miRNA Card

miRNA General Information
miRNA ID hsa-miR-548aq-5p
Description Homo sapiens miR-548aq stem-loop
Comment None
Experiment
Sequence GAAAGUAAUUGCUGUUUUUGCC
miRNA Expression in different cancers

    by mir_boxplot.py


circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr9:134844189|134844349 hsa-miR-548aq-5p 0 1 0
chr6:21596057|21596219 hsa-miR-548aq-5p 0 1 0
chr3:186554618|186554727 hsa-miR-548aq-5p 0 1 0
chr8:98042241|98042371 hsa-miR-548aq-5p 0 1 0
chr15:40569694|40569789 hsa-miR-548aq-5p 0 1 0
chr11:47290782|47293983 hsa-miR-548aq-5p 0 1 0
chr9:134844150|134844349 hsa-miR-548aq-5p 0 1 0
chr6:21596062|21596219 hsa-miR-548aq-5p 0 1 0
chrX:97604780|97604875 hsa-miR-548aq-5p 0 1 0
chr9:113388155|113388308 hsa-miR-548aq-5p 1 0 0
chr4:94667736|94667857 hsa-miR-548aq-5p 0 1 0
chr9:134844172|134844349 hsa-miR-548aq-5p 0 1 0
chr2:241353529|241353622 hsa-miR-548aq-5p 0 1 0
chr7:65957896|65958046 hsa-miR-548aq-5p 0 1 0
chr9:134844141|134844349 hsa-miR-548aq-5p 0 1 0
chr17:28592402|28592553 hsa-miR-548aq-5p 0 1 0
chr1:221742057|221742292 hsa-miR-548aq-5p 0 1 0
chr3:64817874|64818198 hsa-miR-548aq-5p 0 1 0
chr3:44926079|44926197 hsa-miR-548aq-5p 0 1 0
chr19:47169821|47169923 hsa-miR-548aq-5p 0 1 0
chr17:81637287|81637406 hsa-miR-548aq-5p 0 1 0
chr5:112843776|112843914 hsa-miR-548aq-5p 0 1 0
chr3:24120827|24120988 hsa-miR-548aq-5p 0 1 0
chr8:102651591|102651749 hsa-miR-548aq-5p 0 1 0
chr6:21596046|21596219 hsa-miR-548aq-5p 0 1 0
chr7:65957896~65958046 hsa-miR-548aq-5p 0 1 0
chr12:9695773~9695919 hsa-miR-548aq-5p 0 1 0
chr22:24574070~24574235 hsa-miR-548aq-5p 0 1 0
chr9:107306404~107306508 hsa-miR-548aq-5p 0 1 0
chr9:107306398|107306517 hsa-miR-548aq-5p 0 1 0
chr8:102651519~102651749 hsa-miR-548aq-5p 0 1 0
chr2:24790332|24790455 hsa-miR-548aq-5p 0 1 0
chr9:113388155~113388308 hsa-miR-548aq-5p 0 1 0
chr9:134844189~134844349 hsa-miR-548aq-5p 0 1 0
chr9:107306398~107306517 hsa-miR-548aq-5p 0 1 0
chr1:25900191~25900449 hsa-miR-548aq-5p 0 1 0
chr19:49490240|49490576 hsa-miR-548aq-5p 0 1 0
chr10:124775656|124775798 hsa-miR-548aq-5p 0 1 0
chr5:180572932|180573047 hsa-miR-548aq-5p 0 1 0
chr9:71899054|71899208 hsa-miR-548aq-5p 0 1 0
chr11:43468675|43468890 hsa-miR-548aq-5p 0 1 0
chr11:9445404|9445500 hsa-miR-548aq-5p 0 1 0
chr17:10131092|10131245 hsa-miR-548aq-5p 0 1 0
chr2:241353529|241353776 hsa-miR-548aq-5p 0 1 0
chr3:128627384|128627473 hsa-miR-548aq-5p 0 1 0
chr8:58599558|58599797 hsa-miR-548aq-5p 0 1 0
chr1:155514292|155514473 hsa-miR-548aq-5p 0 1 0
chr1:41012388|41012472 hsa-miR-548aq-5p 0 1 0
chr2:85343738|85344094 hsa-miR-548aq-5p 1 0 0
chr6:21596040|21596219 hsa-miR-548aq-5p 0 1 0
chr9:134844169|134844349 hsa-miR-548aq-5p 0 1 0
chr10:5906042|5906223 hsa-miR-548aq-5p 0 1 0
chr11:106939701|106939819 hsa-miR-548aq-5p 0 1 0
chr10:68683921|68684140 hsa-miR-548aq-5p 0 1 0
chr11:33077813|33077928 hsa-miR-548aq-5p 0 1 0
chr18:58387701|58387958 hsa-miR-548aq-5p 0 1 0
chr14:89161973|89162051 hsa-miR-548aq-5p 0 1 0
chr7:116110708|116112038 hsa-miR-548aq-5p 0 1 0
chr16:14079290|14140760 hsa-miR-548aq-5p 0 1 0
chr2:61882349|61882503 hsa-miR-548aq-5p 0 1 0
chr11:33077811|33077928 hsa-miR-548aq-5p 0 1 0
chr16:5065701|5065924 hsa-miR-548aq-5p 0 1 0
chr10:5906079|5906223 hsa-miR-548aq-5p 0 1 0
chr11:35229337|35229633 hsa-miR-548aq-5p 0 1 0
chr6:21596055|21596219 hsa-miR-548aq-5p 0 1 0
chr17:39557639|39557769 hsa-miR-548aq-5p 0 1 0
chr4:145557110|145557287 hsa-miR-548aq-5p 0 1 0
chr8:61606937|61607082 hsa-miR-548aq-5p 0 1 0
chr17:78991765|78991892 hsa-miR-548aq-5p 0 1 0
chr1:174999494|174999648 hsa-miR-548aq-5p 0 1 0
chr6:30724068|30724204 hsa-miR-548aq-5p 0 1 0
chr8:61618978|61644632 hsa-miR-548aq-5p 0 1 0
chr10:246439|246703 hsa-miR-548aq-5p 0 1 0
chr6:21595997|21596219 hsa-miR-548aq-5p 0 1 0
chr6:549175|549285 hsa-miR-548aq-5p 0 1 0
chr15:65158575|65158686 hsa-miR-548aq-5p 0 1 0
chr12:56643490|56643879 hsa-miR-548aq-5p 0 1 0
chr12:56643542|56643903 hsa-miR-548aq-5p 0 1 0
chr9:134844128|134844349 hsa-miR-548aq-5p 0 1 0
chr6:30723957|30724159 hsa-miR-548aq-5p 0 1 0
chr11:34661556|34661838 hsa-miR-548aq-5p 0 1 0
chr17:78991820|78992075 hsa-miR-548aq-5p 0 1 0
chr8:58597876|58599343 hsa-miR-548aq-5p 0 1 0
chr11:85957718|85957842 hsa-miR-548aq-5p 0 1 0
chr3:44926035|44926173 hsa-miR-548aq-5p 0 1 0
chr9:107306404|107306565 hsa-miR-548aq-5p 0 1 0
chr10:32271748|32271917 hsa-miR-548aq-5p 0 1 0
chr17:47118464|47118622 hsa-miR-548aq-5p 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-548aq-5p ZNRF2 zinc and ring finger 2 HGNC:22316 details
hsa-miR-548aq-5p GTF2H5 general transcription factor IIH subunit 5 HGNC:21157 details
hsa-miR-548aq-5p VLDLR very low density lipoprotein receptor HGNC:12698 details
hsa-miR-548aq-5p ZDHHC21 zinc finger DHHC-type palmitoyltransferase 21 HGNC:20750 details
hsa-miR-548aq-5p PRPS1L1 phosphoribosyl pyrophosphate synthetase 1 like 1 HGNC:9463 details
hsa-miR-548aq-5p ZNF207 zinc finger protein 207 HGNC:12998 details
hsa-miR-548aq-5p PTCHD1 patched domain containing 1 HGNC:26392 details
hsa-miR-548aq-5p NEK7 NIMA related kinase 7 HGNC:13386 details
hsa-miR-548aq-5p MCC MCC regulator of WNT signaling pathway HGNC:6935 details
hsa-miR-548aq-5p ZNF562 zinc finger protein 562 HGNC:25950 details
hsa-miR-548aq-5p MRPS5 mitochondrial ribosomal protein S5 HGNC:14498 details
hsa-miR-548aq-5p FEM1C fem-1 homolog C HGNC:16933 details
hsa-miR-548aq-5p TM6SF1 transmembrane 6 superfamily member 1 HGNC:11860 details
hsa-miR-548aq-5p SAMD8 sterile alpha motif domain containing 8 HGNC:26320 details
hsa-miR-548aq-5p PLET1 placenta expressed transcript 1 HGNC:30053 details
hsa-miR-548aq-5p SEM1 SEM1 26S proteasome subunit HGNC:10845 details
hsa-miR-548aq-5p NECTIN3 nectin cell adhesion molecule 3 HGNC:17664 details
hsa-miR-548aq-5p XRCC6 X-ray repair cross complementing 6 HGNC:4055 details
hsa-miR-548aq-5p ANKEF1 ankyrin repeat and EF-hand domain containing 1 HGNC:15803 details
hsa-miR-548aq-5p KIF2C kinesin family member 2C HGNC:6393 details
hsa-miR-548aq-5p ZBTB38 zinc finger and BTB domain containing 38 HGNC:26636 details
hsa-miR-548aq-5p YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon HGNC:12851 details
hsa-miR-548aq-5p SMAD5 SMAD family member 5 HGNC:6771 details
hsa-miR-548aq-5p PHB2 prohibitin 2 HGNC:30306 details
hsa-miR-548aq-5p PEG10 paternally expressed 10 HGNC:14005 details
hsa-miR-548aq-5p MTMR6 myotubularin related protein 6 HGNC:7453 details
hsa-miR-548aq-5p KLHL11 kelch like family member 11 HGNC:19008 details
hsa-miR-548aq-5p GTPBP2 GTP binding protein 2 HGNC:4670 details
hsa-miR-548aq-5p AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-548aq-5p ALG9 ALG9 alpha-1,2-mannosyltransferase HGNC:15672 details
hsa-miR-548aq-5p ERH ERH mRNA splicing and mitosis factor HGNC:3447 details
hsa-miR-548aq-5p FAM3C FAM3 metabolism regulating signaling molecule C HGNC:18664 details
hsa-miR-548aq-5p DDB1 damage specific DNA binding protein 1 HGNC:2717 details
hsa-miR-548aq-5p MDFIC MyoD family inhibitor domain containing HGNC:28870 details
hsa-miR-548aq-5p IPMK inositol polyphosphate multikinase HGNC:20739 details
hsa-miR-548aq-5p IL6ST interleukin 6 cytokine family signal transducer HGNC:6021 details
hsa-miR-548aq-5p CEP120 centrosomal protein 120 HGNC:26690 details
hsa-miR-548aq-5p ZBTB20 zinc finger and BTB domain containing 20 HGNC:13503 details
hsa-miR-548aq-5p PTBP2 polypyrimidine tract binding protein 2 HGNC:17662 details
hsa-miR-548aq-5p TMEM30B transmembrane protein 30B HGNC:27254 details
hsa-miR-548aq-5p SVOP SV2 related protein HGNC:25417 details
hsa-miR-548aq-5p INHBA inhibin subunit beta A HGNC:6066 details
hsa-miR-548aq-5p USP53 ubiquitin specific peptidase 53 HGNC:29255 details
hsa-miR-548aq-5p UBE2D1 ubiquitin conjugating enzyme E2 D1 HGNC:12474 details
hsa-miR-548aq-5p TRIM37 tripartite motif containing 37 HGNC:7523 details
hsa-miR-548aq-5p SPRYD4 SPRY domain containing 4 HGNC:27468 details
hsa-miR-548aq-5p SPPL2A signal peptide peptidase like 2A HGNC:30227 details
hsa-miR-548aq-5p SMG1 SMG1 nonsense mediated mRNA decay associated PI3K related kinase HGNC:30045 details
hsa-miR-548aq-5p CLIP1 CAP-Gly domain containing linker protein 1 HGNC:10461 details
hsa-miR-548aq-5p CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 HGNC:3230 details
hsa-miR-548aq-5p CDK4 cyclin dependent kinase 4 HGNC:1773 details
hsa-miR-548aq-5p CAPZA1 capping actin protein of muscle Z-line subunit alpha 1 HGNC:1488 details
hsa-miR-548aq-5p ZNF154 zinc finger protein 154 HGNC:12939 details
hsa-miR-548aq-5p LRRC55 leucine rich repeat containing 55 HGNC:32324 details
hsa-miR-548aq-5p GRM5 glutamate metabotropic receptor 5 HGNC:4597 details
hsa-miR-548aq-5p ZNF711 zinc finger protein 711 HGNC:13128 details
hsa-miR-548aq-5p YOD1 YOD1 deubiquitinase HGNC:25035 details
hsa-miR-548aq-5p RSBN1 round spermatid basic protein 1 HGNC:25642 details
hsa-miR-548aq-5p POLR1B RNA polymerase I subunit B HGNC:20454 details
hsa-miR-548aq-5p DDIT4 DNA damage inducible transcript 4 HGNC:24944 details
hsa-miR-548aq-5p NPM3 nucleophosmin/nucleoplasmin 3 HGNC:7931 details
hsa-miR-548aq-5p MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase HGNC:7434 details
hsa-miR-548aq-5p ANP32B acidic nuclear phosphoprotein 32 family member B HGNC:16677 details
hsa-miR-548aq-5p CYP20A1 cytochrome P450 family 20 subfamily A member 1 HGNC:20576 details
hsa-miR-548aq-5p TRA2B transformer 2 beta homolog HGNC:10781 details
hsa-miR-548aq-5p TM9SF3 transmembrane 9 superfamily member 3 HGNC:21529 details
hsa-miR-548aq-5p BRIX1 biogenesis of ribosomes BRX1 HGNC:24170 details
hsa-miR-548aq-5p ACTN4 actinin alpha 4 HGNC:166 details
hsa-miR-548aq-5p SHISA9 shisa family member 9 HGNC:37231 details
hsa-miR-548aq-5p ARL13B ADP ribosylation factor like GTPase 13B HGNC:25419 details
hsa-miR-548aq-5p RBM4B RNA binding motif protein 4B HGNC:28842 details
hsa-miR-548aq-5p TMEM41B transmembrane protein 41B HGNC:28948 details
hsa-miR-548aq-5p FRY FRY microtubule binding protein HGNC:20367 details
hsa-miR-548aq-5p RAB32 RAB32, member RAS oncogene family HGNC:9772 details
hsa-miR-548aq-5p SLC9A4 solute carrier family 9 member A4 HGNC:11077 details
hsa-miR-548aq-5p CCNB1 cyclin B1 HGNC:1579 details
hsa-miR-548aq-5p PANX1 pannexin 1 HGNC:8599 details
hsa-miR-548aq-5p PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 HGNC:8575 details
hsa-miR-548aq-5p IKZF5 IKAROS family zinc finger 5 HGNC:14283 details
hsa-miR-548aq-5p HMBOX1 homeobox containing 1 HGNC:26137 details
hsa-miR-548aq-5p GDE1 glycerophosphodiester phosphodiesterase 1 HGNC:29644 details
hsa-miR-548aq-5p ETNK1 ethanolamine kinase 1 HGNC:24649 details
hsa-miR-548aq-5p EFNA5 ephrin A5 HGNC:3225 details
hsa-miR-548aq-5p CSE1L chromosome segregation 1 like HGNC:2431 details
hsa-miR-548aq-5p GPC4 glypican 4 HGNC:4452 details
hsa-miR-548aq-5p HMGN2 high mobility group nucleosomal binding domain 2 HGNC:4986 details
hsa-miR-548aq-5p PEX7 peroxisomal biogenesis factor 7 HGNC:8860 details
hsa-miR-548aq-5p FAM53C family with sequence similarity 53 member C HGNC:1336 details
hsa-miR-548aq-5p SPCS3 signal peptidase complex subunit 3 HGNC:26212 details
hsa-miR-548aq-5p PARP15 poly(ADP-ribose) polymerase family member 15 HGNC:26876 details
hsa-miR-548aq-5p FAM135A family with sequence similarity 135 member A HGNC:21084 details
hsa-miR-548aq-5p XKR9 XK related 9 HGNC:20937 details
hsa-miR-548aq-5p ESYT1 extended synaptotagmin 1 HGNC:29534 details
hsa-miR-548aq-5p KLRC3 killer cell lectin like receptor C3 HGNC:6376 details
hsa-miR-548aq-5p METTL8 methyltransferase 8, methylcytidine HGNC:25856 details
hsa-miR-548aq-5p SH3BGRL SH3 domain binding glutamate rich protein like HGNC:10823 details
hsa-miR-548aq-5p ANGPTL3 angiopoietin like 3 HGNC:491 details
hsa-miR-548aq-5p PTBP1 polypyrimidine tract binding protein 1 HGNC:9583 details
hsa-miR-548aq-5p ACSM2B acyl-CoA synthetase medium chain family member 2B HGNC:30931 details
hsa-miR-548aq-5p PRELID1 PRELI domain containing 1 HGNC:30255 details
hsa-miR-548aq-5p details
hsa-miR-548aq-5p SPC25 SPC25 component of NDC80 kinetochore complex HGNC:24031 details
hsa-miR-548aq-5p GIMAP4 GTPase, IMAP family member 4 HGNC:21872 details
hsa-miR-548aq-5p WBP4 WW domain binding protein 4 HGNC:12739 details
hsa-miR-548aq-5p SLC5A3 solute carrier family 5 member 3 HGNC:11038 details
hsa-miR-548aq-5p SIK1 salt inducible kinase 1 HGNC:11142 details
hsa-miR-548aq-5p PTP4A1 protein tyrosine phosphatase 4A1 HGNC:9634 details
hsa-miR-548aq-5p PDE12 phosphodiesterase 12 HGNC:25386 details
hsa-miR-548aq-5p KPNA1 karyopherin subunit alpha 1 HGNC:6394 details
hsa-miR-548aq-5p KATNAL1 katanin catalytic subunit A1 like 1 HGNC:28361 details
hsa-miR-548aq-5p G3BP1 G3BP stress granule assembly factor 1 HGNC:30292 details
hsa-miR-548aq-5p FOXN2 forkhead box N2 HGNC:5281 details
hsa-miR-548aq-5p DR1 down-regulator of transcription 1 HGNC:3017 details
hsa-miR-548aq-5p CRNKL1 crooked neck pre-mRNA splicing factor 1 HGNC:15762 details
hsa-miR-548aq-5p CHEK2 checkpoint kinase 2 HGNC:16627 details
hsa-miR-548aq-5p RPL7L1 ribosomal protein L7 like 1 HGNC:21370 details
hsa-miR-548aq-5p TMEM241 transmembrane protein 241 HGNC:31723 details
hsa-miR-548aq-5p MKLN1 muskelin 1 HGNC:7109 details
hsa-miR-548aq-5p XIAP X-linked inhibitor of apoptosis HGNC:592 details
hsa-miR-548aq-5p UBE2H ubiquitin conjugating enzyme E2 H HGNC:12484 details
hsa-miR-548aq-5p UBE2D2 ubiquitin conjugating enzyme E2 D2 HGNC:12475 details
hsa-miR-548aq-5p SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein HGNC:16918 details
hsa-miR-548aq-5p SIX4 SIX homeobox 4 HGNC:10890 details
hsa-miR-548aq-5p RGPD4 RANBP2 like and GRIP domain containing 4 HGNC:32417 details
hsa-miR-548aq-5p PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 HGNC:30483 details
hsa-miR-548aq-5p MAP2K4 mitogen-activated protein kinase kinase 4 HGNC:6844 details
hsa-miR-548aq-5p LIPA lipase A, lysosomal acid type HGNC:6617 details
hsa-miR-548aq-5p KLHL28 kelch like family member 28 HGNC:19741 details
hsa-miR-548aq-5p KLF7 Kruppel like factor 7 HGNC:6350 details
hsa-miR-548aq-5p HPRT1 hypoxanthine phosphoribosyltransferase 1 HGNC:5157 details
hsa-miR-548aq-5p HOXA13 homeobox A13 HGNC:5102 details
hsa-miR-548aq-5p GPR27 G protein-coupled receptor 27 HGNC:4482 details
hsa-miR-548aq-5p ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase family member 5 HGNC:13717 details
hsa-miR-548aq-5p details
hsa-miR-548aq-5p ABHD5 abhydrolase domain containing 5, lysophosphatidic acid acyltransferase HGNC:21396 details
hsa-miR-548aq-5p COMMD3-BMI1 COMMD3-BMI1 readthrough HGNC:48326 details
hsa-miR-548aq-5p BMI1 BMI1 proto-oncogene, polycomb ring finger HGNC:1066 details
hsa-miR-548aq-5p ZWINT ZW10 interacting kinetochore protein HGNC:13195 details
hsa-miR-548aq-5p YAP1 Yes1 associated transcriptional regulator HGNC:16262 details
hsa-miR-548aq-5p ZBTB43 zinc finger and BTB domain containing 43 HGNC:17908 details
hsa-miR-548aq-5p MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils HGNC:29383 details
hsa-miR-548aq-5p MFSD9 major facilitator superfamily domain containing 9 HGNC:28158 details
hsa-miR-548aq-5p CBX3 chromobox 3 HGNC:1553 details
hsa-miR-548aq-5p TNIP2 TNFAIP3 interacting protein 2 HGNC:19118 details
hsa-miR-548aq-5p BBS10 Bardet-Biedl syndrome 10 HGNC:26291 details
hsa-miR-548aq-5p KIF3A kinesin family member 3A HGNC:6319 details
hsa-miR-548aq-5p TBC1D13 TBC1 domain family member 13 HGNC:25571 details
hsa-miR-548aq-5p KIAA1586 KIAA1586 HGNC:21360 details
hsa-miR-548aq-5p THRAP3 thyroid hormone receptor associated protein 3 HGNC:22964 details
hsa-miR-548aq-5p NHS NHS actin remodeling regulator HGNC:7820 details
hsa-miR-548aq-5p RCC2 regulator of chromosome condensation 2 HGNC:30297 details
hsa-miR-548aq-5p RAB8B RAB8B, member RAS oncogene family HGNC:30273 details
hsa-miR-548aq-5p PRRC1 proline rich coiled-coil 1 HGNC:28164 details
hsa-miR-548aq-5p PLAGL2 PLAG1 like zinc finger 2 HGNC:9047 details
hsa-miR-548aq-5p LEPROT leptin receptor overlapping transcript HGNC:29477 details
hsa-miR-548aq-5p HSP90AA1 heat shock protein 90 alpha family class A member 1 HGNC:5253 details
hsa-miR-548aq-5p GRPEL2 GrpE like 2, mitochondrial HGNC:21060 details
hsa-miR-548aq-5p FOXK1 forkhead box K1 HGNC:23480 details
hsa-miR-548aq-5p CLDN12 claudin 12 HGNC:2034 details
hsa-miR-548aq-5p BACH1 BTB domain and CNC homolog 1 HGNC:935 details
hsa-miR-548aq-5p MPZL1 myelin protein zero like 1 HGNC:7226 details
hsa-miR-548aq-5p CCDC80 coiled-coil domain containing 80 HGNC:30649 details
hsa-miR-548aq-5p VDAC2 voltage dependent anion channel 2 HGNC:12672 details
hsa-miR-548aq-5p ZNF724 zinc finger protein 724 HGNC:32460 details
hsa-miR-548aq-5p KHSRP KH-type splicing regulatory protein HGNC:6316 details
hsa-miR-548aq-5p MAP2K1 mitogen-activated protein kinase kinase 1 HGNC:6840 details
hsa-miR-548aq-5p SMIM15 small integral membrane protein 15 HGNC:33861 details
hsa-miR-548aq-5p EBNA1BP2 EBNA1 binding protein 2 HGNC:15531 details
hsa-miR-548aq-5p PRKG2 protein kinase cGMP-dependent 2 HGNC:9416 details
hsa-miR-548aq-5p PLEKHG7 pleckstrin homology and RhoGEF domain containing G7 HGNC:33829 details
hsa-miR-548aq-5p KDM5A lysine demethylase 5A HGNC:9886 details
hsa-miR-548aq-5p CTCFL CCCTC-binding factor like HGNC:16234 details
hsa-miR-548aq-5p LYRM2 LYR motif containing 2 HGNC:25229 details
hsa-miR-548aq-5p CLDN16 claudin 16 HGNC:2037 details
hsa-miR-548aq-5p MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 HGNC:7432 details
hsa-miR-548aq-5p ITGB8 integrin subunit beta 8 HGNC:6163 details
hsa-miR-548aq-5p SLC43A3 solute carrier family 43 member 3 HGNC:17466 details
hsa-miR-548aq-5p MKI67 marker of proliferation Ki-67 HGNC:7107 details
hsa-miR-548aq-5p AQP3 aquaporin 3 (Gill blood group) HGNC:636 details
hsa-miR-548aq-5p PCGF5 polycomb group ring finger 5 HGNC:28264 details
hsa-miR-548aq-5p RYBP RING1 and YY1 binding protein HGNC:10480 details
hsa-miR-548aq-5p ZBTB37 zinc finger and BTB domain containing 37 HGNC:28365 details
hsa-miR-548aq-5p SETD7 SET domain containing 7, histone lysine methyltransferase HGNC:30412 details
hsa-miR-548aq-5p SDAD1 SDA1 domain containing 1 HGNC:25537 details
hsa-miR-548aq-5p NACC2 NACC family member 2 HGNC:23846 details
hsa-miR-548aq-5p PKD1 polycystin 1, transient receptor potential channel interacting HGNC:9008 details
hsa-miR-548aq-5p PPP1R18 protein phosphatase 1 regulatory subunit 18 HGNC:29413 details
hsa-miR-548aq-5p PTPN1 protein tyrosine phosphatase non-receptor type 1 HGNC:9642 details
hsa-miR-548aq-5p SDE2 SDE2 telomere maintenance homolog HGNC:26643 details
hsa-miR-548aq-5p UHMK1 U2AF homology motif kinase 1 HGNC:19683 details
hsa-miR-548aq-5p CD47 CD47 molecule HGNC:1682 details
hsa-miR-548aq-5p CDKL2 cyclin dependent kinase like 2 HGNC:1782 details
hsa-miR-548aq-5p RBMS2 RNA binding motif single stranded interacting protein 2 HGNC:9909 details
hsa-miR-548aq-5p RDH11 retinol dehydrogenase 11 HGNC:17964 details
hsa-miR-548aq-5p TPRA1 transmembrane protein adipocyte associated 1 HGNC:30413 details
hsa-miR-548aq-5p ZMPSTE24 zinc metallopeptidase STE24 HGNC:12877 details
hsa-miR-548aq-5p AKAP11 A-kinase anchoring protein 11 HGNC:369 details
hsa-miR-548aq-5p TIAF1 TGFB1-induced anti-apoptotic factor 1 HGNC:11803 details
hsa-miR-548aq-5p ZNF395 zinc finger protein 395 HGNC:18737 details