miRNA Card

miRNA General Information
miRNA ID hsa-miR-548av-3p
Description Homo sapiens miR-548av stem-loop
Comment None
Experiment
Sequence AAAACUGCAGUUACUUUUGC
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr10:115215697|115281487 hsa-miR-548av-3p 1 1 1

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr8:128092390|128092497 hsa-miR-548av-3p 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chrX:47585312|47585646 hsa-miR-548av-3p 0 1 0
chr12:48936299|48936427 hsa-miR-548av-3p 0 1 0
chr1:10418842|10419446 hsa-miR-548av-3p 0 1 0
chr22:29299269|29299667 hsa-miR-548av-3p 0 1 0
chr17:75004562|75004898 hsa-miR-548av-3p 0 1 0
chrX:41343737|41344074 hsa-miR-548av-3p 0 1 0
chr2:99197404|99197539 hsa-miR-548av-3p 0 1 0
chr1:10418826|10419446 hsa-miR-548av-3p 0 1 0
chr5:179729797|179729894 hsa-miR-548av-3p 0 1 0
chr19:57700250|57700526 hsa-miR-548av-3p 0 1 0
chr11:119094030|119094234 hsa-miR-548av-3p 0 1 0
chr1:12012541|12012728 hsa-miR-548av-3p 0 1 0
chr8:81483095|81483237 hsa-miR-548av-3p 0 1 0
chr5:179776237|179776373 hsa-miR-548av-3p 0 1 0
chr14:75469776|75469999 hsa-miR-548av-3p 0 1 0
chr19:11323913|11324007 hsa-miR-548av-3p 0 1 0
chr1:10418848|10419446 hsa-miR-548av-3p 0 1 0
chr20:32333617|32333739 hsa-miR-548av-3p 0 1 0
chr12:48044006|48044157 hsa-miR-548av-3p 0 1 0
chr12:56712444|56712536 hsa-miR-548av-3p 0 1 0
chr8:81483095~81483237 hsa-miR-548av-3p 0 1 0
chr8:76851987~76852124 hsa-miR-548av-3p 0 1 0
chr11:288422~288678 hsa-miR-548av-3p 0 1 0
chr6:43027212~43027429 hsa-miR-548av-3p 0 1 0
chr6:31640199~31640282 hsa-miR-548av-3p 0 1 0
chr1:245764041~245764149 hsa-miR-548av-3p 0 1 0
chr12:48936299~48936427 hsa-miR-548av-3p 0 1 0
chr14:75469854~75469999 hsa-miR-548av-3p 0 1 0
chr17:81870493|81870549 hsa-miR-548av-3p 0 1 0
chr13:91355620|91355777 hsa-miR-548av-3p 0 1 0
chr18:70293049|70293195 hsa-miR-548av-3p 0 1 0
chr20:47774408|47774495 hsa-miR-548av-3p 0 1 0
chr21:37225177|37225356 hsa-miR-548av-3p 0 1 0
chrX:71298731|71298854 hsa-miR-548av-3p 0 1 0
chr3:11536926|11537031 hsa-miR-548av-3p 0 1 0
chr3:31593130|31593283 hsa-miR-548av-3p 0 1 0
chr16:3414809|3414937 hsa-miR-548av-3p 0 1 0
chr11:76797595|76797733 hsa-miR-548av-3p 0 1 0
chr5:179776207|179776373 hsa-miR-548av-3p 0 1 0
chr15:90999731|90999939 hsa-miR-548av-3p 0 1 0
chr1:30870747|30870877 hsa-miR-548av-3p 0 1 0
chr4:30720406|30720535 hsa-miR-548av-3p 0 1 0
chr10:114938237|114938418 hsa-miR-548av-3p 0 1 0
chr1:2589480|2589687 hsa-miR-548av-3p 0 1 0
chr2:241346834|241347048 hsa-miR-548av-3p 0 1 0
chr17:63807780|63807900 hsa-miR-548av-3p 0 1 0
chr4:121035428|121035614 hsa-miR-548av-3p 0 1 0
chr1:10417489|10419446 hsa-miR-548av-3p 0 1 0
chr3:36996690|37001053 hsa-miR-548av-3p 0 1 0
chr1:10418878|10419446 hsa-miR-548av-3p 0 1 0
chr5:179776176|179776373 hsa-miR-548av-3p 0 1 0
chr19:47736402|47736533 hsa-miR-548av-3p 0 1 0
chrX:47585274|47585646 hsa-miR-548av-3p 0 1 0
chr1:114706669|114706824 hsa-miR-548av-3p 0 1 0
chr5:179776235|179776373 hsa-miR-548av-3p 0 1 0
chr1:10418837|10419446 hsa-miR-548av-3p 0 1 0
chr19:57700250|57700487 hsa-miR-548av-3p 0 1 0
chr10:70878711|70878897 hsa-miR-548av-3p 0 1 0
chr1:86744814|86744994 hsa-miR-548av-3p 0 1 0
chr10:114938269|114938418 hsa-miR-548av-3p 0 1 0
chr7:101097497|101097656 hsa-miR-548av-3p 0 1 0
chr11:76797497|76797657 hsa-miR-548av-3p 0 1 0
chr1:114706669|114706875 hsa-miR-548av-3p -8 1 0
chr1:225496309|225496515 hsa-miR-548av-3p -4 1 0
chr6:31640199|31640432 hsa-miR-548av-3p 0 1 0
chr3:14945461|14945601 hsa-miR-548av-3p 0 1 0
chr9:76663301|76663504 hsa-miR-548av-3p 0 1 0
chr11:78173455|78173593 hsa-miR-548av-3p 0 1 0
chr14:75469889|75469999 hsa-miR-548av-3p 0 1 0
chr5:179776153|179776373 hsa-miR-548av-3p 0 1 0
chr7:101097505|101097656 hsa-miR-548av-3p 0 1 0
chr1:12012475|12012728 hsa-miR-548av-3p 0 1 0
chr20:32333617|32333821 hsa-miR-548av-3p 0 1 0
chr22:29299264|29299646 hsa-miR-548av-3p 0 1 0
chr16:3679758|3686136 hsa-miR-548av-3p 0 1 0
chr5:179776209|179776373 hsa-miR-548av-3p 0 1 0
chr13:20403724|20403824 hsa-miR-548av-3p 0 1 0
chr17:47118464|47118622 hsa-miR-548av-3p 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-548av-3p LRRC58 leucine rich repeat containing 58 HGNC:26968 details
hsa-miR-548av-3p PACSIN2 protein kinase C and casein kinase substrate in neurons 2 HGNC:8571 details
hsa-miR-548av-3p RMND5A required for meiotic nuclear division 5 homolog A HGNC:25850 details
hsa-miR-548av-3p RNF152 ring finger protein 152 HGNC:26811 details
hsa-miR-548av-3p IFITM1 interferon induced transmembrane protein 1 HGNC:5412 details
hsa-miR-548av-3p RBM14 RNA binding motif protein 14 HGNC:14219 details
hsa-miR-548av-3p ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase family member 5 HGNC:13717 details
hsa-miR-548av-3p MFF mitochondrial fission factor HGNC:24858 details
hsa-miR-548av-3p VGLL4 vestigial like family member 4 HGNC:28966 details
hsa-miR-548av-3p RREB1 ras responsive element binding protein 1 HGNC:10449 details
hsa-miR-548av-3p RAB5B RAB5B, member RAS oncogene family HGNC:9784 details
hsa-miR-548av-3p PPP1R15B protein phosphatase 1 regulatory subunit 15B HGNC:14951 details
hsa-miR-548av-3p COASY Coenzyme A synthase HGNC:29932 details
hsa-miR-548av-3p POFUT1 protein O-fucosyltransferase 1 HGNC:14988 details
hsa-miR-548av-3p GSE1 Gse1 coiled-coil protein HGNC:28979 details
hsa-miR-548av-3p ZWINT ZW10 interacting kinetochore protein HGNC:13195 details
hsa-miR-548av-3p PNRC1 proline rich nuclear receptor coactivator 1 HGNC:17278 details
hsa-miR-548av-3p RPS21 ribosomal protein S21 HGNC:10409 details
hsa-miR-548av-3p E2F6 E2F transcription factor 6 HGNC:3120 details
hsa-miR-548av-3p BAG4 BAG cochaperone 4 HGNC:940 details
hsa-miR-548av-3p LMLN leishmanolysin like peptidase HGNC:15991 details
hsa-miR-548av-3p KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-548av-3p ELOVL5 ELOVL fatty acid elongase 5 HGNC:21308 details
hsa-miR-548av-3p CD164 CD164 molecule HGNC:1632 details
hsa-miR-548av-3p SBNO1 strawberry notch homolog 1 HGNC:22973 details
hsa-miR-548av-3p SGO1 shugoshin 1 HGNC:25088 details
hsa-miR-548av-3p SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 HGNC:18398 details
hsa-miR-548av-3p RAG1 recombination activating 1 HGNC:9831 details
hsa-miR-548av-3p TMSB4X thymosin beta 4 X-linked HGNC:11881 details
hsa-miR-548av-3p TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D HGNC:28759 details
hsa-miR-548av-3p NLN neurolysin HGNC:16058 details
hsa-miR-548av-3p ELL2 elongation factor for RNA polymerase II 2 HGNC:17064 details
hsa-miR-548av-3p details
hsa-miR-548av-3p SPRY1 sprouty RTK signaling antagonist 1 HGNC:11269 details
hsa-miR-548av-3p HOXA9 homeobox A9 HGNC:5109 details
hsa-miR-548av-3p GPC4 glypican 4 HGNC:4452 details
hsa-miR-548av-3p ASXL2 ASXL transcriptional regulator 2 HGNC:23805 details
hsa-miR-548av-3p GTF2E2 general transcription factor IIE subunit 2 HGNC:4651 details
hsa-miR-548av-3p ZNF639 zinc finger protein 639 HGNC:30950 details
hsa-miR-548av-3p NUTF2 nuclear transport factor 2 HGNC:13722 details
hsa-miR-548av-3p TMEM30A transmembrane protein 30A HGNC:16667 details
hsa-miR-548av-3p PPP2CA protein phosphatase 2 catalytic subunit alpha HGNC:9299 details
hsa-miR-548av-3p NUMB NUMB endocytic adaptor protein HGNC:8060 details
hsa-miR-548av-3p DNAJB14 DnaJ heat shock protein family (Hsp40) member B14 HGNC:25881 details
hsa-miR-548av-3p ZNF598 zinc finger protein 598, E3 ubiquitin ligase HGNC:28079 details
hsa-miR-548av-3p ZCCHC2 zinc finger CCHC-type containing 2 HGNC:22916 details
hsa-miR-548av-3p LCOR ligand dependent nuclear receptor corepressor HGNC:29503 details
hsa-miR-548av-3p HNRNPU heterogeneous nuclear ribonucleoprotein U HGNC:5048 details
hsa-miR-548av-3p E2F3 E2F transcription factor 3 HGNC:3115 details
hsa-miR-548av-3p ARF1 ADP ribosylation factor 1 HGNC:652 details
hsa-miR-548av-3p GNA13 G protein subunit alpha 13 HGNC:4381 details
hsa-miR-548av-3p FOXO3 forkhead box O3 HGNC:3821 details
hsa-miR-548av-3p FEN1 flap structure-specific endonuclease 1 HGNC:3650 details
hsa-miR-548av-3p TMEM135 transmembrane protein 135 HGNC:26167 details
hsa-miR-548av-3p KIF5B kinesin family member 5B HGNC:6324 details
hsa-miR-548av-3p KHSRP KH-type splicing regulatory protein HGNC:6316 details
hsa-miR-548av-3p CYLC2 cylicin 2 HGNC:2583 details
hsa-miR-548av-3p DNAL1 dynein axonemal light chain 1 HGNC:23247 details
hsa-miR-548av-3p PDYN prodynorphin HGNC:8820 details
hsa-miR-548av-3p PTEN phosphatase and tensin homolog HGNC:9588 details
hsa-miR-548av-3p SLC35A3 solute carrier family 35 member A3 HGNC:11023 details
hsa-miR-548av-3p ZNF48 zinc finger protein 48 HGNC:13114 details
hsa-miR-548av-3p NIPAL1 NIPA like domain containing 1 HGNC:27194 details
hsa-miR-548av-3p CRLS1 cardiolipin synthase 1 HGNC:16148 details
hsa-miR-548av-3p FFAR4 free fatty acid receptor 4 HGNC:19061 details
hsa-miR-548av-3p ZNF573 zinc finger protein 573 HGNC:26420 details
hsa-miR-548av-3p ZNF566 zinc finger protein 566 HGNC:25919 details
hsa-miR-548av-3p SEC14L4 SEC14 like lipid binding 4 HGNC:20627 details
hsa-miR-548av-3p FKBP9 FKBP prolyl isomerase 9 HGNC:3725 details
hsa-miR-548av-3p SP9 Sp9 transcription factor HGNC:30690 details
hsa-miR-548av-3p SPATS2L spermatogenesis associated serine rich 2 like HGNC:24574 details
hsa-miR-548av-3p SIKE1 suppressor of IKBKE 1 HGNC:26119 details
hsa-miR-548av-3p ITPRIPL2 ITPRIP like 2 HGNC:27257 details
hsa-miR-548av-3p ZBTB25 zinc finger and BTB domain containing 25 HGNC:13112 details
hsa-miR-548av-3p SETD1A SET domain containing 1A, histone lysine methyltransferase HGNC:29010 details
hsa-miR-548av-3p USP37 ubiquitin specific peptidase 37 HGNC:20063 details
hsa-miR-548av-3p details
hsa-miR-548av-3p SMAD2 SMAD family member 2 HGNC:6768 details
hsa-miR-548av-3p INSIG1 insulin induced gene 1 HGNC:6083 details
hsa-miR-548av-3p HEXIM1 HEXIM P-TEFb complex subunit 1 HGNC:24953 details
hsa-miR-548av-3p MRPS10 mitochondrial ribosomal protein S10 HGNC:14502 details
hsa-miR-548av-3p PGD phosphogluconate dehydrogenase HGNC:8891 details
hsa-miR-548av-3p KANSL1 KAT8 regulatory NSL complex subunit 1 HGNC:24565 details
hsa-miR-548av-3p SKA2 spindle and kinetochore associated complex subunit 2 HGNC:28006 details
hsa-miR-548av-3p ELF5 E74 like ETS transcription factor 5 HGNC:3320 details
hsa-miR-548av-3p details
hsa-miR-548av-3p GIGYF1 GRB10 interacting GYF protein 1 HGNC:9126 details
hsa-miR-548av-3p GPR107 G protein-coupled receptor 107 HGNC:17830 details
hsa-miR-548av-3p HMGB1 high mobility group box 1 HGNC:4983 details
hsa-miR-548av-3p details
hsa-miR-548av-3p ZFP36L1 ZFP36 ring finger protein like 1 HGNC:1107 details
hsa-miR-548av-3p KCTD21 potassium channel tetramerization domain containing 21 HGNC:27452 details
hsa-miR-548av-3p MRRF mitochondrial ribosome recycling factor HGNC:7234 details
hsa-miR-548av-3p PLA2G4A phospholipase A2 group IVA HGNC:9035 details
hsa-miR-548av-3p CCAR1 cell division cycle and apoptosis regulator 1 HGNC:24236 details
hsa-miR-548av-3p MAPKAPK5 MAPK activated protein kinase 5 HGNC:6889 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab