49472183 hsa-miR-548ac 0 1 0
chr1:32334284|32334463 hsa-miR-548ac 0 1 0
chr2:43291808|43291918 hsa-miR-548ac 0 1 0
chr18:70293049|70293195 hsa-miR-548ac 0 1 0
chr17:10147423|10147619 hsa-miR-548ac 0 1 0
chr10:73553597|73553794 hsa-miR-548ac 0 1 0
chr8:128092390|128092497 hsa-miR-548ac 0 1 0
chrX:2612150|2612218 hsa-miR-548ac 0 1 0
chr7:99400821|99401019 hsa-miR-548ac 0 1 0
chr5:157789753|157789857 hsa-miR-548ac 0 1 0
chr3:31593130|31593283 hsa-miR-548ac 0 1 0
chr15:42735965|42736357 hsa-miR-548ac 0 1 0
chr9:34436803|34436965 hsa-miR-548ac 0 1 0
chr14:22836617|22836764 hsa-miR-548ac 0 1 0
chr1:154466842|154467001 hsa-miR-548ac 0 1 0
chr12:132584158|132584262 hsa-miR-548ac 0 1 0
chr2:99394296|99394557 hsa-miR-548ac 0 1 0
chr1:154466832|154467001 hsa-miR-548ac 0 1 0
chr14:22836617|22836749 hsa-miR-548ac 0 1 0
chr14:22836617|22836743 hsa-miR-548ac 0 1 0
chr3:32248162|32282659 hsa-miR-548ac 0 1 0
chr14:91725427|91725527 hsa-miR-548ac 0 1 0
chr9:113408595|113408824 hsa-miR-548ac 0 1 0
chr6:7882538|7882652 hsa-miR-548ac 0 1 0
chr19:39386377|39386711 hsa-miR-548ac 0 1 0
chr22:21002391|21002545 hsa-miR-548ac 0 1 0
chr1:154466893|154467001 hsa-miR-548ac 0 1 0
chr14:22836569|22836764 hsa-miR-548ac 0 1 0
chr17:1678762|1679130 hsa-miR-548ac 0 1 0
chr2:200419250|200419496 hsa-miR-548ac 0 1 0
chr14:22836613|22836743 hsa-miR-548ac 0 1 0
chr14:38253596|38253742 hsa-miR-548ac 0 1 0
chr19:18307151|18307362 hsa-miR-548ac 0 1 0
chr17:81029528|81029663 hsa-miR-548ac 0 1 0
chr19:18307151|18307369 hsa-miR-548ac 0 1 0
chr1:32334141|32334309 hsa-miR-548ac 0 1 0
chr15:39597241|39597336 hsa-miR-548ac 0 1 0
chr15:43386206|43386300 hsa-miR-548ac 0 1 0
chr1:64841245|64841476 hsa-miR-548ac 0 1 0
chr3:185193307|185193466 hsa-miR-548ac 0 1 0
chr1:16396641|16396726 hsa-miR-548ac 0 1 0
chr3:185193307|185193444 hsa-miR-548ac 0 1 0
chr14:55065314|55065570 hsa-miR-548ac 0 1 0
chr15:39597239|39597336 hsa-miR-548ac 0 1 0
chr3:177021657|177021732 hsa-miR-548ac 0 1 0
chr16:69701865|69701995 hsa-miR-548ac 0 1 0
chr10:246439|246703 hsa-miR-548ac 0 1 0
chr3:154352744|154352846 hsa-miR-548ac 0 1 0
chr1:149934209|149934493 hsa-miR-548ac 0 1 0
chr1:149934209|149934321 hsa-miR-548ac 0 1 0
chr6:31640873|31641190 hsa-miR-548ac 0 1 0
chr3:53781566|53781703 hsa-miR-548ac 0 1 0
chr17:47118464|47118622 hsa-miR-548ac 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-548ac TMEM158 transmembrane protein 158 HGNC:30293 details
hsa-miR-548ac HMX3 H6 family homeobox 3 HGNC:5019 details
hsa-miR-548ac FRMD5 FERM domain containing 5 HGNC:28214 details
hsa-miR-548ac PTPRG protein tyrosine phosphatase receptor type G HGNC:9671 details
hsa-miR-548ac HSBP1 heat shock factor binding protein 1 HGNC:5203 details
hsa-miR-548ac EXD2 exonuclease 3'-5' domain containing 2 HGNC:20217 details
hsa-miR-548ac TNFSF15 TNF superfamily member 15 HGNC:11931 details
hsa-miR-548ac CD1D CD1d molecule HGNC:1637 details
hsa-miR-548ac RABIF RAB interacting factor HGNC:9797 details
hsa-miR-548ac ACSL3 acyl-CoA synthetase long chain family member 3 HGNC:3570 details
hsa-miR-548ac ABHD2 abhydrolase domain containing 2, acylglycerol lipase HGNC:18717 details
hsa-miR-548ac details
hsa-miR-548ac TMCC3 transmembrane and coiled-coil domain family 3 HGNC:29199 details
hsa-miR-548ac P2RY10 P2Y receptor family member 10 HGNC:19906 details
hsa-miR-548ac ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 HGNC:221 details
hsa-miR-548ac PALM2 paralemmin 2 HGNC:15845 details
hsa-miR-548ac IMP3 IMP U3 small nucleolar ribonucleoprotein 3 HGNC:14497 details
hsa-miR-548ac GABRB3 gamma-aminobutyric acid type A receptor subunit beta3 HGNC:4083 details
hsa-miR-548ac ZNF101 zinc finger protein 101 HGNC:12881 details
hsa-miR-548ac GRK2 G protein-coupled receptor kinase 2 HGNC:289 details
hsa-miR-548ac NUDT19 nudix hydrolase 19 HGNC:32036 details
hsa-miR-548ac UGCG UDP-glucose ceramide glucosyltransferase HGNC:12524 details
hsa-miR-548ac TSC22D2 TSC22 domain family member 2 HGNC:29095 details
hsa-miR-548ac TM9SF3 transmembrane 9 superfamily member 3 HGNC:21529 details
hsa-miR-548ac SUZ12 SUZ12 polycomb repressive complex 2 subunit HGNC:17101 details
hsa-miR-548ac SKIL SKI like proto-oncogene HGNC:10897 details
hsa-miR-548ac SDC4 syndecan 4 HGNC:10661 details
hsa-miR-548ac RHOB ras homolog family member B HGNC:668 details
hsa-miR-548ac POLR2D RNA polymerase II subunit D HGNC:9191 details
hsa-miR-548ac POGK pogo transposable element derived with KRAB domain HGNC:18800 details
hsa-miR-548ac PDIA6 protein disulfide isomerase family A member 6 HGNC:30168 details
hsa-miR-548ac PDE4D phosphodiesterase 4D HGNC:8783 details
hsa-miR-548ac NR2F2 nuclear receptor subfamily 2 group F member 2 HGNC:7976 details
hsa-miR-548ac NEK7 NIMA related kinase 7 HGNC:13386 details
hsa-miR-548ac M6PR mannose-6-phosphate receptor, cation dependent HGNC:6752 details
hsa-miR-548ac KANSL1 KAT8 regulatory NSL complex subunit 1 HGNC:24565 details
hsa-miR-548ac CDKN1B cyclin dependent kinase inhibitor 1B HGNC:1785 details
hsa-miR-548ac details
hsa-miR-548ac AR androgen receptor HGNC:644 details
hsa-miR-548ac AKAP11 A-kinase anchoring protein 11 HGNC:369 details
hsa-miR-548ac ACTB actin beta HGNC:132 details
hsa-miR-548ac ABCE1 ATP binding cassette subfamily E member 1 HGNC:69 details
hsa-miR-548ac INHBA inhibin subunit beta A HGNC:6066 details
hsa-miR-548ac IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-548ac ANKEF1 ankyrin repeat and EF-hand domain containing 1 HGNC:15803 details
hsa-miR-548ac YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta HGNC:12855 details
hsa-miR-548ac SOX4 SRY-box transcription factor 4 HGNC:11200 details
hsa-miR-548ac ARNTL aryl hydrocarbon receptor nuclear translocator like HGNC:701 details
