miRNA Card

miRNA General Information
miRNA ID hsa-miR-548aj-3p
Description Homo sapiens miR-548aj-1 stem-loop
Comment None
Experiment Illumina [1]
Sequence UAAAAACUGCAAUUACUUUUA
miRNA Expression in different cancers

    by mir_boxplot.py


circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-548aj-3p HAUS6 HAUS augmin like complex subunit 6 HGNC:25948 details
hsa-miR-548aj-3p ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like HGNC:22423 details
hsa-miR-548aj-3p ILDR1 immunoglobulin like domain containing receptor 1 HGNC:28741 details
hsa-miR-548aj-3p GJD3 gap junction protein delta 3 HGNC:19147 details
hsa-miR-548aj-3p details
hsa-miR-548aj-3p CHMP1B charged multivesicular body protein 1B HGNC:24287 details
hsa-miR-548aj-3p FRMD5 FERM domain containing 5 HGNC:28214 details
hsa-miR-548aj-3p PTPRG protein tyrosine phosphatase receptor type G HGNC:9671 details
hsa-miR-548aj-3p HSBP1 heat shock factor binding protein 1 HGNC:5203 details
hsa-miR-548aj-3p EXD2 exonuclease 3'-5' domain containing 2 HGNC:20217 details
hsa-miR-548aj-3p details
hsa-miR-548aj-3p ZNF207 zinc finger protein 207 HGNC:12998 details
hsa-miR-548aj-3p HSPA14 heat shock protein family A (Hsp70) member 14 HGNC:29526 details
hsa-miR-548aj-3p CRNKL1 crooked neck pre-mRNA splicing factor 1 HGNC:15762 details
hsa-miR-548aj-3p RCC2 regulator of chromosome condensation 2 HGNC:30297 details
hsa-miR-548aj-3p TNFSF15 TNF superfamily member 15 HGNC:11931 details
hsa-miR-548aj-3p PGK1 phosphoglycerate kinase 1 HGNC:8896 details
hsa-miR-548aj-3p DNAAF3 dynein axonemal assembly factor 3 HGNC:30492 details
hsa-miR-548aj-3p CD1D CD1d molecule HGNC:1637 details
hsa-miR-548aj-3p RABIF RAB interacting factor HGNC:9797 details
hsa-miR-548aj-3p ST6GAL2 ST6 beta-galactoside alpha-2,6-sialyltransferase 2 HGNC:10861 details
hsa-miR-548aj-3p ACSL3 acyl-CoA synthetase long chain family member 3 HGNC:3570 details
hsa-miR-548aj-3p ABHD2 abhydrolase domain containing 2, acylglycerol lipase HGNC:18717 details
hsa-miR-548aj-3p details
hsa-miR-548aj-3p MTPAP mitochondrial poly(A) polymerase HGNC:25532 details
hsa-miR-548aj-3p TMCC3 transmembrane and coiled-coil domain family 3 HGNC:29199 details
hsa-miR-548aj-3p LMAN1 lectin, mannose binding 1 HGNC:6631 details
hsa-miR-548aj-3p GSR glutathione-disulfide reductase HGNC:4623 details
hsa-miR-548aj-3p P2RY10 P2Y receptor family member 10 HGNC:19906 details
hsa-miR-548aj-3p SNAI2 snail family transcriptional repressor 2 HGNC:11094 details
hsa-miR-548aj-3p TNFAIP3 TNF alpha induced protein 3 HGNC:11896 details
hsa-miR-548aj-3p FOXN2 forkhead box N2 HGNC:5281 details
hsa-miR-548aj-3p DENND4C DENN domain containing 4C HGNC:26079 details
hsa-miR-548aj-3p ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 HGNC:221 details
hsa-miR-548aj-3p PALM2 paralemmin 2 HGNC:15845 details
hsa-miR-548aj-3p GPC5 glypican 5 HGNC:4453 details
hsa-miR-548aj-3p IMP3 IMP U3 small nucleolar ribonucleoprotein 3 HGNC:14497 details
hsa-miR-548aj-3p GABRB3 gamma-aminobutyric acid type A receptor subunit beta3 HGNC:4083 details
hsa-miR-548aj-3p EXOC2 exocyst complex component 2 HGNC:24968 details
