miRNA Card

miRNA General Information
miRNA ID hsa-miR-548ah-5p
Description Homo sapiens miR-548ah stem-loop
Comment None
Experiment Illumina [1]
Sequence AAAAGUGAUUGCAGUGUUUG
miRNA Expression in different cancers



circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chrX:154366374|154366755 hsa-miR-548ah-5p 0 1 0
chr1:101083421|101083539 hsa-miR-548ah-5p 0 1 0
chr17:7462155|7462266 hsa-miR-548ah-5p 0 1 0
chr5:179871516|179873154 hsa-miR-548ah-5p 0 1 0
chr19:42239955|42240079 hsa-miR-548ah-5p 0 1 0
chr7:16777857|16779116 hsa-miR-548ah-5p 0 1 0
chr9:91421640|91421785 hsa-miR-548ah-5p 1 0 0
chrX:154354957|154355037 hsa-miR-548ah-5p 0 1 0
chrX:119243192|119243480 hsa-miR-548ah-5p 0 1 0
chr17:35830634|35830797 hsa-miR-548ah-5p 0 1 0
chr1:101083419|101083539 hsa-miR-548ah-5p 0 1 0
chr8:144095833|144096029 hsa-miR-548ah-5p 0 1 0
chr5:179729959|179730047 hsa-miR-548ah-5p 0 1 0
chr19:42239979|42240076 hsa-miR-548ah-5p 0 1 0
chr2:208236516|208236676 hsa-miR-548ah-5p 0 1 0
chr15:44729322|44729473 hsa-miR-548ah-5p 0 1 0
chr2:196781912|196782086 hsa-miR-548ah-5p 0 1 0
chr2:99376406|99376478 hsa-miR-548ah-5p 0 1 0
chr17:47678140|47678406 hsa-miR-548ah-5p 0 1 0
chr2:208236538~208236676 hsa-miR-548ah-5p 0 1 0
chr1:110345564~110345757 hsa-miR-548ah-5p 0 1 0
chr2:75672456~75672759 hsa-miR-548ah-5p 0 1 0
chr19:3163504~3163700 hsa-miR-548ah-5p 0 1 0
chr16:490067~490169 hsa-miR-548ah-5p 0 1 0
chrX:154354957~154355034 hsa-miR-548ah-5p 0 1 0
chr6:33203588~33203792 hsa-miR-548ah-5p 0 1 0
chr9:91421640~91421785 hsa-miR-548ah-5p 0 1 0
chr20:50556032|50556138 hsa-miR-548ah-5p 1 0 0
chr12:46360336|46360442 hsa-miR-548ah-5p 0 1 0
chr19:42239979|42240128 hsa-miR-548ah-5p 0 1 0
chrX:154354945|154355072 hsa-miR-548ah-5p 0 1 0
chr20:21359576|21359737 hsa-miR-548ah-5p 0 1 0
chr1:40701404|40701514 hsa-miR-548ah-5p 0 1 0
chr10:110297589|110297728 hsa-miR-548ah-5p 0 1 0
chr10:132428245|132428414 hsa-miR-548ah-5p 1 0 0
chr16:29679758|29679902 hsa-miR-548ah-5p 0 1 0
chr11:65503403|65503539 hsa-miR-548ah-5p 0 1 0
chr12:67663992|67664193 hsa-miR-548ah-5p 0 1 0
chrX:102599573|102599711 hsa-miR-548ah-5p 0 1 0
chr12:132077761|132077928 hsa-miR-548ah-5p 0 1 0
chr8:6622117|6622360 hsa-miR-548ah-5p 0 1 0
chr1:155514292|155514473 hsa-miR-548ah-5p 0 1 0
chr1:183568416|183568558 hsa-miR-548ah-5p 0 1 0
chr12:89593422|89593567 hsa-miR-548ah-5p 0 1 0
chr22:19117881|19118034 hsa-miR-548ah-5p 0 1 0
chr2:10589129|10589284 hsa-miR-548ah-5p 1 0 0
chr11:130140443|130141572 hsa-miR-548ah-5p 1 0 0
chr6:75084655|75084861 hsa-miR-548ah-5p 1 0 0
chr1:162378040|162378200 hsa-miR-548ah-5p 1 0 0
chr11:27501802|27501920 hsa-miR-548ah-5p 0 1 0
chr20:33238136|33239842 hsa-miR-548ah-5p 0 1 0
chr3:186790380|186791819 hsa-miR-548ah-5p 0 1 0
chrX:154366562|154366639 hsa-miR-548ah-5p 0 1 0
chr7:87159863|87160059 hsa-miR-548ah-5p 0 1 0
chr8:37546197|37546322 hsa-miR-548ah-5p 0 1 0
chr6:33203588|33203804 hsa-miR-548ah-5p 0 1 0
chr5:179872892|179872973 hsa-miR-548ah-5p 0 1 0
chr12:48667764|48669222 hsa-miR-548ah-5p 0 1 0
chrX:119583562|119583679 hsa-miR-548ah-5p 0 1 0
chr14:70812430|70812777 hsa-miR-548ah-5p 0 1 0
chr6:7289590|7289761 hsa-miR-548ah-5p 0 1 0
chr5:157787446|157787684 hsa-miR-548ah-5p 0 1 0
chr10:116887895|116888084 hsa-miR-548ah-5p 0 1 0
chr1:51461091|51465326 hsa-miR-548ah-5p 0 1 0
chr2:28788696|28788809 hsa-miR-548ah-5p 0 1 0
chr17:82727034|82727421 hsa-miR-548ah-5p 0 1 0
chr20:41514830|41514941 hsa-miR-548ah-5p 0 1 0
chr8:144095870|144096029 hsa-miR-548ah-5p 0 1 0
chr1:32679938|32680153 hsa-miR-548ah-5p 0 1 0
chr3:128119685|128119901 hsa-miR-548ah-5p 0 1 0
chr7:4764075|4764441 hsa-miR-548ah-5p 0 1 0
chr8:143216127|143216249 hsa-miR-548ah-5p 0 1 0
chr2:28783907|28788809 hsa-miR-548ah-5p 0 1 0
chr17:82727031|82727137 hsa-miR-548ah-5p -8 1 0
chrX:106874285|106874398 hsa-miR-548ah-5p -5 1 0
chr9:137208638|137208753 hsa-miR-548ah-5p -8 1 0
chr2:172597467|172597653 hsa-miR-548ah-5p -9 1 0
chr8:144107523|144107601 hsa-miR-548ah-5p 0 1 0
chr6:7289471|7289827 hsa-miR-548ah-5p 0 1 0
chr7:30452616|30452945 hsa-miR-548ah-5p 0 1 0
chr2:99376445|99376544 hsa-miR-548ah-5p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-548ah-5p NRIP3 nuclear receptor interacting protein 3 HGNC:1167 details
hsa-miR-548ah-5p LLPH LLP homolog, long-term synaptic facilitation factor HGNC:28229 details
hsa-miR-548ah-5p SREK1IP1 SREK1 interacting protein 1 HGNC:26716 details
hsa-miR-548ah-5p ZNF623 zinc finger protein 623 HGNC:29084 details
hsa-miR-548ah-5p TBC1D8 TBC1 domain family member 8 HGNC:17791 details
hsa-miR-548ah-5p SRSF11 serine and arginine rich splicing factor 11 HGNC:10782 details
hsa-miR-548ah-5p details
hsa-miR-548ah-5p WDR77 WD repeat domain 77 HGNC:29652 details
hsa-miR-548ah-5p WNK3 WNK lysine deficient protein kinase 3 HGNC:14543 details
hsa-miR-548ah-5p TSR1 TSR1 ribosome maturation factor HGNC:25542 details
hsa-miR-548ah-5p TP53INP1 tumor protein p53 inducible nuclear protein 1 HGNC:18022 details
hsa-miR-548ah-5p NPNT nephronectin HGNC:27405 details
hsa-miR-548ah-5p GLIS3 GLIS family zinc finger 3 HGNC:28510 details
hsa-miR-548ah-5p TMEM9B TMEM9 domain family member B HGNC:1168 details
hsa-miR-548ah-5p ATP6V0B ATPase H+ transporting V0 subunit b HGNC:861 details
hsa-miR-548ah-5p ZNF3 zinc finger protein 3 HGNC:13089 details
hsa-miR-548ah-5p CRCP CGRP receptor component HGNC:17888 details
hsa-miR-548ah-5p NEDD9 neural precursor cell expressed, developmentally down-regulated 9 HGNC:7733 details
hsa-miR-548ah-5p details
hsa-miR-548ah-5p SPAM1 sperm adhesion molecule 1 HGNC:11217 details
hsa-miR-548ah-5p FUT10 fucosyltransferase 10 HGNC:19234 details
hsa-miR-548ah-5p CD55 CD55 molecule (Cromer blood group) HGNC:2665 details
hsa-miR-548ah-5p S100A11 S100 calcium binding protein A11 HGNC:10488 details
hsa-miR-548ah-5p KRT10 keratin 10 HGNC:6413 details
hsa-miR-548ah-5p AKR7A2 aldo-keto reductase family 7 member A2 HGNC:389 details
hsa-miR-548ah-5p ZFYVE9 zinc finger FYVE-type containing 9 HGNC:6775 details
hsa-miR-548ah-5p ZBTB33 zinc finger and BTB domain containing 33 HGNC:16682 details
hsa-miR-548ah-5p TRIP10 thyroid hormone receptor interactor 10 HGNC:12304 details
hsa-miR-548ah-5p TPM4 tropomyosin 4 HGNC:12013 details
hsa-miR-548ah-5p TMEM64 transmembrane protein 64 HGNC:25441 details
hsa-miR-548ah-5p TFAM transcription factor A, mitochondrial HGNC:11741 details
hsa-miR-548ah-5p STMN1 stathmin 1 HGNC:6510 details
hsa-miR-548ah-5p SMIM13 small integral membrane protein 13 HGNC:27356 details
hsa-miR-548ah-5p SLC22A23 solute carrier family 22 member 23 HGNC:21106 details
hsa-miR-548ah-5p SGPL1 sphingosine-1-phosphate lyase 1 HGNC:10817 details
hsa-miR-548ah-5p RRM2 ribonucleotide reductase regulatory subunit M2 HGNC:10452 details
hsa-miR-548ah-5p RAB5B RAB5B, member RAS oncogene family HGNC:9784 details