hsa-miR-548ac SF1 splicing factor 1 HGNC:12950 details
hsa-miR-548ac HSPA1B heat shock protein family A (Hsp70) member 1B HGNC:5233 details
hsa-miR-548ac CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 HGNC:3230 details
hsa-miR-548ac CDC37L1 cell division cycle 37 like 1 HGNC:17179 details
hsa-miR-548ac FBXL13 F-box and leucine rich repeat protein 13 HGNC:21658 details
hsa-miR-548ac MYO6 myosin VI HGNC:7605 details
hsa-miR-548ac MC2R melanocortin 2 receptor HGNC:6930 details
hsa-miR-548ac PURA purine rich element binding protein A HGNC:9701 details
hsa-miR-548ac NHLRC3 NHL repeat containing 3 HGNC:33751 details
hsa-miR-548ac BCAT1 branched chain amino acid transaminase 1 HGNC:976 details
hsa-miR-548ac YES1 YES proto-oncogene 1, Src family tyrosine kinase HGNC:12841 details
hsa-miR-548ac MRGBP MRG domain binding protein HGNC:15866 details
hsa-miR-548ac HMGN2 high mobility group nucleosomal binding domain 2 HGNC:4986 details
hsa-miR-548ac AMER1 APC membrane recruitment protein 1 HGNC:26837 details
hsa-miR-548ac ID4 inhibitor of DNA binding 4, HLH protein HGNC:5363 details
hsa-miR-548ac XRCC3 X-ray repair cross complementing 3 HGNC:12830 details
hsa-miR-548ac MYBPC1 myosin binding protein C1 HGNC:7549 details
hsa-miR-548ac SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase HGNC:25016 details
hsa-miR-548ac UBE2D1 ubiquitin conjugating enzyme E2 D1 HGNC:12474 details
hsa-miR-548ac PSMA2 proteasome 20S subunit alpha 2 HGNC:9531 details
hsa-miR-548ac PPP3R1 protein phosphatase 3 regulatory subunit B, alpha HGNC:9317 details
hsa-miR-548ac MBNL3 muscleblind like splicing regulator 3 HGNC:20564 details
hsa-miR-548ac LRRC55 leucine rich repeat containing 55 HGNC:32324 details
hsa-miR-548ac CDC5L cell division cycle 5 like HGNC:1743 details
hsa-miR-548ac SYNM synemin HGNC:24466 details
hsa-miR-548ac PPIA peptidylprolyl isomerase A HGNC:9253 details
hsa-miR-548ac CLASP1 cytoplasmic linker associated protein 1 HGNC:17088 details
hsa-miR-548ac FBLN2 fibulin 2 HGNC:3601 details
hsa-miR-548ac MGARP mitochondria localized glutamic acid rich protein HGNC:29969 details
hsa-miR-548ac SMU1 SMU1 DNA replication regulator and spliceosomal factor HGNC:18247 details
hsa-miR-548ac COL4A3 collagen type IV alpha 3 chain HGNC:2204 details
hsa-miR-548ac TBC1D22B TBC1 domain family member 22B HGNC:21602 details
hsa-miR-548ac TOMM20 translocase of outer mitochondrial membrane 20 HGNC:20947 details
hsa-miR-548ac ZNF100 zinc finger protein 100 HGNC:12880 details
hsa-miR-548ac ATRNL1 attractin like 1 HGNC:29063 details
hsa-miR-548ac PDE5A phosphodiesterase 5A HGNC:8784 details
hsa-miR-548ac SEL1L SEL1L adaptor subunit of ERAD E3 ubiquitin ligase HGNC:10717 details
hsa-miR-548ac MKRN3 makorin ring finger protein 3 HGNC:7114 details
hsa-miR-548ac TMEM18 transmembrane protein 18 HGNC:25257 details
hsa-miR-548ac WDR13 WD repeat domain 13 HGNC:14352 details
hsa-miR-548ac VKORC1L1 vitamin K epoxide reductase complex subunit 1 like 1 HGNC:21492 details
hsa-miR-548ac RNF20 ring finger protein 20 HGNC:10062 details
hsa-miR-548ac RAB33B RAB33B, member RAS oncogene family HGNC:16075 details
hsa-miR-548ac FAM169A family with sequence similarity 169 member A HGNC:29138 details
hsa-miR-548ac CABLES1 Cdk5 and Abl enzyme substrate 1 HGNC:25097 details
hsa-miR-548ac ARL10 ADP ribosylation factor like GTPase 10 HGNC:22042 details
hsa-miR-548ac SLC25A43 solute carrier family 25 member 43 HGNC:30557 details
hsa-miR-548ac CDC27 cell division cycle 27 HGNC:1728 details
hsa-miR-548ac details
hsa-miR-548ac ZNF829 zinc finger protein 829 HGNC:34032 details
hsa-miR-548ac MFAP3 microfibril associated protein 3 HGNC:7034 details
hsa-miR-548ac YY2 YY2 transcription factor HGNC:31684 details
hsa-miR-548ac SNCB synuclein beta HGNC:11140 details
hsa-miR-548ac SPC25 SPC25 component of NDC80 kinetochore complex HGNC:24031 details
hsa-miR-548ac VEZF1 vascular endothelial zinc finger 1 HGNC:12949 details
hsa-miR-548ac STRN3 striatin 3 HGNC:15720 details
hsa-miR-548ac DCUN1D3 defective in cullin neddylation 1 domain containing 3 HGNC:28734 details
hsa-miR-548ac DAZAP1 DAZ associated protein 1 HGNC:2683 details
hsa-miR-548ac CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 HGNC:1775 details
hsa-miR-548ac ZNF681 zinc finger protein 681 HGNC:26457 details
hsa-miR-548ac SLC29A1 solute carrier family 29 member 1 (Augustine blood group) HGNC:11003 details
hsa-miR-548ac LLGL2 LLGL scribble cell polarity complex component 2 HGNC:6629 details
hsa-miR-548ac SPPL3 signal peptide peptidase like 3 HGNC:30424 details
hsa-miR-548ac HDGFL2 HDGF like 2 HGNC:14680 details
hsa-miR-548ac ALG1 ALG1 chitobiosyldiphosphodolichol beta-mannosyltransferase HGNC:18294 details
hsa-miR-548ac YAF2 YY1 associated factor 2 HGNC:17363 details
hsa-miR-548ac TVP23C trans-golgi network vesicle protein 23 homolog C HGNC:30453 details
hsa-miR-548ac TSPAN3 tetraspanin 3 HGNC:17752 details
hsa-miR-548ac NPM3 nucleophosmin/nucleoplasmin 3 HGNC:7931 details
hsa-miR-548ac SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein HGNC:16918 details
hsa-miR-548ac RECK reversion inducing cysteine rich protein with kazal motifs HGNC:11345 details
hsa-miR-548ac MTF2 metal response element binding transcription factor 2 HGNC:29535 details
hsa-miR-548ac LEPROT leptin receptor overlapping transcript HGNC:29477 details
hsa-miR-548ac ITGA2 integrin subunit alpha 2 HGNC:6137 details
hsa-miR-548ac CNIH1 cornichon family AMPA receptor auxiliary protein 1 HGNC:19431 details
hsa-miR-548ac details
hsa-miR-548ac C18orf25 chromosome 18 open reading frame 25 HGNC:28172 details
hsa-miR-548ac ARF1 ADP ribosylation factor 1 HGNC:652 details
hsa-miR-548ac GSKIP GSK3B interacting protein HGNC:20343 details