hsa-miR-548aj-3p GRK2 G protein-coupled receptor kinase 2 HGNC:289 details
hsa-miR-548aj-3p WEE1 WEE1 G2 checkpoint kinase HGNC:12761 details
hsa-miR-548aj-3p UGCG UDP-glucose ceramide glucosyltransferase HGNC:12524 details
hsa-miR-548aj-3p TSC22D2 TSC22 domain family member 2 HGNC:29095 details
hsa-miR-548aj-3p TM9SF3 transmembrane 9 superfamily member 3 HGNC:21529 details
hsa-miR-548aj-3p SUZ12 SUZ12 polycomb repressive complex 2 subunit HGNC:17101 details
hsa-miR-548aj-3p SKIL SKI like proto-oncogene HGNC:10897 details
hsa-miR-548aj-3p RHOB ras homolog family member B HGNC:668 details
hsa-miR-548aj-3p POGK pogo transposable element derived with KRAB domain HGNC:18800 details
hsa-miR-548aj-3p NEK7 NIMA related kinase 7 HGNC:13386 details
hsa-miR-548aj-3p M6PR mannose-6-phosphate receptor, cation dependent HGNC:6752 details
hsa-miR-548aj-3p KANSL1 KAT8 regulatory NSL complex subunit 1 HGNC:24565 details
hsa-miR-548aj-3p IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 HGNC:28868 details
hsa-miR-548aj-3p MFSD14B major facilitator superfamily domain containing 14B HGNC:23376 details
hsa-miR-548aj-3p CDKN1B cyclin dependent kinase inhibitor 1B HGNC:1785 details
hsa-miR-548aj-3p ABCE1 ATP binding cassette subfamily E member 1 HGNC:69 details
hsa-miR-548aj-3p IER2 immediate early response 2 HGNC:28871 details
hsa-miR-548aj-3p FEM1C fem-1 homolog C HGNC:16933 details
hsa-miR-548aj-3p SOX4 SRY-box transcription factor 4 HGNC:11200 details
hsa-miR-548aj-3p HSPA5 heat shock protein family A (Hsp70) member 5 HGNC:5238 details
hsa-miR-548aj-3p ARNTL aryl hydrocarbon receptor nuclear translocator like HGNC:701 details
hsa-miR-548aj-3p ZNF652 zinc finger protein 652 HGNC:29147 details
hsa-miR-548aj-3p HSPA1B heat shock protein family A (Hsp70) member 1B HGNC:5233 details
hsa-miR-548aj-3p KRAS KRAS proto-oncogene, GTPase HGNC:6407 details
hsa-miR-548aj-3p CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 HGNC:3230 details
hsa-miR-548aj-3p FBXL13 F-box and leucine rich repeat protein 13 HGNC:21658 details
hsa-miR-548aj-3p MYO6 myosin VI HGNC:7605 details
hsa-miR-548aj-3p PURA purine rich element binding protein A HGNC:9701 details
hsa-miR-548aj-3p NHLRC3 NHL repeat containing 3 HGNC:33751 details
hsa-miR-548aj-3p BCAT1 branched chain amino acid transaminase 1 HGNC:976 details
hsa-miR-548aj-3p YES1 YES proto-oncogene 1, Src family tyrosine kinase HGNC:12841 details
hsa-miR-548aj-3p HES7 hes family bHLH transcription factor 7 HGNC:15977 details
hsa-miR-548aj-3p RARB retinoic acid receptor beta HGNC:9865 details
hsa-miR-548aj-3p MRGBP MRG domain binding protein HGNC:15866 details
hsa-miR-548aj-3p HMGN2 high mobility group nucleosomal binding domain 2 HGNC:4986 details
hsa-miR-548aj-3p EIF1AX eukaryotic translation initiation factor 1A X-linked HGNC:3250 details
hsa-miR-548aj-3p AMER1 APC membrane recruitment protein 1 HGNC:26837 details
hsa-miR-548aj-3p ID4 inhibitor of DNA binding 4, HLH protein HGNC:5363 details
hsa-miR-548aj-3p MYBPC1 myosin binding protein C1 HGNC:7549 details
hsa-miR-548aj-3p SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase HGNC:25016 details
hsa-miR-548aj-3p ZNF620 zinc finger protein 620 HGNC:28742 details
hsa-miR-548aj-3p PSMA2 proteasome 20S subunit alpha 2 HGNC:9531 details
hsa-miR-548aj-3p ICOSLG inducible T cell costimulator ligand HGNC:17087 details
hsa-miR-548aj-3p FBLN2 fibulin 2 HGNC:3601 details
hsa-miR-548aj-3p MGARP mitochondria localized glutamic acid rich protein HGNC:29969 details
hsa-miR-548aj-3p COL4A3 collagen type IV alpha 3 chain HGNC:2204 details
hsa-miR-548aj-3p TBC1D22B TBC1 domain family member 22B HGNC:21602 details
hsa-miR-548aj-3p ZNF100 zinc finger protein 100 HGNC:12880 details
hsa-miR-548aj-3p ZNF81 zinc finger protein 81 HGNC:13156 details
hsa-miR-548aj-3p TRIM72 tripartite motif containing 72 HGNC:32671 details
hsa-miR-548aj-3p MKRN3 makorin ring finger protein 3 HGNC:7114 details
hsa-miR-548aj-3p TRUB1 TruB pseudouridine synthase family member 1 HGNC:16060 details
hsa-miR-548aj-3p FANCC FA complementation group C HGNC:3584 details
hsa-miR-548aj-3p TMEM18 transmembrane protein 18 HGNC:25257 details
hsa-miR-548aj-3p SEMA4F ssemaphorin 4F HGNC:10734 details
hsa-miR-548aj-3p SAR1B secretion associated Ras related GTPase 1B HGNC:10535 details
hsa-miR-548aj-3p RASGEF1A RasGEF domain family member 1A HGNC:24246 details
hsa-miR-548aj-3p PTBP3 polypyrimidine tract binding protein 3 HGNC:10253 details
hsa-miR-548aj-3p HAS3 hyaluronan synthase 3 HGNC:4820 details
hsa-miR-548aj-3p ERI1 exoribonuclease 1 HGNC:23994 details
hsa-miR-548aj-3p ELK3 ETS transcription factor ELK3 HGNC:3325 details
hsa-miR-548aj-3p CABLES1 Cdk5 and Abl enzyme substrate 1 HGNC:25097 details
hsa-miR-548aj-3p SPRY1 sprouty RTK signaling antagonist 1 HGNC:11269 details
hsa-miR-548aj-3p SLC25A43 solute carrier family 25 member 43 HGNC:30557 details
hsa-miR-548aj-3p GPC4 glypican 4 HGNC:4452 details
hsa-miR-548aj-3p ZNF829 zinc finger protein 829 HGNC:34032 details
hsa-miR-548aj-3p MFAP3 microfibril associated protein 3 HGNC:7034 details
hsa-miR-548aj-3p YY2 YY2 transcription factor HGNC:31684 details
hsa-miR-548aj-3p GTF2B general transcription factor IIB HGNC:4648 details
hsa-miR-548aj-3p ZSCAN12 zinc finger and SCAN domain containing 12 HGNC:13172 details
hsa-miR-548aj-3p SNCB synuclein beta HGNC:11140 details
hsa-miR-548aj-3p SPC25 SPC25 component of NDC80 kinetochore complex HGNC:24031 details
hsa-miR-548aj-3p VEZF1 vascular endothelial zinc finger 1 HGNC:12949 details
hsa-miR-548aj-3p MOB1B MOB kinase activator 1B HGNC:29801 details
hsa-miR-548aj-3p DYNC1LI2 dynein cytoplasmic 1 light intermediate chain 2 HGNC:2966 details
hsa-miR-548aj-3p DAZAP1 DAZ associated protein 1 HGNC:2683 details
hsa-miR-548aj-3p LLGL2 LLGL scribble cell polarity complex component 2 HGNC:6629 details
hsa-miR-548aj-3p SPPL3 signal peptide peptidase like 3 HGNC:30424 details
hsa-miR-548aj-3p ALG1 ALG1 chitobiosyldiphosphodolichol beta-mannosyltransferase HGNC:18294 details
hsa-miR-548aj-3p TVP23C trans-golgi network vesicle protein 23 homolog C HGNC:30453 details
hsa-miR-548aj-3p TSPAN3 tetraspanin 3 HGNC:17752 details
hsa-miR-548aj-3p TM7SF3 transmembrane 7 superfamily member 3 HGNC:23049 details
hsa-miR-548aj-3p SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein HGNC:16918 details
hsa-miR-548aj-3p SLC35D1 solute carrier family 35 member D1 HGNC:20800 details
hsa-miR-548aj-3p RGPD4 RANBP2 like and GRIP domain containing 4 HGNC:32417 details
hsa-miR-548aj-3p RECK reversion inducing cysteine rich protein with kazal motifs HGNC:11345 details
hsa-miR-548aj-3p PDZD8 PDZ domain containing 8 HGNC:26974 details
hsa-miR-548aj-3p MTF2 metal response element binding transcription factor 2 HGNC:29535 details
hsa-miR-548aj-3p HNRNPU heterogeneous nuclear ribonucleoprotein U HGNC:5048 details
hsa-miR-548aj-3p details
hsa-miR-548aj-3p CNIH1 cornichon family AMPA receptor auxiliary protein 1 HGNC:19431 details
hsa-miR-548aj-3p CBFB core-binding factor subunit beta HGNC:1539 details
hsa-miR-548aj-3p details
hsa-miR-548aj-3p C18orf25 chromosome 18 open reading frame 25 HGNC:28172 details
hsa-miR-548aj-3p ARF1 ADP ribosylation factor 1 HGNC:652 details
hsa-miR-548aj-3p GSKIP GSK3B interacting protein HGNC:20343 details
hsa-miR-548aj-3p SKI SKI proto-oncogene HGNC:10896 details
hsa-miR-548aj-3p GRB2 growth factor receptor bound protein 2 HGNC:4566 details
hsa-miR-548aj-3p EIF2S2 eukaryotic translation initiation factor 2 subunit beta HGNC:3266 details
hsa-miR-548aj-3p ARID1A AT-rich interaction domain 1A HGNC:11110 details
hsa-miR-548aj-3p DEPDC1B DEP domain containing 1B HGNC:24902 details
hsa-miR-548aj-3p TMEM64 transmembrane protein 64 HGNC:25441 details
hsa-miR-548aj-3p TGFBR3 transforming growth factor beta receptor 3 HGNC:11774 details
hsa-miR-548aj-3p details
hsa-miR-548aj-3p OTUD4 OTU deubiquitinase 4 HGNC:24949 details
hsa-miR-548aj-3p MTMR3 myotubularin related protein 3 HGNC:7451 details
hsa-miR-548aj-3p MKNK2 MAPK interacting serine/threonine kinase 2 HGNC:7111 details
hsa-miR-548aj-3p ATF7IP activating transcription factor 7 interacting protein HGNC:20092 details
hsa-miR-548aj-3p MPZL1 myelin protein zero like 1 HGNC:7226 details
hsa-miR-548aj-3p PHF19 PHD finger protein 19 HGNC:24566 details
hsa-miR-548aj-3p HOXA9 homeobox A9 HGNC:5109 details
hsa-miR-548aj-3p KHSRP KH-type splicing regulatory protein HGNC:6316 details
hsa-miR-548aj-3p DDX21 DExD-box helicase 21 HGNC:2744 details
hsa-miR-548aj-3p RPS16 ribosomal protein S16 HGNC:10396 details
hsa-miR-548aj-3p PSAT1 phosphoserine aminotransferase 1 HGNC:19129 details
hsa-miR-548aj-3p NRBF2 nuclear receptor binding factor 2 HGNC:19692 details
hsa-miR-548aj-3p H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase HGNC:4795 details
hsa-miR-548aj-3p ZRANB1 zinc finger RANBP2-type containing 1 HGNC:18224 details
hsa-miR-548aj-3p ATP9A ATPase phospholipid transporting 9A (putative) HGNC:13540 details
hsa-miR-548aj-3p ZNF581 zinc finger protein 581 HGNC:25017 details
hsa-miR-548aj-3p NHSL1 NHS like 1 HGNC:21021 details
hsa-miR-548aj-3p SYT2 synaptotagmin 2 HGNC:11510 details
hsa-miR-548aj-3p NUDCD3 NudC domain containing 3 HGNC:22208 details
hsa-miR-548aj-3p KCNK10 potassium two pore domain channel subfamily K member 10 HGNC:6273 details
hsa-miR-548aj-3p ZYG11B zyg-11 family member B, cell cycle regulator HGNC:25820 details
hsa-miR-548aj-3p PDCD4 programmed cell death 4 HGNC:8763 details
hsa-miR-548aj-3p PDGFRA platelet derived growth factor receptor alpha HGNC:8803 details
hsa-miR-548aj-3p SLC25A11 solute carrier family 25 member 11 HGNC:10981 details
hsa-miR-548aj-3p PSPC1 paraspeckle component 1 HGNC:20320 details
hsa-miR-548aj-3p PLXNA4 plexin A4 HGNC:9102 details
hsa-miR-548aj-3p ESR1 estrogen receptor 1 HGNC:3467 details
hsa-miR-548aj-3p AMPD3 adenosine monophosphate deaminase 3 HGNC:470 details
hsa-miR-548aj-3p SUB1 SUB1 regulator of transcription HGNC:19985 details
hsa-miR-548aj-3p GMPR guanosine monophosphate reductase HGNC:4376 details
hsa-miR-548aj-3p ZNF608 zinc finger protein 608 HGNC:29238 details
hsa-miR-548aj-3p ZBTB10 zinc finger and BTB domain containing 10 HGNC:30953 details
hsa-miR-548aj-3p CCDC158 coiled-coil domain containing 158 HGNC:26374 details
hsa-miR-548aj-3p GGCX gamma-glutamyl carboxylase HGNC:4247 details
hsa-miR-548aj-3p MICA MHC class I polypeptide-related sequence A HGNC:7090 details
hsa-miR-548aj-3p ZIC2 Zic family member 2 HGNC:12873 details
hsa-miR-548aj-3p FUNDC2 FUN14 domain containing 2 HGNC:24925 details
hsa-miR-548aj-3p LMBR1 limb development membrane protein 1 HGNC:13243 details
hsa-miR-548aj-3p SLCO3A1 solute carrier organic anion transporter family member 3A1 HGNC:10952 details
hsa-miR-548aj-3p XKR6 XK related 6 HGNC:27806 details
hsa-miR-548aj-3p PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon HGNC:9313 details
hsa-miR-548aj-3p OXSR1 oxidative stress responsive kinase 1 HGNC:8508 details
hsa-miR-548aj-3p details
hsa-miR-548aj-3p KDM5A lysine demethylase 5A HGNC:9886 details
hsa-miR-548aj-3p IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 HGNC:28866 details
hsa-miR-548aj-3p HINT1 histidine triad nucleotide binding protein 1 HGNC:4912 details
hsa-miR-548aj-3p ADAM17 ADAM metallopeptidase domain 17 HGNC:195 details
hsa-miR-548aj-3p GRIK4 glutamate ionotropic receptor kainate type subunit 4 HGNC:4582 details
hsa-miR-548aj-3p CDKL2 cyclin dependent kinase like 2 HGNC:1782 details
hsa-miR-548aj-3p GBP6 guanylate binding protein family member 6 HGNC:25395 details
hsa-miR-548aj-3p RNF2 ring finger protein 2 HGNC:10061 details
hsa-miR-548aj-3p CLN8 CLN8 transmembrane ER and ERGIC protein HGNC:2079 details
hsa-miR-548aj-3p ASAP2 ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 HGNC:2721 details
hsa-miR-548aj-3p FDX1 ferredoxin 1 HGNC:3638 details
hsa-miR-548aj-3p MEF2C myocyte enhancer factor 2C HGNC:6996 details
hsa-miR-548aj-3p LIMD1 LIM domain containing 1 HGNC:6612 details
hsa-miR-548aj-3p CCDC117 coiled-coil domain containing 117 HGNC:26599 details
hsa-miR-548aj-3p ANAPC16 anaphase promoting complex subunit 16 HGNC:26976 details
hsa-miR-548aj-3p UNC93A unc-93 homolog A HGNC:12570 details
hsa-miR-548aj-3p CD59 CD59 molecule (CD59 blood group) HGNC:1689 details
hsa-miR-548aj-3p VCAM1 vascular cell adhesion molecule 1 HGNC:12663 details
hsa-miR-548aj-3p TTC26 tetratricopeptide repeat domain 26 HGNC:21882 details
hsa-miR-548aj-3p SERBP1 SERPINE1 mRNA binding protein 1 HGNC:17860 details
hsa-miR-548aj-3p PNRC1 proline rich nuclear receptor coactivator 1 HGNC:17278 details
hsa-miR-548aj-3p TCF24 transcription factor 24 HGNC:32275 details
hsa-miR-548aj-3p STX4 syntaxin 4 HGNC:11439 details
hsa-miR-548aj-3p ZNF99 zinc finger protein 99 HGNC:13175 details
hsa-miR-548aj-3p ZNF566 zinc finger protein 566 HGNC:25919 details
hsa-miR-548aj-3p CTNNA3 catenin alpha 3 HGNC:2511 details
hsa-miR-548aj-3p C4orf3 chromosome 4 open reading frame 3 HGNC:19225 details
hsa-miR-548aj-3p GIN1 gypsy retrotransposon integrase 1 HGNC:25959 details
hsa-miR-548aj-3p VDR vitamin D receptor HGNC:12679 details
hsa-miR-548aj-3p details
hsa-miR-548aj-3p PGM2 phosphoglucomutase 2 HGNC:8906 details
hsa-miR-548aj-3p ATF6B activating transcription factor 6 beta HGNC:2349 details
hsa-miR-548aj-3p ZNF583 zinc finger protein 583 HGNC:26427 details
hsa-miR-548aj-3p CDC14B cell division cycle 14B HGNC:1719 details
hsa-miR-548aj-3p UFM1 ubiquitin fold modifier 1 HGNC:20597 details
hsa-miR-548aj-3p CLNK cytokine dependent hematopoietic cell linker HGNC:17438 details
hsa-miR-548aj-3p ZNF280B zinc finger protein 280B HGNC:23022 details
hsa-miR-548aj-3p SIX4 SIX homeobox 4 HGNC:10890 details
hsa-miR-548aj-3p PKN2 protein kinase N2 HGNC:9406 details
hsa-miR-548aj-3p NUDT21 nudix hydrolase 21 HGNC:13870 details
hsa-miR-548aj-3p details
hsa-miR-548aj-3p FAXC failed axon connections homolog, metaxin like GST domain containing HGNC:20742 details
hsa-miR-548aj-3p ETV3 ETS variant transcription factor 3 HGNC:3492 details
hsa-miR-548aj-3p ENAH ENAH actin regulator HGNC:18271 details
hsa-miR-548aj-3p EMP2 epithelial membrane protein 2 HGNC:3334 details
hsa-miR-548aj-3p CXCR5 C-X-C motif chemokine receptor 5 HGNC:1060 details
hsa-miR-548aj-3p CTDSPL2 CTD small phosphatase like 2 HGNC:26936 details
hsa-miR-548aj-3p BTBD3 BTB domain containing 3 HGNC:15854 details
hsa-miR-548aj-3p ASH1L ASH1 like histone lysine methyltransferase HGNC:19088 details
hsa-miR-548aj-3p INTU inturned planar cell polarity protein HGNC:29239 details
hsa-miR-548aj-3p details
hsa-miR-548aj-3p SPATS2L spermatogenesis associated serine rich 2 like HGNC:24574 details
hsa-miR-548aj-3p LNPK lunapark, ER junction formation factor HGNC:21610 details
hsa-miR-548aj-3p RPL10A ribosomal protein L10a HGNC:10299 details
hsa-miR-548aj-3p TRIM45 tripartite motif containing 45 HGNC:19018 details
hsa-miR-548aj-3p NHLRC2 NHL repeat containing 2 HGNC:24731 details
hsa-miR-548aj-3p KCNJ15 potassium inwardly rectifying channel subfamily J member 15 HGNC:6261 details
hsa-miR-548aj-3p ITPRIPL2 ITPRIP like 2 HGNC:27257 details
hsa-miR-548aj-3p TOR1AIP2 torsin 1A interacting protein 2 HGNC:24055 details
hsa-miR-548aj-3p HHIP hedgehog interacting protein HGNC:14866 details
hsa-miR-548aj-3p ZNF574 zinc finger protein 574 HGNC:26166 details
hsa-miR-548aj-3p SCIMP SLP adaptor and CSK interacting membrane protein HGNC:33504 details
hsa-miR-548aj-3p RSRC1 arginine and serine rich coiled-coil 1 HGNC:24152 details
hsa-miR-548aj-3p XRN2 5'-3' exoribonuclease 2 HGNC:12836 details
hsa-miR-548aj-3p details
hsa-miR-548aj-3p ZFHX3 zinc finger homeobox 3 HGNC:777 details
hsa-miR-548aj-3p TJP1 tight junction protein 1 HGNC:11827 details
hsa-miR-548aj-3p SOAT1 sterol O-acyltransferase 1 HGNC:11177 details
hsa-miR-548aj-3p SEMA4D semaphorin 4D HGNC:10732 details
hsa-miR-548aj-3p MRO maestro HGNC:24121 details
hsa-miR-548aj-3p MAP3K1 mitogen-activated protein kinase kinase kinase 1 HGNC:6848 details
hsa-miR-548aj-3p LONRF3 LON peptidase N-terminal domain and ring finger 3 HGNC:21152 details
hsa-miR-548aj-3p FAM126B family with sequence similarity 126 member B HGNC:28593 details
hsa-miR-548aj-3p details
hsa-miR-548aj-3p MRPS10 mitochondrial ribosomal protein S10 HGNC:14502 details
hsa-miR-548aj-3p SNX12 sorting nexin 12 HGNC:14976 details
hsa-miR-548aj-3p LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 HGNC:26068 details
hsa-miR-548aj-3p CCBE1 collagen and calcium binding EGF domains 1 HGNC:29426 details
hsa-miR-548aj-3p PKIA cAMP-dependent protein kinase inhibitor alpha HGNC:9017 details
hsa-miR-548aj-3p G2E3 G2/M-phase specific E3 ubiquitin protein ligase HGNC:20338 details
hsa-miR-548aj-3p ZNF749 zinc finger protein 749 HGNC:32783 details
hsa-miR-548aj-3p PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 HGNC:29035 details
hsa-miR-548aj-3p ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-548aj-3p TMLHE trimethyllysine hydroxylase, epsilon HGNC:18308 details
hsa-miR-548aj-3p CKS2 CDC28 protein kinase regulatory subunit 2 HGNC:2000 details
hsa-miR-548aj-3p DGKE diacylglycerol kinase epsilon HGNC:2852 details
hsa-miR-548aj-3p WTIP WT1 interacting protein HGNC:20964 details
hsa-miR-548aj-3p GATM glycine amidinotransferase HGNC:4175 details
hsa-miR-548aj-3p HMGB1 high mobility group box 1 HGNC:4983 details
hsa-miR-548aj-3p PHF12 PHD finger protein 12 HGNC:20816 details
hsa-miR-548aj-3p SLC16A1 solute carrier family 16 member 1 HGNC:10922 details
hsa-miR-548aj-3p details
hsa-miR-548aj-3p CAMLG calcium modulating ligand HGNC:1471 details
hsa-miR-548aj-3p CAPZA1 capping actin protein of muscle Z-line subunit alpha 1 HGNC:1488 details
hsa-miR-548aj-3p CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 HGNC:104 details
hsa-miR-548aj-3p HCFC1 host cell factor C1 HGNC:4839 details
hsa-miR-548aj-3p IL6R interleukin 6 receptor HGNC:6019 details
hsa-miR-548aj-3p PF4 platelet factor 4 HGNC:8861 details
hsa-miR-548aj-3p PHB2 prohibitin 2 HGNC:30306 details
hsa-miR-548aj-3p PTPRB protein tyrosine phosphatase receptor type B HGNC:9665 details
hsa-miR-548aj-3p RIMS4 regulating synaptic membrane exocytosis 4 HGNC:16183 details
hsa-miR-548aj-3p SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone HGNC:16987 details
hsa-miR-548aj-3p TRIM35 tripartite motif containing 35 HGNC:16285 details
hsa-miR-548aj-3p GNPTAB N-acetylglucosamine-1-phosphate transferase subunits alpha and beta HGNC:29670 details
hsa-miR-548aj-3p IGSF9 immunoglobulin superfamily member 9 HGNC:18132 details
hsa-miR-548aj-3p KIF1B kinesin family member 1B HGNC:16636 details
hsa-miR-548aj-3p KLHDC10 kelch domain containing 10 HGNC:22194 details
hsa-miR-548aj-3p MAPKAPK5 MAPK activated protein kinase 5 HGNC:6889 details
hsa-miR-548aj-3p ZNF607 zinc finger protein 607 HGNC:28192 details