hsa-miR-548ah-5p PXK PX domain containing serine/threonine kinase like HGNC:23326 details
hsa-miR-548ah-5p PURB purine rich element binding protein B HGNC:9702 details
hsa-miR-548ah-5p PPP1R15B protein phosphatase 1 regulatory subunit 15B HGNC:14951 details
hsa-miR-548ah-5p POU2F1 POU class 2 homeobox 1 HGNC:9212 details
hsa-miR-548ah-5p NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-548ah-5p NPAT nuclear protein, coactivator of histone transcription HGNC:7896 details
hsa-miR-548ah-5p NIN ninein HGNC:14906 details
hsa-miR-548ah-5p LARP1 La ribonucleoprotein 1, translational regulator HGNC:29531 details
hsa-miR-548ah-5p KLF6 Kruppel like factor 6 HGNC:2235 details
hsa-miR-548ah-5p HSPA8 heat shock protein family A (Hsp70) member 8 HGNC:5241 details
hsa-miR-548ah-5p G2E3 G2/M-phase specific E3 ubiquitin protein ligase HGNC:20338 details
hsa-miR-548ah-5p FEM1B fem-1 homolog B HGNC:3649 details
hsa-miR-548ah-5p FBXL5 F-box and leucine rich repeat protein 5 HGNC:13602 details
hsa-miR-548ah-5p F3 coagulation factor III, tissue factor HGNC:3541 details
hsa-miR-548ah-5p ERGIC2 ERGIC and golgi 2 HGNC:30208 details
hsa-miR-548ah-5p DCAF8 DDB1 and CUL4 associated factor 8 HGNC:24891 details
hsa-miR-548ah-5p COIL coilin HGNC:2184 details
hsa-miR-548ah-5p CNOT6L CCR4-NOT transcription complex subunit 6 like HGNC:18042 details
hsa-miR-548ah-5p CHSY1 chondroitin sulfate synthase 1 HGNC:17198 details
hsa-miR-548ah-5p CCND1 cyclin D1 HGNC:1582 details
hsa-miR-548ah-5p details
hsa-miR-548ah-5p EMSY EMSY transcriptional repressor, BRCA2 interacting HGNC:18071 details
hsa-miR-548ah-5p BZW1 basic leucine zipper and W2 domains 1 HGNC:18380 details
hsa-miR-548ah-5p BMP2 bone morphogenetic protein 2 HGNC:1069 details
hsa-miR-548ah-5p B2M beta-2-microglobulin HGNC:914 details
hsa-miR-548ah-5p ATXN7L3B ataxin 7 like 3B HGNC:37931 details
hsa-miR-548ah-5p ATL3 atlastin GTPase 3 HGNC:24526 details
hsa-miR-548ah-5p APEX1 apurinic/apyrimidinic endodeoxyribonuclease 1 HGNC:587 details
hsa-miR-548ah-5p ANKRD11 ankyrin repeat domain 11 HGNC:21316 details
hsa-miR-548ah-5p ANKH ANKH inorganic pyrophosphate transport regulator HGNC:15492 details
hsa-miR-548ah-5p AKAP11 A-kinase anchoring protein 11 HGNC:369 details
hsa-miR-548ah-5p ZNFX1 zinc finger NFX1-type containing 1 HGNC:29271 details
hsa-miR-548ah-5p ZFYVE26 zinc finger FYVE-type containing 26 HGNC:20761 details
hsa-miR-548ah-5p RRAS2 RAS related 2 HGNC:17271 details
hsa-miR-548ah-5p PTP4A1 protein tyrosine phosphatase 4A1 HGNC:9634 details
hsa-miR-548ah-5p NFAT5 nuclear factor of activated T cells 5 HGNC:7774 details
hsa-miR-548ah-5p MYLIP myosin regulatory light chain interacting protein HGNC:21155 details
hsa-miR-548ah-5p ZFYVE21 zinc finger FYVE-type containing 21 HGNC:20760 details
hsa-miR-548ah-5p UGCG UDP-glucose ceramide glucosyltransferase HGNC:12524 details
hsa-miR-548ah-5p SEMA7A semaphorin 7A (John Milton Hagen blood group) HGNC:10741 details
hsa-miR-548ah-5p RBPJ recombination signal binding protein for immunoglobulin kappa J region HGNC:5724 details
hsa-miR-548ah-5p MKNK2 MAPK interacting serine/threonine kinase 2 HGNC:7111 details
hsa-miR-548ah-5p MIDN midnolin HGNC:16298 details
hsa-miR-548ah-5p KIAA0513 KIAA0513 HGNC:29058 details
hsa-miR-548ah-5p HBP1 HMG-box transcription factor 1 HGNC:23200 details
hsa-miR-548ah-5p DUSP2 dual specificity phosphatase 2 HGNC:3068 details
hsa-miR-548ah-5p CAPN15 calpain 15 HGNC:11182 details
hsa-miR-548ah-5p BTG2 BTG anti-proliferation factor 2 HGNC:1131 details
hsa-miR-548ah-5p BCL2L11 BCL2 like 11 HGNC:994 details
hsa-miR-548ah-5p ANKRD33B ankyrin repeat domain 33B HGNC:35240 details
hsa-miR-548ah-5p TRIM31 tripartite motif containing 31 HGNC:16289 details
hsa-miR-548ah-5p details
hsa-miR-548ah-5p FEM1C fem-1 homolog C HGNC:16933 details
hsa-miR-548ah-5p ABHD17B abhydrolase domain containing 17B, depalmitoylase HGNC:24278 details
hsa-miR-548ah-5p KIAA1191 KIAA1191 HGNC:29209 details
hsa-miR-548ah-5p TMEM127 transmembrane protein 127 HGNC:26038 details
hsa-miR-548ah-5p PTPN4 protein tyrosine phosphatase non-receptor type 4 HGNC:9656 details
hsa-miR-548ah-5p MAPRE3 microtubule associated protein RP/EB family member 3 HGNC:6892 details
hsa-miR-548ah-5p IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-548ah-5p GIGYF1 GRB10 interacting GYF protein 1 HGNC:9126 details
hsa-miR-548ah-5p GATA6 GATA binding protein 6 HGNC:4174 details
hsa-miR-548ah-5p GINS4 GINS complex subunit 4 HGNC:28226 details
hsa-miR-548ah-5p MDM2 MDM2 proto-oncogene HGNC:6973 details
hsa-miR-548ah-5p ZNF780A zinc finger protein 780A HGNC:27603 details
hsa-miR-548ah-5p TMEM242 transmembrane protein 242 HGNC:17206 details
hsa-miR-548ah-5p C9orf40 chromosome 9 open reading frame 40 HGNC:23433 details
hsa-miR-548ah-5p SRSF2 serine and arginine rich splicing factor 2 HGNC:10783 details
hsa-miR-548ah-5p SP4 Sp4 transcription factor HGNC:11209 details
hsa-miR-548ah-5p details
hsa-miR-548ah-5p REST RE1 silencing transcription factor HGNC:9966 details
hsa-miR-548ah-5p RAB11FIP1 RAB11 family interacting protein 1 HGNC:30265 details
hsa-miR-548ah-5p PFKP phosphofructokinase, platelet HGNC:8878 details
hsa-miR-548ah-5p NAGK N-acetylglucosamine kinase HGNC:17174 details
hsa-miR-548ah-5p NACC2 NACC family member 2 HGNC:23846 details
hsa-miR-548ah-5p MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils HGNC:29383 details
hsa-miR-548ah-5p details
hsa-miR-548ah-5p LZIC leucine zipper and CTNNBIP1 domain containing HGNC:17497 details
hsa-miR-548ah-5p KIF23 kinesin family member 23 HGNC:6392 details
hsa-miR-548ah-5p details
hsa-miR-548ah-5p FZD9 frizzled class receptor 9 HGNC:4047 details
hsa-miR-548ah-5p FOXK2 forkhead box K2 HGNC:6036 details
hsa-miR-548ah-5p details
hsa-miR-548ah-5p BTF3L4 basic transcription factor 3 like 4 HGNC:30547 details
hsa-miR-548ah-5p ANKRD52 ankyrin repeat domain 52 HGNC:26614 details
hsa-miR-548ah-5p ACVR1B activin A receptor type 1B HGNC:172 details
hsa-miR-548ah-5p ZNF850 zinc finger protein 850 HGNC:27994 details
hsa-miR-548ah-5p SGMS2 sphingomyelin synthase 2 HGNC:28395 details
hsa-miR-548ah-5p PCBP2 poly(rC) binding protein 2 HGNC:8648 details
hsa-miR-548ah-5p NIPA1 NIPA magnesium transporter 1 HGNC:17043 details
hsa-miR-548ah-5p KLHL36 kelch like family member 36 HGNC:17844 details
hsa-miR-548ah-5p ACTR2 actin related protein 2 HGNC:169 details
hsa-miR-548ah-5p ENO4 enolase 4 HGNC:31670 details
hsa-miR-548ah-5p CD59 CD59 molecule (CD59 blood group) HGNC:1689 details
hsa-miR-548ah-5p details
hsa-miR-548ah-5p RAP1B RAP1B, member of RAS oncogene family HGNC:9857 details
hsa-miR-548ah-5p GRB10 growth factor receptor bound protein 10 HGNC:4564 details
hsa-miR-548ah-5p CEP97 centrosomal protein 97 HGNC:26244 details
hsa-miR-548ah-5p CENPQ centromere protein Q HGNC:21347 details
hsa-miR-548ah-5p BNIP2 BCL2 interacting protein 2 HGNC:1083 details
hsa-miR-548ah-5p EPS15L1 epidermal growth factor receptor pathway substrate 15 like 1 HGNC:24634 details
hsa-miR-548ah-5p DCK deoxycytidine kinase HGNC:2704 details
hsa-miR-548ah-5p LAPTM4B lysosomal protein transmembrane 4 beta HGNC:13646 details
hsa-miR-548ah-5p DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 HGNC:24013 details
hsa-miR-548ah-5p COX19 cytochrome c oxidase assembly factor COX19 HGNC:28074 details
hsa-miR-548ah-5p ITM2C integral membrane protein 2C HGNC:6175 details
hsa-miR-548ah-5p USF3 upstream transcription factor family member 3 HGNC:30494 details
hsa-miR-548ah-5p CRLF3 cytokine receptor like factor 3 HGNC:17177 details
hsa-miR-548ah-5p BTG3 BTG anti-proliferation factor 3 HGNC:1132 details
hsa-miR-548ah-5p ZNF93 zinc finger protein 93 HGNC:13169 details
hsa-miR-548ah-5p XIRP2 xin actin binding repeat containing 2 HGNC:14303 details
hsa-miR-548ah-5p CLEC12B C-type lectin domain family 12 member B HGNC:31966 details
hsa-miR-548ah-5p SERF1B small EDRK-rich factor 1B HGNC:10756 details
hsa-miR-548ah-5p SERF1A small EDRK-rich factor 1A HGNC:10755 details
hsa-miR-548ah-5p details
hsa-miR-548ah-5p ZNF264 zinc finger protein 264 HGNC:13057 details
hsa-miR-548ah-5p MTPAP mitochondrial poly(A) polymerase HGNC:25532 details
hsa-miR-548ah-5p RTTN rotatin HGNC:18654 details
hsa-miR-548ah-5p U2SURP U2 snRNP associated SURP domain containing HGNC:30855 details
hsa-miR-548ah-5p TGFBR2 transforming growth factor beta receptor 2 HGNC:11773 details
hsa-miR-548ah-5p TBL1XR1 TBL1X receptor 1 HGNC:29529 details
hsa-miR-548ah-5p KMT5B lysine methyltransferase 5B HGNC:24283 details
hsa-miR-548ah-5p STC2 stanniocalcin 2 HGNC:11374 details
hsa-miR-548ah-5p RNASEH1 ribonuclease H1 HGNC:18466 details
hsa-miR-548ah-5p FNBP1L formin binding protein 1 like HGNC:20851 details
hsa-miR-548ah-5p ELAVL2 ELAV like RNA binding protein 2 HGNC:3313 details
hsa-miR-548ah-5p EIF4H eukaryotic translation initiation factor 4H HGNC:12741 details
hsa-miR-548ah-5p DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 HGNC:24637 details
hsa-miR-548ah-5p CAPRIN2 caprin family member 2 HGNC:21259 details
hsa-miR-548ah-5p EIF3H eukaryotic translation initiation factor 3 subunit H HGNC:3273 details
hsa-miR-548ah-5p FOXC1 forkhead box C1 HGNC:3800 details
hsa-miR-548ah-5p CXCL10 C-X-C motif chemokine ligand 10 HGNC:10637 details
hsa-miR-548ah-5p RLIM ring finger protein, LIM domain interacting HGNC:13429 details
hsa-miR-548ah-5p GLO1 glyoxalase I HGNC:4323 details
hsa-miR-548ah-5p ZC3HAV1 zinc finger CCCH-type containing, antiviral 1 HGNC:23721 details
hsa-miR-548ah-5p PEX2 peroxisomal biogenesis factor 2 HGNC:9717 details
hsa-miR-548ah-5p SLC25A46 solute carrier family 25 member 46 HGNC:25198 details
hsa-miR-548ah-5p WDR13 WD repeat domain 13 HGNC:14352 details
hsa-miR-548ah-5p XIAP X-linked inhibitor of apoptosis HGNC:592 details
hsa-miR-548ah-5p RPS15A ribosomal protein S15a HGNC:10389 details
hsa-miR-548ah-5p KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-548ah-5p GDF11 growth differentiation factor 11 HGNC:4216 details
hsa-miR-548ah-5p DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 HGNC:3093 details
hsa-miR-548ah-5p PLS1 plastin 1 HGNC:9090 details
hsa-miR-548ah-5p RPF2 ribosome production factor 2 homolog HGNC:20870 details
hsa-miR-548ah-5p IFNGR1 interferon gamma receptor 1 HGNC:5439 details
hsa-miR-548ah-5p FCF1 FCF1 rRNA-processing protein HGNC:20220 details
hsa-miR-548ah-5p ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif 9 HGNC:13202 details
hsa-miR-548ah-5p details
hsa-miR-548ah-5p ZNF805 zinc finger protein 805 HGNC:23272 details
hsa-miR-548ah-5p ULK1 unc-51 like autophagy activating kinase 1 HGNC:12558 details
hsa-miR-548ah-5p TPRG1L tumor protein p63 regulated 1 like HGNC:27007 details
hsa-miR-548ah-5p TNFRSF21 TNF receptor superfamily member 21 HGNC:13469 details
hsa-miR-548ah-5p TMEM200C transmembrane protein 200C HGNC:37208 details
hsa-miR-548ah-5p SLC5A3 solute carrier family 5 member 3 HGNC:11038 details
hsa-miR-548ah-5p SIK1 salt inducible kinase 1 HGNC:11142 details
hsa-miR-548ah-5p RAP2C RAP2C, member of RAS oncogene family HGNC:21165 details
hsa-miR-548ah-5p RAB4A RAB4A, member RAS oncogene family HGNC:9781 details
hsa-miR-548ah-5p PLRG1 pleiotropic regulator 1 HGNC:9089 details
hsa-miR-548ah-5p FJX1 four-jointed box kinase 1 HGNC:17166 details
hsa-miR-548ah-5p EPHA4 EPH receptor A4 HGNC:3388 details
hsa-miR-548ah-5p ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase family member 5 HGNC:13717 details
hsa-miR-548ah-5p EGLN3 egl-9 family hypoxia inducible factor 3 HGNC:14661 details
hsa-miR-548ah-5p CLIC4 chloride intracellular channel 4 HGNC:13518 details
hsa-miR-548ah-5p CERCAM cerebral endothelial cell adhesion molecule HGNC:23723 details
hsa-miR-548ah-5p details
hsa-miR-548ah-5p ATXN1 ataxin 1 HGNC:10548 details
hsa-miR-548ah-5p ADAR adenosine deaminase RNA specific HGNC:225 details
hsa-miR-548ah-5p LUZP2 leucine zipper protein 2 HGNC:23206 details
hsa-miR-548ah-5p TRAPPC2 trafficking protein particle complex subunit 2 HGNC:23068 details
hsa-miR-548ah-5p TAF6 TATA-box binding protein associated factor 6 HGNC:11540 details
hsa-miR-548ah-5p PVR PVR cell adhesion molecule HGNC:9705 details
hsa-miR-548ah-5p FMNL2 formin like 2 HGNC:18267 details
hsa-miR-548ah-5p F2RL3 F2R like thrombin or trypsin receptor 3 HGNC:3540 details
hsa-miR-548ah-5p ZCCHC2 zinc finger CCHC-type containing 2 HGNC:22916 details
hsa-miR-548ah-5p ZBTB18 zinc finger and BTB domain containing 18 HGNC:13030 details
hsa-miR-548ah-5p YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta HGNC:12855 details
hsa-miR-548ah-5p USP48 ubiquitin specific peptidase 48 HGNC:18533 details
hsa-miR-548ah-5p UBXN2A UBX domain protein 2A HGNC:27265 details
hsa-miR-548ah-5p TNKS2 tankyrase 2 HGNC:15677 details
hsa-miR-548ah-5p SIPA1L2 signal induced proliferation associated 1 like 2 HGNC:23800 details
hsa-miR-548ah-5p SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 HGNC:10833 details
hsa-miR-548ah-5p SCD stearoyl-CoA desaturase HGNC:10571 details
hsa-miR-548ah-5p SAMD8 sterile alpha motif domain containing 8 HGNC:26320 details
hsa-miR-548ah-5p SAMD12 sterile alpha motif domain containing 12 HGNC:31750 details
hsa-miR-548ah-5p RUFY2 RUN and FYVE domain containing 2 HGNC:19761 details
hsa-miR-548ah-5p RRN3 RRN3 homolog, RNA polymerase I transcription factor HGNC:30346 details
hsa-miR-548ah-5p RPS6KA5 ribosomal protein S6 kinase A5 HGNC:10434 details
hsa-miR-548ah-5p RHOC ras homolog family member C HGNC:669 details
hsa-miR-548ah-5p RGMB repulsive guidance molecule BMP co-receptor b HGNC:26896 details
hsa-miR-548ah-5p RAB39B RAB39B, member RAS oncogene family HGNC:16499 details
hsa-miR-548ah-5p PTPDC1 protein tyrosine phosphatase domain containing 1 HGNC:30184 details
hsa-miR-548ah-5p PRICKLE2 prickle planar cell polarity protein 2 HGNC:20340 details
hsa-miR-548ah-5p PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 HGNC:8575 details
hsa-miR-548ah-5p OCLN occludin HGNC:8104 details
hsa-miR-548ah-5p MED17 mediator complex subunit 17 HGNC:2375 details
hsa-miR-548ah-5p MAPK1 mitogen-activated protein kinase 1 HGNC:6871 details
hsa-miR-548ah-5p ISOC1 isochorismatase domain containing 1 HGNC:24254 details
hsa-miR-548ah-5p FOXJ3 forkhead box J3 HGNC:29178 details
hsa-miR-548ah-5p FOXJ2 forkhead box J2 HGNC:24818 details
hsa-miR-548ah-5p EFCAB14 EF-hand calcium binding domain 14 HGNC:29051 details
hsa-miR-548ah-5p DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 HGNC:1297 details
hsa-miR-548ah-5p CBX1 chromobox 1 HGNC:1551 details
hsa-miR-548ah-5p CAMLG calcium modulating ligand HGNC:1471 details
hsa-miR-548ah-5p ARSJ arylsulfatase family member J HGNC:26286 details
hsa-miR-548ah-5p ZBTB37 zinc finger and BTB domain containing 37 HGNC:28365 details
hsa-miR-548ah-5p TXNIP thioredoxin interacting protein HGNC:16952 details
hsa-miR-548ah-5p RUNX3 RUNX family transcription factor 3 HGNC:10473 details
hsa-miR-548ah-5p HMGB2 high mobility group box 2 HGNC:5000 details
hsa-miR-548ah-5p CCDC71L coiled-coil domain containing 71 like HGNC:26685 details
hsa-miR-548ah-5p ZNF714 zinc finger protein 714 HGNC:27124 details
hsa-miR-548ah-5p LRPAP1 LDL receptor related protein associated protein 1 HGNC:6701 details
hsa-miR-548ah-5p DSPP dentin sialophosphoprotein HGNC:3054 details
hsa-miR-548ah-5p TRIM27 tripartite motif containing 27 HGNC:9975 details
hsa-miR-548ah-5p AKAP17A A-kinase anchoring protein 17A HGNC:18783 details
hsa-miR-548ah-5p YTHDF3 YTH N6-methyladenosine RNA binding protein 3 HGNC:26465 details
hsa-miR-548ah-5p SMG1 SMG1 nonsense mediated mRNA decay associated PI3K related kinase HGNC:30045 details
hsa-miR-548ah-5p NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit HGNC:21042 details
hsa-miR-548ah-5p LRP12 LDL receptor related protein 12 HGNC:31708 details
hsa-miR-548ah-5p KCNB1 potassium voltage-gated channel subfamily B member 1 HGNC:6231 details
hsa-miR-548ah-5p ITGB1 integrin subunit beta 1 HGNC:6153 details
hsa-miR-548ah-5p details
hsa-miR-548ah-5p FAM210A family with sequence similarity 210 member A HGNC:28346 details
hsa-miR-548ah-5p EIF4A2 eukaryotic translation initiation factor 4A2 HGNC:3284 details
hsa-miR-548ah-5p DGAT2 diacylglycerol O-acyltransferase 2 HGNC:16940 details
hsa-miR-548ah-5p CRK CRK proto-oncogene, adaptor protein HGNC:2362 details
hsa-miR-548ah-5p CAV1 caveolin 1 HGNC:1527 details
hsa-miR-548ah-5p RBM12B RNA binding motif protein 12B HGNC:32310 details
hsa-miR-548ah-5p CKAP2 cytoskeleton associated protein 2 HGNC:1990 details
hsa-miR-548ah-5p F2R coagulation factor II thrombin receptor HGNC:3537 details
hsa-miR-548ah-5p RPRD2 regulation of nuclear pre-mRNA domain containing 2 HGNC:29039 details
hsa-miR-548ah-5p RPL17-C18orf32 RPL17-C18orf32 readthrough HGNC:44661 details
hsa-miR-548ah-5p NKIRAS1 NFKB inhibitor interacting Ras like 1 HGNC:17899 details
hsa-miR-548ah-5p GPR137B G protein-coupled receptor 137B HGNC:11862 details
hsa-miR-548ah-5p DESI1 desumoylating isopeptidase 1 HGNC:24577 details
hsa-miR-548ah-5p C18orf32 chromosome 18 open reading frame 32 HGNC:31690 details
hsa-miR-548ah-5p LIMA1 LIM domain and actin binding 1 HGNC:24636 details
hsa-miR-548ah-5p SNAP47 synaptosome associated protein 47 HGNC:30669 details
hsa-miR-548ah-5p HAUS8 HAUS augmin like complex subunit 8 HGNC:30532 details
hsa-miR-548ah-5p RAB1A RAB1A, member RAS oncogene family HGNC:9758 details
hsa-miR-548ah-5p PRKCB protein kinase C beta HGNC:9395 details
hsa-miR-548ah-5p BRI3BP BRI3 binding protein HGNC:14251 details
hsa-miR-548ah-5p SH3KBP1 SH3 domain containing kinase binding protein 1 HGNC:13867 details
hsa-miR-548ah-5p FAXC failed axon connections homolog, metaxin like GST domain containing HGNC:20742 details
hsa-miR-548ah-5p MEMO1 mediator of cell motility 1 HGNC:14014 details
hsa-miR-548ah-5p FAM126B family with sequence similarity 126 member B HGNC:28593 details
hsa-miR-548ah-5p KCNK10 potassium two pore domain channel subfamily K member 10 HGNC:6273 details
hsa-miR-548ah-5p CBX8 chromobox 8 HGNC:15962 details
hsa-miR-548ah-5p APPL1 adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 HGNC:24035 details
hsa-miR-548ah-5p details
hsa-miR-548ah-5p PAK6 p21 (RAC1) activated kinase 6 HGNC:16061 details
hsa-miR-548ah-5p KIAA0232 KIAA0232 HGNC:28992 details
hsa-miR-548ah-5p OSTM1 osteoclastogenesis associated transmembrane protein 1 HGNC:21652 details
hsa-miR-548ah-5p USP32 ubiquitin specific peptidase 32 HGNC:19143 details
hsa-miR-548ah-5p LIAS lipoic acid synthetase HGNC:16429 details
hsa-miR-548ah-5p GJD3 gap junction protein delta 3 HGNC:19147 details
hsa-miR-548ah-5p CPS1 carbamoyl-phosphate synthase 1 HGNC:2323 details
hsa-miR-548ah-5p THEM4 thioesterase superfamily member 4 HGNC:17947 details
hsa-miR-548ah-5p RBMXL1 RBMX like 1 HGNC:25073 details
hsa-miR-548ah-5p THAP6 THAP domain containing 6 HGNC:23189 details
hsa-miR-548ah-5p SFT2D2 SFT2 domain containing 2 HGNC:25140 details
hsa-miR-548ah-5p MYPN myopalladin HGNC:23246 details
hsa-miR-548ah-5p MINK1 misshapen like kinase 1 HGNC:17565 details
hsa-miR-548ah-5p HIPK3 homeodomain interacting protein kinase 3 HGNC:4915 details
hsa-miR-548ah-5p HIF1A hypoxia inducible factor 1 subunit alpha HGNC:4910 details
hsa-miR-548ah-5p RHOH ras homolog family member H HGNC:686 details
hsa-miR-548ah-5p PEA15 proliferation and apoptosis adaptor protein 15 HGNC:8822 details
hsa-miR-548ah-5p COL1A1 collagen type I alpha 1 chain HGNC:2197 details
hsa-miR-548ah-5p FOXK1 forkhead box K1 HGNC:23480 details
hsa-miR-548ah-5p SATB2 SATB homeobox 2 HGNC:21637 details
hsa-miR-548ah-5p ARL5A ADP ribosylation factor like GTPase 5A HGNC:696 details
hsa-miR-548ah-5p CCDC198 coiled-coil domain containing 198 HGNC:20189 details
hsa-miR-548ah-5p DSEL dermatan sulfate epimerase like HGNC:18144 details
hsa-miR-548ah-5p EVC EvC ciliary complex subunit 1 HGNC:3497 details
hsa-miR-548ah-5p GLB1L3 galactosidase beta 1 like 3 HGNC:25147 details
hsa-miR-548ah-5p HCCS holocytochrome c synthase HGNC:4837 details
hsa-miR-548ah-5p IRAK2 interleukin 1 receptor associated kinase 2 HGNC:6113 details
hsa-miR-548ah-5p MDM4 MDM4 regulator of p53 HGNC:6974 details
hsa-miR-548ah-5p NCLN nicalin HGNC:26923 details
hsa-miR-548ah-5p NR3C1 nuclear receptor subfamily 3 group C member 1 HGNC:7978 details
hsa-miR-548ah-5p PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 HGNC:9108 details
hsa-miR-548ah-5p SESN1 sestrin 1 HGNC:21595 details
hsa-miR-548ah-5p ZNF716 zinc finger protein 716 HGNC:32458 details
hsa-miR-548ah-5p CPE carboxypeptidase E HGNC:2303 details
hsa-miR-548ah-5p PFKFB3 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 HGNC:8874 details