hsa-miR-548ac GAL3ST3 galactose-3-O-sulfotransferase 3 HGNC:24144 details
hsa-miR-548ac SKI SKI proto-oncogene HGNC:10896 details
hsa-miR-548ac RBPJ recombination signal binding protein for immunoglobulin kappa J region HGNC:5724 details
hsa-miR-548ac GRB2 growth factor receptor bound protein 2 HGNC:4566 details
hsa-miR-548ac EIF2S2 eukaryotic translation initiation factor 2 subunit beta HGNC:3266 details
hsa-miR-548ac ARID1A AT-rich interaction domain 1A HGNC:11110 details
hsa-miR-548ac ZNF678 zinc finger protein 678 HGNC:28652 details
hsa-miR-548ac DEPDC1B DEP domain containing 1B HGNC:24902 details
hsa-miR-548ac TRA2B transformer 2 beta homolog HGNC:10781 details
hsa-miR-548ac TMEM64 transmembrane protein 64 HGNC:25441 details
hsa-miR-548ac RMND5A required for meiotic nuclear division 5 homolog A HGNC:25850 details
hsa-miR-548ac RFX1 regulatory factor X1 HGNC:9982 details
hsa-miR-548ac MTMR3 myotubularin related protein 3 HGNC:7451 details
hsa-miR-548ac GRPEL2 GrpE like 2, mitochondrial HGNC:21060 details
hsa-miR-548ac CELF2 CUGBP Elav-like family member 2 HGNC:2550 details
hsa-miR-548ac CBX3 chromobox 3 HGNC:1553 details
hsa-miR-548ac ATF7IP activating transcription factor 7 interacting protein HGNC:20092 details
hsa-miR-548ac MYBL1 MYB proto-oncogene like 1 HGNC:7547 details
hsa-miR-548ac THYN1 thymocyte nuclear protein 1 HGNC:29560 details
hsa-miR-548ac MPZL1 myelin protein zero like 1 HGNC:7226 details
hsa-miR-548ac PHF19 PHD finger protein 19 HGNC:24566 details
hsa-miR-548ac HOXA9 homeobox A9 HGNC:5109 details
hsa-miR-548ac CELF1 CUGBP Elav-like family member 1 HGNC:2549 details
hsa-miR-548ac ACOT9 acyl-CoA thioesterase 9 HGNC:17152 details
hsa-miR-548ac KHSRP KH-type splicing regulatory protein HGNC:6316 details
hsa-miR-548ac VPS50 VPS50 subunit of EARP/GARPII complex HGNC:25956 details
hsa-miR-548ac CMTM6 CKLF like MARVEL transmembrane domain containing 6 HGNC:19177 details
hsa-miR-548ac PSAT1 phosphoserine aminotransferase 1 HGNC:19129 details
hsa-miR-548ac NRBF2 nuclear receptor binding factor 2 HGNC:19692 details
hsa-miR-548ac H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase HGNC:4795 details
hsa-miR-548ac NKTR natural killer cell triggering receptor HGNC:7833 details
hsa-miR-548ac ATP9A ATPase phospholipid transporting 9A (putative) HGNC:13540 details
hsa-miR-548ac details
hsa-miR-548ac TCEAL4 transcription elongation factor A like 4 HGNC:26121 details
hsa-miR-548ac details
hsa-miR-548ac SYT2 synaptotagmin 2 HGNC:11510 details
hsa-miR-548ac NAV2 neuron navigator 2 HGNC:15997 details
hsa-miR-548ac SGO2 shugoshin 2 HGNC:30812 details
hsa-miR-548ac details
hsa-miR-548ac KCNK10 potassium two pore domain channel subfamily K member 10 HGNC:6273 details
hsa-miR-548ac SLC2A4 solute carrier family 2 member 4 HGNC:11009 details
hsa-miR-548ac HIPK3 homeodomain interacting protein kinase 3 HGNC:4915 details
hsa-miR-548ac EDIL3 EGF like repeats and discoidin domains 3 HGNC:3173 details
hsa-miR-548ac RPL3L ribosomal protein L3 like HGNC:10351 details
hsa-miR-548ac TRPC3 transient receptor potential cation channel subfamily C member 3 HGNC:12335 details
hsa-miR-548ac PCNX2 pecanex 2 HGNC:8736 details
hsa-miR-548ac TRIB2 tribbles pseudokinase 2 HGNC:30809 details
hsa-miR-548ac LSM14A LSM14A mRNA processing body assembly factor HGNC:24489 details
hsa-miR-548ac INO80C INO80 complex subunit C HGNC:26994 details
hsa-miR-548ac AMPD3 adenosine monophosphate deaminase 3 HGNC:470 details
hsa-miR-548ac MMS22L MMS22 like, DNA repair protein HGNC:21475 details
hsa-miR-548ac BRD4 bromodomain containing 4 HGNC:13575 details
hsa-miR-548ac PTPN11 protein tyrosine phosphatase non-receptor type 11 HGNC:9644 details
hsa-miR-548ac GDPGP1 GDP-D-glucose phosphorylase 1 HGNC:34360 details
hsa-miR-548ac ESR1 estrogen receptor 1 HGNC:3467 details
hsa-miR-548ac CD59 CD59 molecule (CD59 blood group) HGNC:1689 details
hsa-miR-548ac ALYREF Aly/REF export factor HGNC:19071 details
hsa-miR-548ac RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 HGNC:14436 details
hsa-miR-548ac CFAP65 cilia and flagella associated protein 65 HGNC:25325 details
hsa-miR-548ac CCR5 C-C motif chemokine receptor 5 HGNC:1606 details
hsa-miR-548ac TXNL1 thioredoxin like 1 HGNC:12436 details
hsa-miR-548ac UBE2V1 ubiquitin conjugating enzyme E2 V1 HGNC:12494 details
hsa-miR-548ac SLC25A51 solute carrier family 25 member 51 HGNC:23323 details
hsa-miR-548ac SALL1 spalt like transcription factor 1 HGNC:10524 details
hsa-miR-548ac RRAGC Ras related GTP binding C HGNC:19902 details
hsa-miR-548ac RC3H1 ring finger and CCCH-type domains 1 HGNC:29434 details
hsa-miR-548ac NRXN1 neurexin 1 HGNC:8008 details
hsa-miR-548ac MAX MYC associated factor X HGNC:6913 details
hsa-miR-548ac LUC7L2 LUC7 like 2, pre-mRNA splicing factor HGNC:21608 details
hsa-miR-548ac HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 HGNC:5031 details
hsa-miR-548ac FMNL3 formin like 3 HGNC:23698 details
hsa-miR-548ac details
hsa-miR-548ac details
hsa-miR-548ac ARID4A AT-rich interaction domain 4A HGNC:9885 details
hsa-miR-548ac ANGPTL2 angiopoietin like 2 HGNC:490 details
hsa-miR-548ac details
hsa-miR-548ac RNF2 ring finger protein 2 HGNC:10061 details
hsa-miR-548ac USF3 upstream transcription factor family member 3 HGNC:30494 details
hsa-miR-548ac AP3B1 adaptor related protein complex 3 subunit beta 1 HGNC:566 details
hsa-miR-548ac ZNF652 zinc finger protein 652 HGNC:29147 details
hsa-miR-548ac SFT2D2 SFT2 domain containing 2 HGNC:25140 details
hsa-miR-548ac RAP2B RAP2B, member of RAS oncogene family HGNC:9862 details
hsa-miR-548ac PTEN phosphatase and tensin homolog HGNC:9588 details
hsa-miR-548ac PRR3 proline rich 3 HGNC:21149 details
hsa-miR-548ac UNC93A unc-93 homolog A HGNC:12570 details
hsa-miR-548ac TNPO1 transportin 1 HGNC:6401 details
hsa-miR-548ac NOP53 NOP53 ribosome biogenesis factor HGNC:4333 details
hsa-miR-548ac SERBP1 SERPINE1 mRNA binding protein 1 HGNC:17860 details
hsa-miR-548ac PNRC1 proline rich nuclear receptor coactivator 1 HGNC:17278 details
hsa-miR-548ac TCF24 transcription factor 24 HGNC:32275 details
hsa-miR-548ac PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 HGNC:15882 details
hsa-miR-548ac C4orf3 chromosome 4 open reading frame 3 HGNC:19225 details
hsa-miR-548ac GIN1 gypsy retrotransposon integrase 1 HGNC:25959 details
hsa-miR-548ac VDR vitamin D receptor HGNC:12679 details
hsa-miR-548ac STEAP4 STEAP4 metalloreductase HGNC:21923 details
hsa-miR-548ac B3GALNT1 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) HGNC:918 details
hsa-miR-548ac TNFRSF13C TNF receptor superfamily member 13C HGNC:17755 details
hsa-miR-548ac ZCCHC9 zinc finger CCHC-type containing 9 HGNC:25424 details
hsa-miR-548ac UFM1 ubiquitin fold modifier 1 HGNC:20597 details
hsa-miR-548ac CLNK cytokine dependent hematopoietic cell linker HGNC:17438 details
hsa-miR-548ac ZNF518B zinc finger protein 518B HGNC:29365 details
hsa-miR-548ac SLC30A1 solute carrier family 30 member 1 HGNC:11012 details
hsa-miR-548ac SIX4 SIX homeobox 4 HGNC:10890 details
hsa-miR-548ac LCOR ligand dependent nuclear receptor corepressor HGNC:29503 details
hsa-miR-548ac details
hsa-miR-548ac KDM5A lysine demethylase 5A HGNC:9886 details
hsa-miR-548ac TOR1AIP2 torsin 1A interacting protein 2 HGNC:24055 details
hsa-miR-548ac GPC5 glypican 5 HGNC:4453 details
hsa-miR-548ac BTBD3 BTB domain containing 3 HGNC:15854 details
hsa-miR-548ac C9orf64 chromosome 9 open reading frame 64 HGNC:28144 details
hsa-miR-548ac TGIF2 TGFB induced factor homeobox 2 HGNC:15764 details
hsa-miR-548ac GINS2 GINS complex subunit 2 HGNC:24575 details
hsa-miR-548ac ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit HGNC:3433 details
hsa-miR-548ac AAGAB alpha and gamma adaptin binding protein HGNC:25662 details
hsa-miR-548ac TRIM45 tripartite motif containing 45 HGNC:19018 details
hsa-miR-548ac TMPPE transmembrane protein with metallophosphoesterase domain HGNC:33865 details
hsa-miR-548ac NHLRC2 NHL repeat containing 2 HGNC:24731 details
hsa-miR-548ac KCNJ15 potassium inwardly rectifying channel subfamily J member 15 HGNC:6261 details
hsa-miR-548ac HHIP hedgehog interacting protein HGNC:14866 details
hsa-miR-548ac SCIMP SLP adaptor and CSK interacting membrane protein HGNC:33504 details
hsa-miR-548ac NUDT7 nudix hydrolase 7 HGNC:8054 details
hsa-miR-548ac RSRC1 arginine and serine rich coiled-coil 1 HGNC:24152 details
hsa-miR-548ac ZNF845 zinc finger protein 845 HGNC:25112 details
hsa-miR-548ac XRN2 5'-3' exoribonuclease 2 HGNC:12836 details
hsa-miR-548ac details
hsa-miR-548ac ZFHX3 zinc finger homeobox 3 HGNC:777 details
hsa-miR-548ac TJP1 tight junction protein 1 HGNC:11827 details
hsa-miR-548ac SOAT1 sterol O-acyltransferase 1 HGNC:11177 details
hsa-miR-548ac SEMA4D semaphorin 4D HGNC:10732 details
hsa-miR-548ac NEO1 neogenin 1 HGNC:7754 details
hsa-miR-548ac MRO maestro HGNC:24121 details
hsa-miR-548ac MAP3K1 mitogen-activated protein kinase kinase kinase 1 HGNC:6848 details
hsa-miR-548ac LDLR low density lipoprotein receptor HGNC:6547 details
hsa-miR-548ac FAM126B family with sequence similarity 126 member B HGNC:28593 details
hsa-miR-548ac details
hsa-miR-548ac PGM3 phosphoglucomutase 3 HGNC:8907 details
hsa-miR-548ac LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 HGNC:26068 details
hsa-miR-548ac RHOA ras homolog family member A HGNC:667 details
hsa-miR-548ac CCBE1 collagen and calcium binding EGF domains 1 HGNC:29426 details
hsa-miR-548ac U2SURP U2 snRNP associated SURP domain containing HGNC:30855 details
hsa-miR-548ac PKIA cAMP-dependent protein kinase inhibitor alpha HGNC:9017 details
hsa-miR-548ac TADA3 transcriptional adaptor 3 HGNC:19422 details
hsa-miR-548ac NEGR1 neuronal growth regulator 1 HGNC:17302 details
hsa-miR-548ac G2E3 G2/M-phase specific E3 ubiquitin protein ligase HGNC:20338 details
hsa-miR-548ac MYOCD myocardin HGNC:16067 details
hsa-miR-548ac BUB3 BUB3 mitotic checkpoint protein HGNC:1151 details
hsa-miR-548ac ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-548ac GTF2F2 general transcription factor IIF subunit 2 HGNC:4653 details
hsa-miR-548ac TMLHE trimethyllysine hydroxylase, epsilon HGNC:18308 details
hsa-miR-548ac AGAP1 ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 HGNC:16922 details
hsa-miR-548ac FAM126A family with sequence similarity 126 member A HGNC:24587 details
hsa-miR-548ac GATM glycine amidinotransferase HGNC:4175 details
hsa-miR-548ac LRRC58 leucine rich repeat containing 58 HGNC:26968 details
hsa-miR-548ac PHF12 PHD finger protein 12 HGNC:20816 details
hsa-miR-548ac CAMLG calcium modulating ligand HGNC:1471 details
hsa-miR-548ac CAPZA1 capping actin protein of muscle Z-line subunit alpha 1 HGNC:1488 details
hsa-miR-548ac GEMIN6 gem nuclear organelle associated protein 6 HGNC:20044 details
hsa-miR-548ac HCFC1 host cell factor C1 HGNC:4839 details
hsa-miR-548ac MDM4 MDM4 regulator of p53 HGNC:6974 details
hsa-miR-548ac PF4 platelet factor 4 HGNC:8861 details
hsa-miR-548ac PTPRB protein tyrosine phosphatase receptor type B HGNC:9665 details
hsa-miR-548ac SRP19 signal recognition particle 19 HGNC:11300 details
hsa-miR-548ac SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone HGNC:16987 details
hsa-miR-548ac CCNI2 cyclin I family member 2 HGNC:33869 details
hsa-miR-548ac details
hsa-miR-548ac KIF1B kinesin family member 1B HGNC:16636 details
hsa-miR-548ac KLHDC10 kelch domain containing 10 HGNC:22194 details
hsa-miR-548ac LANCL3 LanC like 3 HGNC:24767 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab