miRNA Card

miRNA General Information
miRNA ID hsa-miR-548at-5p
Description Homo sapiens miR-548at stem-loop
Comment None
Experiment Illumina [2]
Sequence AAAAGUUAUUGCGGUUUUGGCU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr16:71764350|71774592 hsa-miR-548at-5p 1 1 1
chr14:69203917|69230598 hsa-miR-548at-5p 1 1 1

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr12:54283115|54283234 hsa-miR-548at-5p 1 0 0
chr22:24359905|24360026 hsa-miR-548at-5p 0 1 0
chr1:150965556|150965712 hsa-miR-548at-5p 0 1 0
chr4:82423585|82423959 hsa-miR-548at-5p 0 1 0
chr21:29063413|29063523 hsa-miR-548at-5p 0 1 0
chr1:150965545|150965722 hsa-miR-548at-5p 0 1 0
chr11:65855722|65855832 hsa-miR-548at-5p 0 1 0
chr1:150965569|150965712 hsa-miR-548at-5p 0 1 0
chr12:54283091|54283234 hsa-miR-548at-5p 1 0 0
chr8:27544203|27544507 hsa-miR-548at-5p 1 0 0
chr8:129841739|129841952 hsa-miR-548at-5p 1 0 0
chr12:49763882|49764046 hsa-miR-548at-5p 0 1 0
chr10:179994|180128 hsa-miR-548at-5p 0 1 0
chr1:150965569|150965722 hsa-miR-548at-5p 0 1 0
chr10:70425485|70425611 hsa-miR-548at-5p 0 1 0
chr11:65855654|65855954 hsa-miR-548at-5p 0 1 0
chr1:150965610|150965722 hsa-miR-548at-5p 0 1 0
chr2:173221226|173221492 hsa-miR-548at-5p 0 1 0
chr16:18788981|18789118 hsa-miR-548at-5p 0 1 0
chr16:71732739|71732932 hsa-miR-548at-5p 0 1 0
chr19:37822598|37822746 hsa-miR-548at-5p 0 1 0
chr11:33085713|33085938 hsa-miR-548at-5p 0 1 0
chr3:37327054|37327148 hsa-miR-548at-5p 0 1 0
chr1:150965556~150965712 hsa-miR-548at-5p 0 1 0
chr9:115020880|115020990 hsa-miR-548at-5p 0 1 0
chr5:115524596|115524728 hsa-miR-548at-5p 0 1 0
chr18:26545648~26545817 hsa-miR-548at-5p 0 1 0
chr11:65855654~65855969 hsa-miR-548at-5p 0 1 0
chr1:78024452~78024568 hsa-miR-548at-5p 0 1 0
chr4:48904484~48904567 hsa-miR-548at-5p 0 1 0
chr14:92935021~92935199 hsa-miR-548at-5p 0 1 0
chr15:75649089~75649200 hsa-miR-548at-5p 0 1 0
chr3:41224717~41225050 hsa-miR-548at-5p 0 1 0
chr10:179994~180128 hsa-miR-548at-5p 0 1 0
chr19:40805241~40805352 hsa-miR-548at-5p 0 1 0
chr8:140551416~140555993 hsa-miR-548at-5p 0 1 0
chr7:26195853~26196476 hsa-miR-548at-5p 0 1 0
chr12:67430545~67430881 hsa-miR-548at-5p 0 1 0
chr1:150965480~150965784 hsa-miR-548at-5p 0 1 0
chr12:55942014~55942263 hsa-miR-548at-5p 0 1 0
chr10:102958874|102959003 hsa-miR-548at-5p 1 0 0
chr6:157208852|157209010 hsa-miR-548at-5p 0 1 0
chr16:78543620|78543748 hsa-miR-548at-5p 0 1 0
chr8:60975626|60975859 hsa-miR-548at-5p 0 1 0
chr15:58886986|58887299 hsa-miR-548at-5p 0 1 0
chr1:231831117|231831264 hsa-miR-548at-5p 0 1 0
chr17:32472311|32472538 hsa-miR-548at-5p 0 1 0
chr10:70744374|70744558 hsa-miR-548at-5p 0 1 0
chr7:142900589|142900750 hsa-miR-548at-5p 0 1 0
chr12:117017434|117017566 hsa-miR-548at-5p 0 1 0
chr11:5696482|5696640 hsa-miR-548at-5p 0 1 0
chr5:139665618|139665803 hsa-miR-548at-5p 0 1 0
chr5:134145111|134145308 hsa-miR-548at-5p 0 1 0
chr12:110449611|110449779 hsa-miR-548at-5p 0 1 0
chr9:120764518|120764630 hsa-miR-548at-5p 1 0 0
chr6:31792217|31792460 hsa-miR-548at-5p 1 0 0
chr12:113269871|113269989 hsa-miR-548at-5p 0 1 0
chr2:85544031|85544135 hsa-miR-548at-5p 0 1 0
chr4:139059271|139059416 hsa-miR-548at-5p 0 1 0
chr10:5740155|5740346 hsa-miR-548at-5p 0 1 0
chr11:65855654|65856011 hsa-miR-548at-5p 0 1 0
chr3:66379912|66380095 hsa-miR-548at-5p 0 1 0
chr11:65855654|65855957 hsa-miR-548at-5p 0 1 0
chr6:36110062|36110235 hsa-miR-548at-5p 0 1 0
chr20:37507101|37507298 hsa-miR-548at-5p 0 1 0
chr14:94102477|94102548 hsa-miR-548at-5p 0 1 0
chr1:205885905|205886125 hsa-miR-548at-5p 0 1 0
chr14:21016896|21017022 hsa-miR-548at-5p 0 1 0
chr2:85544020|85544200 hsa-miR-548at-5p 0 1 0
chr10:5740185|5740346 hsa-miR-548at-5p 0 1 0
chr4:48904484|48904588 hsa-miR-548at-5p 0 1 0
chr11:65855654|65855969 hsa-miR-548at-5p 0 1 0
chr12:104852028|104852123 hsa-miR-548at-5p 0 1 0
chr12:31442775|31447769 hsa-miR-548at-5p 0 1 0
chrX:53086139|53086310 hsa-miR-548at-5p 0 1 0
chr11:95130940|95131074 hsa-miR-548at-5p 0 1 0
chr1:156197843|156198034 hsa-miR-548at-5p 0 1 0
chr6:49440206|49440320 hsa-miR-548at-5p 0 1 0
chr1:150965655|150965784 hsa-miR-548at-5p 0 1 0
chr20:36784442|36784598 hsa-miR-548at-5p 0 1 0
chr1:37560325|37560491 hsa-miR-548at-5p 0 1 0
chr2:173221416|173221468 hsa-miR-548at-5p -8 1 0
chr8:143920590|143920784 hsa-miR-548at-5p 1 0 0
chr2:195659258|195659474 hsa-miR-548at-5p 0 1 0
chr6:36110121|36110235 hsa-miR-548at-5p 0 1 0
chrX:23783970|23784108 hsa-miR-548at-5p 0 1 0
chr16:71732739|71732929 hsa-miR-548at-5p 0 1 0
chr5:141511960|141512286 hsa-miR-548at-5p 0 1 0
chr11:107353524|107353736 hsa-miR-548at-5p 0 1 0
chr4:82423585|82423851 hsa-miR-548at-5p 0 1 0
chr10:103880926|103881146 hsa-miR-548at-5p 0 1 0
chr19:12773608|12773880 hsa-miR-548at-5p 0 1 0
chr5:76834710|76834845 hsa-miR-548at-5p 0 1 0
chr4:48904484|48904598 hsa-miR-548at-5p 0 1 0
chr2:85544031|85544177 hsa-miR-548at-5p 0 1 0
chr8:43022243|43022377 hsa-miR-548at-5p 0 1 0
chr10:70425461|70425611 hsa-miR-548at-5p 0 1 0
chr12:55942028|55942263 hsa-miR-548at-5p 0 1 0
chr10:100386528|100386720 hsa-miR-548at-5p 0 1 0
chr11:65855654|65855964 hsa-miR-548at-5p 0 1 0
chr15:75649065|75649180 hsa-miR-548at-5p 0 1 0
chr1:150965539|150965712 hsa-miR-548at-5p 0 1 0
chr3:154272160|154272403 hsa-miR-548at-5p 0 1 0
chr2:202238510|202238592 hsa-miR-548at-5p 0 1 0
chr2:158682627|158682841 hsa-miR-548at-5p 0 1 0
chr5:882367|882665 hsa-miR-548at-5p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-548at-5p POLR1B RNA polymerase I subunit B HGNC:20454 details
hsa-miR-548at-5p AGO4 argonaute RISC component 4 HGNC:18424 details
hsa-miR-548at-5p ANKRD26 ankyrin repeat domain 26 HGNC:29186 details
hsa-miR-548at-5p MMP16 matrix metallopeptidase 16 HGNC:7162 details
hsa-miR-548at-5p HDLBP high density lipoprotein binding protein HGNC:4857 details
hsa-miR-548at-5p PROX2 prospero homeobox 2 HGNC:26715 details
hsa-miR-548at-5p FUT10 fucosyltransferase 10 HGNC:19234 details
hsa-miR-548at-5p SIRT1 sirtuin 1 HGNC:14929 details
hsa-miR-548at-5p RPS19 ribosomal protein S19 HGNC:10402 details
hsa-miR-548at-5p HMGN1 high mobility group nucleosome binding domain 1 HGNC:4984 details
hsa-miR-548at-5p RAD51AP1 RAD51 associated protein 1 HGNC:16956 details
hsa-miR-548at-5p ZFP36L1 ZFP36 ring finger protein like 1 HGNC:1107 details
hsa-miR-548at-5p NSD2 nuclear receptor binding SET domain protein 2 HGNC:12766 details
hsa-miR-548at-5p TNRC6B trinucleotide repeat containing adaptor 6B HGNC:29190 details
hsa-miR-548at-5p TMOD3 tropomodulin 3 HGNC:11873 details
hsa-miR-548at-5p STX6 syntaxin 6 HGNC:11441 details
hsa-miR-548at-5p SMIM13 small integral membrane protein 13 HGNC:27356 details
hsa-miR-548at-5p IMPDH1P11 inosine monophosphate dehydrogenase 1 pseudogene 11 HGNC:6054 details
hsa-miR-548at-5p CBX5 chromobox 5 HGNC:1555 details
hsa-miR-548at-5p RNF11 ring finger protein 11 HGNC:10056 details
hsa-miR-548at-5p XIAP X-linked inhibitor of apoptosis HGNC:592 details
hsa-miR-548at-5p PCBP1 poly(rC) binding protein 1 HGNC:8647 details
hsa-miR-548at-5p BRWD3 bromodomain and WD repeat domain containing 3 HGNC:17342 details
hsa-miR-548at-5p TRIM24 tripartite motif containing 24 HGNC:11812 details
hsa-miR-548at-5p ZNF607 zinc finger protein 607 HGNC:28192 details
hsa-miR-548at-5p OXGR1 oxoglutarate receptor 1 HGNC:4531 details
hsa-miR-548at-5p TAOK1 TAO kinase 1 HGNC:29259 details
hsa-miR-548at-5p IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-548at-5p NACC2 NACC family member 2 HGNC:23846 details
hsa-miR-548at-5p MAT2A methionine adenosyltransferase 2A HGNC:6904 details
hsa-miR-548at-5p UCP1 uncoupling protein 1 HGNC:12517 details
hsa-miR-548at-5p MON1B MON1 homolog B, secretory trafficking associated HGNC:25020 details
hsa-miR-548at-5p KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-548at-5p E2F7 E2F transcription factor 7 HGNC:23820 details
hsa-miR-548at-5p PEX5L peroxisomal biogenesis factor 5 like HGNC:30024 details
hsa-miR-548at-5p HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 HGNC:17011 details
hsa-miR-548at-5p LRRC63 leucine rich repeat containing 63 HGNC:34296 details
hsa-miR-548at-5p ZNF579 zinc finger protein 579 HGNC:26646 details
hsa-miR-548at-5p NT5DC1 5'-nucleotidase domain containing 1 HGNC:21556 details
hsa-miR-548at-5p TMF1 TATA element modulatory factor 1 HGNC:11870 details
hsa-miR-548at-5p TMEM248 transmembrane protein 248 HGNC:25476 details
hsa-miR-548at-5p PRDX3 peroxiredoxin 3 HGNC:9354 details
hsa-miR-548at-5p GPBP1L1 GC-rich promoter binding protein 1 like 1 HGNC:28843 details
hsa-miR-548at-5p DONSON DNA replication fork stabilization factor DONSON HGNC:2993 details
hsa-miR-548at-5p SPIC Spi-C transcription factor HGNC:29549 details
hsa-miR-548at-5p FBLN2 fibulin 2 HGNC:3601 details
hsa-miR-548at-5p CCDC117 coiled-coil domain containing 117 HGNC:26599 details
hsa-miR-548at-5p SLC38A2 solute carrier family 38 member 2 HGNC:13448 details
hsa-miR-548at-5p PTBP2 polypyrimidine tract binding protein 2 HGNC:17662 details
hsa-miR-548at-5p PMEPA1 prostate transmembrane protein, androgen induced 1 HGNC:14107 details
hsa-miR-548at-5p PHOX2B paired like homeobox 2B HGNC:9143 details
hsa-miR-548at-5p NAA50 N-alpha-acetyltransferase 50, NatE catalytic subunit HGNC:29533 details
hsa-miR-548at-5p MAP4K5 mitogen-activated protein kinase kinase kinase kinase 5 HGNC:6867 details
hsa-miR-548at-5p INIP INTS3 and NABP interacting protein HGNC:24994 details
hsa-miR-548at-5p ELOVL6 ELOVL fatty acid elongase 6 HGNC:15829 details
hsa-miR-548at-5p DNAL1 dynein axonemal light chain 1 HGNC:23247 details
hsa-miR-548at-5p DDX3X DEAD-box helicase 3 X-linked HGNC:2745 details
hsa-miR-548at-5p ANP32E acidic nuclear phosphoprotein 32 family member E HGNC:16673 details
hsa-miR-548at-5p ANKRD28 ankyrin repeat domain 28 HGNC:29024 details
hsa-miR-548at-5p LYRM2 LYR motif containing 2 HGNC:25229 details
hsa-miR-548at-5p MDM2 MDM2 proto-oncogene HGNC:6973 details
hsa-miR-548at-5p PGK1 phosphoglycerate kinase 1 HGNC:8896 details
hsa-miR-548at-5p MRPL18 mitochondrial ribosomal protein L18 HGNC:14477 details
hsa-miR-548at-5p EGLN1 egl-9 family hypoxia inducible factor 1 HGNC:1232 details
hsa-miR-548at-5p NDRG1 N-myc downstream regulated 1 HGNC:7679 details
hsa-miR-548at-5p TRIM66 tripartite motif containing 66 HGNC:29005 details
hsa-miR-548at-5p RFTN2 raftlin family member 2 HGNC:26402 details
hsa-miR-548at-5p SLC7A5P2 solute carrier family 7 member 5 pseudogene 2 HGNC:24951 details
hsa-miR-548at-5p DHODH dihydroorotate dehydrogenase (quinone) HGNC:2867 details
hsa-miR-548at-5p ZNF275 zinc finger protein 275 HGNC:13069 details
hsa-miR-548at-5p ZBTB10 zinc finger and BTB domain containing 10 HGNC:30953 details
hsa-miR-548at-5p USP48 ubiquitin specific peptidase 48 HGNC:18533 details
hsa-miR-548at-5p RNF6 ring finger protein 6 HGNC:10069 details
hsa-miR-548at-5p PTMA prothymosin alpha HGNC:9623 details
hsa-miR-548at-5p GFPT1 glutamine--fructose-6-phosphate transaminase 1 HGNC:4241 details
hsa-miR-548at-5p CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 HGNC:28680 details
hsa-miR-548at-5p C5orf51 chromosome 5 open reading frame 51 HGNC:27750 details
hsa-miR-548at-5p ZNF138 zinc finger protein 138 HGNC:12922 details
hsa-miR-548at-5p TTC8 tetratricopeptide repeat domain 8 HGNC:20087 details
hsa-miR-548at-5p MRPL35 mitochondrial ribosomal protein L35 HGNC:14489 details
hsa-miR-548at-5p UBE2A ubiquitin conjugating enzyme E2 A HGNC:12472 details
hsa-miR-548at-5p TAF13 TATA-box binding protein associated factor 13 HGNC:11546 details
hsa-miR-548at-5p SUPT7L SPT7 like, STAGA complex subunit gamma HGNC:30632 details
hsa-miR-548at-5p ROBO1 roundabout guidance receptor 1 HGNC:10249 details
hsa-miR-548at-5p RCAN2 regulator of calcineurin 2 HGNC:3041 details
hsa-miR-548at-5p PRRC1 proline rich coiled-coil 1 HGNC:28164 details
hsa-miR-548at-5p PPP4R2 protein phosphatase 4 regulatory subunit 2 HGNC:18296 details
hsa-miR-548at-5p PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma HGNC:23786 details
hsa-miR-548at-5p HOXA9 homeobox A9 HGNC:5109 details
hsa-miR-548at-5p DHX33 DEAH-box helicase 33 HGNC:16718 details
hsa-miR-548at-5p DDX3Y DEAD-box helicase 3 Y-linked HGNC:2699 details
hsa-miR-548at-5p TMEM98 transmembrane protein 98 HGNC:24529 details
hsa-miR-548at-5p TWF1 twinfilin actin binding protein 1 HGNC:9620 details
hsa-miR-548at-5p TEAD1 TEA domain transcription factor 1 HGNC:11714 details
hsa-miR-548at-5p MSH6 mutS homolog 6 HGNC:7329 details
hsa-miR-548at-5p GINM1 glycoprotein integral membrane 1 HGNC:21074 details
hsa-miR-548at-5p RMI2 RecQ mediated genome instability 2 HGNC:28349 details
hsa-miR-548at-5p PPWD1 peptidylprolyl isomerase domain and WD repeat containing 1 HGNC:28954 details
hsa-miR-548at-5p ZNF146 zinc finger protein 146 HGNC:12931 details
hsa-miR-548at-5p SON SON DNA and RNA binding protein HGNC:11183 details
hsa-miR-548at-5p ITGB1 integrin subunit beta 1 HGNC:6153 details
hsa-miR-548at-5p FOXC1 forkhead box C1 HGNC:3800 details
hsa-miR-548at-5p CEP97 centrosomal protein 97 HGNC:26244 details
hsa-miR-548at-5p C1orf21 chromosome 1 open reading frame 21 HGNC:15494 details
hsa-miR-548at-5p YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta HGNC:12854 details
hsa-miR-548at-5p LSM11 LSM11, U7 small nuclear RNA associated HGNC:30860 details
hsa-miR-548at-5p DDX21 DExD-box helicase 21 HGNC:2744 details
hsa-miR-548at-5p TP73 tumor protein p73 HGNC:12003 details
hsa-miR-548at-5p CREBL2 cAMP responsive element binding protein like 2 HGNC:2350 details
hsa-miR-548at-5p SCYL3 SCY1 like pseudokinase 3 HGNC:19285 details
hsa-miR-548at-5p details
hsa-miR-548at-5p DHX36 DEAH-box helicase 36 HGNC:14410 details
hsa-miR-548at-5p TAF8 TATA-box binding protein associated factor 8 HGNC:17300 details
hsa-miR-548at-5p ZNF70 zinc finger protein 70 HGNC:13140 details
hsa-miR-548at-5p VBP1 VHL binding protein 1 HGNC:12662 details
hsa-miR-548at-5p WASL WASP like actin nucleation promoting factor HGNC:12735 details
hsa-miR-548at-5p STK38 serine/threonine kinase 38 HGNC:17847 details
hsa-miR-548at-5p RAB14 RAB14, member RAS oncogene family HGNC:16524 details
hsa-miR-548at-5p PCGF5 polycomb group ring finger 5 HGNC:28264 details
hsa-miR-548at-5p details
hsa-miR-548at-5p DCLK3 doublecortin like kinase 3 HGNC:19005 details
hsa-miR-548at-5p LMBRD2 LMBR1 domain containing 2 HGNC:25287 details
hsa-miR-548at-5p DDOST dolichyl-diphosphooligosaccharide--protein glycosyltransferase non-catalytic subunit HGNC:2728 details
hsa-miR-548at-5p LIPA lipase A, lysosomal acid type HGNC:6617 details
hsa-miR-548at-5p details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab