CircNet

miRNA General Information

Basic
Network

miRNA ID	hsa-miR-548aw
Description	Homo sapiens miR-548aw stem-loop
Comment	None
Experiment	Illumina [1]
Sequence	GUGCAAAAGUCAUCACGGUU

miRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan
chr2:53934605\|53937540	hsa-miR-548aw	1	0	1

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr4:7966405\|7966563	hsa-miR-548aw	0	1
chr12:50100093\|50100217	hsa-miR-548aw	0	1
chr6:157189729\|157190088	hsa-miR-548aw	0	1
chr12:6975123\|6975800	hsa-miR-548aw	0	1
chr12:14934907\|14937975	hsa-miR-548aw	0	1
chr10:80432338\|80432520	hsa-miR-548aw	0	1
chr19:16101888\|16102053	hsa-miR-548aw	0	1
chr1:119711962\|119712142	hsa-miR-548aw	0	1
chr16:70572064\|70572242	hsa-miR-548aw	0	1
chr17:37513201\|37513291	hsa-miR-548aw	0	1
chr3:14920724\|14920914	hsa-miR-548aw	0	1
chr7:80656592\|80656694	hsa-miR-548aw	0	1
chr10:6233726\|6233834	hsa-miR-548aw	0	1
chr11:35810617\|35810740	hsa-miR-548aw	0	1
chr6:7882432\|7882659	hsa-miR-548aw	0	1
chr12:131922394\|131922503	hsa-miR-548aw	0	1
chrX:13709143\|13709279	hsa-miR-548aw	0	1
chr15:33972231\|33972359	hsa-miR-548aw	0	1
chr16:648289\|648384	hsa-miR-548aw	0	1
chr11:36230699\|36230805	hsa-miR-548aw	0	1
chr6:7882538\|7882659	hsa-miR-548aw	0	1
chr19:52059835\|52059946	hsa-miR-548aw	0	1
chr10:6233701\|6233866	hsa-miR-548aw	0	1
chr1:119711994\|119712103	hsa-miR-548aw	0	1
chr5:173314863\|173314986	hsa-miR-548aw	0	1
chr12:69587957\|69588238	hsa-miR-548aw	0	1
chr17:40100329\|40100483	hsa-miR-548aw	0	1
chr19:9343646\|9343807	hsa-miR-548aw	0	1
chr17:74951002\|74951103	hsa-miR-548aw	0	1
chr11:67673486\|67673597	hsa-miR-548aw	0	1
chr8:27598197\|27598518	hsa-miR-548aw	0	1
chr20:46685774\|46685904	hsa-miR-548aw	0	1
chr10:6233618\|6233834	hsa-miR-548aw	0	1
chr9:134438644\|134438807	hsa-miR-548aw	0	1
chr5:173314863\|173314957	hsa-miR-548aw	0	1
chr10:80432320~80432517	hsa-miR-548aw	0	1
chr5:56888234~56888357	hsa-miR-548aw	0	1
chr2:207080336~207080511	hsa-miR-548aw	0	1
chr11:36230699~36230805	hsa-miR-548aw	0	1
chr11:36230671~36230805	hsa-miR-548aw	0	1
chr19:16101888~16102053	hsa-miR-548aw	0	1
chr17:37513201~37513291	hsa-miR-548aw	0	1
chr11:35810617~35810740	hsa-miR-548aw	0	1
chr6:157189729~157190088	hsa-miR-548aw	0	1
chr20:44747063~44747218	hsa-miR-548aw	0	1
chr6:89644238\|89644302	hsa-miR-548aw	0	1
chr12:31325888\|31326104	hsa-miR-548aw	0	1
chr17:7063823\|7064014	hsa-miR-548aw	0	1
chr1:150577287\|150577458	hsa-miR-548aw	0	1
chr16:67098858\|67098956	hsa-miR-548aw	0	1
chr4:127965927\|127966040	hsa-miR-548aw	0	1
chrX:154675870\|154676026	hsa-miR-548aw	0	1
chr11:31435592\|31435703	hsa-miR-548aw	0	1
chr2:178653238\|178663902	hsa-miR-548aw	0	1
chr1:89754166\|89754255	hsa-miR-548aw	0	1
chr2:86550163\|86550279	hsa-miR-548aw	0	1
chr16:11798057\|11798233	hsa-miR-548aw	0	1
chr15:90883132\|90883293	hsa-miR-548aw	0	1
chr17:74431629\|74431903	hsa-miR-548aw	0	1
chr3:45547405\|45547649	hsa-miR-548aw	0	1
chr2:207080336\|207080518	hsa-miR-548aw	0	1
chr2:210677998\|210678163	hsa-miR-548aw	0	1
chrX:20125410\|20125526	hsa-miR-548aw	0	1
chr11:35810625\|35810740	hsa-miR-548aw	0	1
chr11:35810608\|35810740	hsa-miR-548aw	0	1
chr6:31951875\|31952019	hsa-miR-548aw	0	1
chr12:50100113\|50100217	hsa-miR-548aw	0	1
chr16:69335071\|69335213	hsa-miR-548aw	0	1
chr8:41509961\|41510066	hsa-miR-548aw	0	1
chr14:103129297\|103129428	hsa-miR-548aw	0	1
chr10:80432338\|80432517	hsa-miR-548aw	0	1
chr7:138001700\|138001994	hsa-miR-548aw	0	1
chr15:90883152\|90883282	hsa-miR-548aw	0	1
chr6:7882538\|7882652	hsa-miR-548aw	0	1
chr2:239960919\|239961023	hsa-miR-548aw	0	1
chr1:246566010\|246566204	hsa-miR-548aw	0	1
chr17:35441127\|35441243	hsa-miR-548aw	0	1
chr11:45882129\|45882281	hsa-miR-548aw	-4	1
chr15:90883152\|90883277	hsa-miR-548aw	-8	1
chr9:6257293\|6257395	hsa-miR-548aw	-9	1
chr11:35810552\|35810754	hsa-miR-548aw	0	1
chr1:11919884\|11920076	hsa-miR-548aw	-10	1
chr1:1985252\|1985432	hsa-miR-548aw	0	1
chr10:94328226\|94328351	hsa-miR-548aw	0	1
chr1:234365416\|234365551	hsa-miR-548aw	0	1
chr7:99538368\|99538486	hsa-miR-548aw	0	1
chr17:40100380\|40100497	hsa-miR-548aw	0	1
chr6:36489528\|36489718	hsa-miR-548aw	0	1
chr3:53812659\|53812736	hsa-miR-548aw	0	1
chr9:5054749\|5054872	hsa-miR-548aw	0	1
chr12:2858433\|2858522	hsa-miR-548aw	0	1
chr6:31951875\|31951976	hsa-miR-548aw	0	1
chr13:21375042\|21375198	hsa-miR-548aw	0	1
chr2:65205776\|65205924	hsa-miR-548aw	0	1
chr1:28743052\|28743175	hsa-miR-548aw	0	1
chr14:73219260\|73219438	hsa-miR-548aw	0	1
chr17:37513192\|37513291	hsa-miR-548aw	0	1
chr17:40100380\|40100501	hsa-miR-548aw	0	1
chr16:11003149\|11003269	hsa-miR-548aw	0	1
chr4:140532090\|140532225	hsa-miR-548aw	0	1
chr13:42234616\|42234840	hsa-miR-548aw	0	1

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-miR-548aw	ZNF701	zinc finger protein 701	HGNC:25597	details
hsa-miR-548aw	ZNF525	zinc finger protein 525	HGNC:29423	details
hsa-miR-548aw	CRYBG3	crystallin beta-gamma domain containing 3	HGNC:34427	details
hsa-miR-548aw	FOXP1	forkhead box P1	HGNC:3823	details
hsa-miR-548aw	POLI	DNA polymerase iota	HGNC:9182	details
hsa-miR-548aw	OTUD7A	OTU deubiquitinase 7A	HGNC:20718	details
hsa-miR-548aw	DDX39B	DExD-box helicase 39B	HGNC:13917	details
hsa-miR-548aw	EIF4EBP2	eukaryotic translation initiation factor 4E binding protein 2	HGNC:3289	details
hsa-miR-548aw				details
hsa-miR-548aw	ZBTB38	zinc finger and BTB domain containing 38	HGNC:26636	details
hsa-miR-548aw	YY1	YY1 transcription factor	HGNC:12856	details
hsa-miR-548aw	WNT7B	Wnt family member 7B	HGNC:12787	details
hsa-miR-548aw	TMBIM6	transmembrane BAX inhibitor motif containing 6	HGNC:11723	details
hsa-miR-548aw	STX6	syntaxin 6	HGNC:11441	details
hsa-miR-548aw	STX16	syntaxin 16	HGNC:11431	details
hsa-miR-548aw	SMG1	SMG1 nonsense mediated mRNA decay associated PI3K related kinase	HGNC:30045	details
hsa-miR-548aw	SGK1	serum/glucocorticoid regulated kinase 1	HGNC:10810	details
hsa-miR-548aw	SELENOT	selenoprotein T	HGNC:18136	details
hsa-miR-548aw	RGS16	regulator of G protein signaling 16	HGNC:9997	details
hsa-miR-548aw	PTGES2	prostaglandin E synthase 2	HGNC:17822	details
hsa-miR-548aw	PPP2R5E	protein phosphatase 2 regulatory subunit B'epsilon	HGNC:9313	details
hsa-miR-548aw	PITPNA	phosphatidylinositol transfer protein alpha	HGNC:9001	details
hsa-miR-548aw	PATL1	PAT1 homolog 1, processing body mRNA decay factor	HGNC:26721	details
hsa-miR-548aw	NFIB	nuclear factor I B	HGNC:7785	details
hsa-miR-548aw	MTMR6	myotubularin related protein 6	HGNC:7453	details
hsa-miR-548aw	KIF13A	kinesin family member 13A	HGNC:14566	details
hsa-miR-548aw				details
hsa-miR-548aw				details
hsa-miR-548aw	GMFB	glia maturation factor beta	HGNC:4373	details
hsa-miR-548aw	FZD6	frizzled class receptor 6	HGNC:4044	details
hsa-miR-548aw	MIGA2	mitoguardin 2	HGNC:23621	details
hsa-miR-548aw	EOGT	EGF domain specific O-linked N-acetylglucosamine transferase	HGNC:28526	details
hsa-miR-548aw	ELL2	elongation factor for RNA polymerase II 2	HGNC:17064	details
hsa-miR-548aw	DLG5	discs large MAGUK scaffold protein 5	HGNC:2904	details
hsa-miR-548aw	CCNA2	cyclin A2	HGNC:1578	details
hsa-miR-548aw	BLCAP	BLCAP apoptosis inducing factor	HGNC:1055	details
hsa-miR-548aw	ATP6V1B2	ATPase H+ transporting V1 subunit B2	HGNC:854	details
hsa-miR-548aw	ARL5B	ADP ribosylation factor like GTPase 5B	HGNC:23052	details
hsa-miR-548aw	ANKRD11	ankyrin repeat domain 11	HGNC:21316	details
hsa-miR-548aw	ZFYVE26	zinc finger FYVE-type containing 26	HGNC:20761	details
hsa-miR-548aw	SOX4	SRY-box transcription factor 4	HGNC:11200	details
hsa-miR-548aw	DICER1	dicer 1, ribonuclease III	HGNC:17098	details
hsa-miR-548aw	ARPP19	cAMP regulated phosphoprotein 19	HGNC:16967	details
hsa-miR-548aw	SEC23A	SEC23 homolog A, COPII coat complex component	HGNC:10701	details
hsa-miR-548aw	CNOT4	CCR4-NOT transcription complex subunit 4	HGNC:7880	details
hsa-miR-548aw	ATF7IP	activating transcription factor 7 interacting protein	HGNC:20092	details
hsa-miR-548aw	PDRG1	p53 and DNA damage regulated 1	HGNC:16119	details
hsa-miR-548aw	WDR45B	WD repeat domain 45B	HGNC:25072	details
hsa-miR-548aw	SLC48A1	solute carrier family 48 member 1	HGNC:26035	details
hsa-miR-548aw	MMGT1	membrane magnesium transporter 1	HGNC:28100	details
hsa-miR-548aw	LPP	LIM domain containing preferred translocation partner in lipoma	HGNC:6679	details
hsa-miR-548aw	CCND2	cyclin D2	HGNC:1583	details
hsa-miR-548aw	BTF3L4	basic transcription factor 3 like 4	HGNC:30547	details
hsa-miR-548aw	BRWD3	bromodomain and WD repeat domain containing 3	HGNC:17342	details
hsa-miR-548aw	ROCK1	Rho associated coiled-coil containing protein kinase 1	HGNC:10251	details
hsa-miR-548aw	PTBP2	polypyrimidine tract binding protein 2	HGNC:17662	details
hsa-miR-548aw	NBPF11	NBPF member 11	HGNC:31993	details
hsa-miR-548aw	UQCRFS1	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	HGNC:12587	details
hsa-miR-548aw	TUBB2A	tubulin beta 2A class IIa	HGNC:12412	details
hsa-miR-548aw	SMCR8	SMCR8-C9orf72 complex subunit	HGNC:17921	details
hsa-miR-548aw	SKIL	SKI like proto-oncogene	HGNC:10897	details
hsa-miR-548aw	SEMA4C	semaphorin 4C	HGNC:10731	details
hsa-miR-548aw	PPP1R15B	protein phosphatase 1 regulatory subunit 15B	HGNC:14951	details
hsa-miR-548aw	PLEKHF2	pleckstrin homology and FYVE domain containing 2	HGNC:20757	details
hsa-miR-548aw	G3BP2	G3BP stress granule assembly factor 2	HGNC:30291	details
hsa-miR-548aw	CCNL1	cyclin L1	HGNC:20569	details
hsa-miR-548aw	ZNF154	zinc finger protein 154	HGNC:12939	details
hsa-miR-548aw	ASGR2	asialoglycoprotein receptor 2	HGNC:743	details
hsa-miR-548aw	ERCC4	ERCC excision repair 4, endonuclease catalytic subunit	HGNC:3436	details
hsa-miR-548aw	VMA21	vacuolar ATPase assembly factor VMA21	HGNC:22082	details
hsa-miR-548aw	UBN2	ubinuclein 2	HGNC:21931	details
hsa-miR-548aw	QKI	QKI, KH domain containing RNA binding	HGNC:21100	details
hsa-miR-548aw	MOB1B	MOB kinase activator 1B	HGNC:29801	details
hsa-miR-548aw	MED12L	mediator complex subunit 12L	HGNC:16050	details
hsa-miR-548aw	CEP350	centrosomal protein 350	HGNC:24238	details
hsa-miR-548aw	SMAD4	SMAD family member 4	HGNC:6770	details
hsa-miR-548aw	MCRIP2	MAPK regulated corepressor interacting protein 2	HGNC:14142	details
hsa-miR-548aw	SPART	spartin	HGNC:18514	details
hsa-miR-548aw	RAN	RAN, member RAS oncogene family	HGNC:9846	details
hsa-miR-548aw	PSMA2	proteasome 20S subunit alpha 2	HGNC:9531	details
hsa-miR-548aw	PPTC7	protein phosphatase targeting COQ7	HGNC:30695	details
hsa-miR-548aw	NIPA1	NIPA magnesium transporter 1	HGNC:17043	details
hsa-miR-548aw	LNPEP	leucyl and cystinyl aminopeptidase	HGNC:6656	details
hsa-miR-548aw	ELOVL5	ELOVL fatty acid elongase 5	HGNC:21308	details
hsa-miR-548aw	CREBL2	cAMP responsive element binding protein like 2	HGNC:2350	details
hsa-miR-548aw	SF3B3	splicing factor 3b subunit 3	HGNC:10770	details
hsa-miR-548aw	RNF111	ring finger protein 111	HGNC:17384	details
hsa-miR-548aw	GRB10	growth factor receptor bound protein 10	HGNC:4564	details
hsa-miR-548aw	F8A2	coagulation factor VIII associated 2	HGNC:31849	details
hsa-miR-548aw	F8A3	coagulation factor VIII associated 3	HGNC:31850	details
hsa-miR-548aw	ITM2C	integral membrane protein 2C	HGNC:6175	details
hsa-miR-548aw	IMPA1	inositol monophosphatase 1	HGNC:6050	details
hsa-miR-548aw	TBRG1	transforming growth factor beta regulator 1	HGNC:29551	details
hsa-miR-548aw	SLC30A4	solute carrier family 30 member 4	HGNC:11015	details
hsa-miR-548aw	RRAGD	Ras related GTP binding D	HGNC:19903	details
hsa-miR-548aw	RNF11	ring finger protein 11	HGNC:10056	details
hsa-miR-548aw	LDLR	low density lipoprotein receptor	HGNC:6547	details
hsa-miR-548aw	KPNA6	karyopherin subunit alpha 6	HGNC:6399	details
hsa-miR-548aw	AGFG1	ArfGAP with FG repeats 1	HGNC:5175	details
hsa-miR-548aw	ZNF93	zinc finger protein 93	HGNC:13169	details
hsa-miR-548aw	GAS7	growth arrest specific 7	HGNC:4169	details
hsa-miR-548aw	CCNL2	cyclin L2	HGNC:20570	details
hsa-miR-548aw				details
hsa-miR-548aw	NUP58	nucleoporin 58	HGNC:20261	details
hsa-miR-548aw	MALT1	MALT1 paracaspase	HGNC:6819	details
hsa-miR-548aw	COA5	cytochrome c oxidase assembly factor 5	HGNC:33848	details
hsa-miR-548aw				details
hsa-miR-548aw	GLP2R	glucagon like peptide 2 receptor	HGNC:4325	details
hsa-miR-548aw	LINC00598	long intergenic non-protein coding RNA 598	HGNC:42770	details
hsa-miR-548aw	RAVER2	ribonucleoprotein, PTB binding 2	HGNC:25577	details
hsa-miR-548aw	RAB8B	RAB8B, member RAS oncogene family	HGNC:30273	details
hsa-miR-548aw	MRPL17	mitochondrial ribosomal protein L17	HGNC:14053	details
hsa-miR-548aw	TLNRD1	talin rod domain containing 1	HGNC:13519	details
hsa-miR-548aw	GRAMD4	GRAM domain containing 4	HGNC:29113	details
hsa-miR-548aw	ANKRD50	ankyrin repeat domain 50	HGNC:29223	details
hsa-miR-548aw				details
hsa-miR-548aw	ADARB2	adenosine deaminase RNA specific B2 (inactive)	HGNC:227	details
hsa-miR-548aw	ZNF367	zinc finger protein 367	HGNC:18320	details
hsa-miR-548aw	TNFRSF11A	TNF receptor superfamily member 11a	HGNC:11908	details
hsa-miR-548aw	ESYT1	extended synaptotagmin 1	HGNC:29534	details
hsa-miR-548aw	AP5Z1	adaptor related protein complex 5 subunit zeta 1	HGNC:22197	details
hsa-miR-548aw	NDRG1	N-myc downstream regulated 1	HGNC:7679	details
hsa-miR-548aw	MFF	mitochondrial fission factor	HGNC:24858	details
hsa-miR-548aw	PAICS	phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase	HGNC:8587	details
hsa-miR-548aw	ZNF772	zinc finger protein 772	HGNC:33106	details
hsa-miR-548aw	WDR81	WD repeat domain 81	HGNC:26600	details
hsa-miR-548aw	WDR26	WD repeat domain 26	HGNC:21208	details
hsa-miR-548aw	WBP4	WW domain binding protein 4	HGNC:12739	details
hsa-miR-548aw	USP13	ubiquitin specific peptidase 13	HGNC:12611	details
hsa-miR-548aw	STOX2	storkhead box 2	HGNC:25450	details
hsa-miR-548aw	SLC6A8	solute carrier family 6 member 8	HGNC:11055	details
hsa-miR-548aw	RORA	RAR related orphan receptor A	HGNC:10258	details
hsa-miR-548aw	SFTPA1	surfactant protein A1	HGNC:10798	details
hsa-miR-548aw	POGZ	pogo transposable element derived with ZNF domain	HGNC:18801	details
hsa-miR-548aw	MBNL3	muscleblind like splicing regulator 3	HGNC:20564	details
hsa-miR-548aw	MBNL1	muscleblind like splicing regulator 1	HGNC:6923	details
hsa-miR-548aw	LCLAT1	lysocardiolipin acyltransferase 1	HGNC:26756	details
hsa-miR-548aw	GIGYF1	GRB10 interacting GYF protein 1	HGNC:9126	details
hsa-miR-548aw	ELMOD2	ELMO domain containing 2	HGNC:28111	details
hsa-miR-548aw	E2F8	E2F transcription factor 8	HGNC:24727	details
hsa-miR-548aw	CEP55	centrosomal protein 55	HGNC:1161	details
hsa-miR-548aw	CHEK2	checkpoint kinase 2	HGNC:16627	details
hsa-miR-548aw	CALM1	calmodulin 1	HGNC:1442	details
hsa-miR-548aw				details
hsa-miR-548aw	BMP3	bone morphogenetic protein 3	HGNC:1070	details
hsa-miR-548aw	ARHGAP12	Rho GTPase activating protein 12	HGNC:16348	details
hsa-miR-548aw	ARC	activity regulated cytoskeleton associated protein	HGNC:648	details
hsa-miR-548aw	ACBD5	acyl-CoA binding domain containing 5	HGNC:23338	details
hsa-miR-548aw	ZNF598	zinc finger protein 598, E3 ubiquitin ligase	HGNC:28079	details
hsa-miR-548aw	MAVS	mitochondrial antiviral signaling protein	HGNC:29233	details
hsa-miR-548aw	MYZAP	myocardial zonula adherens protein	HGNC:43444	details
hsa-miR-548aw	ZNF678	zinc finger protein 678	HGNC:28652	details
hsa-miR-548aw	CIDEC	cell death inducing DFFA like effector c	HGNC:24229	details
hsa-miR-548aw	ZXDA	zinc finger X-linked duplicated A	HGNC:13198	details
hsa-miR-548aw	ZBTB18	zinc finger and BTB domain containing 18	HGNC:13030	details
hsa-miR-548aw	WASL	WASP like actin nucleation promoting factor	HGNC:12735	details
hsa-miR-548aw	UCK2	uridine-cytidine kinase 2	HGNC:12562	details
hsa-miR-548aw	TRIM33	tripartite motif containing 33	HGNC:16290	details
hsa-miR-548aw	SAMD8	sterile alpha motif domain containing 8	HGNC:26320	details
hsa-miR-548aw	REL	REL proto-oncogene, NF-kB subunit	HGNC:9954	details
hsa-miR-548aw	RCAN2	regulator of calcineurin 2	HGNC:3041	details
hsa-miR-548aw	PRKACB	protein kinase cAMP-activated catalytic subunit beta	HGNC:9381	details
hsa-miR-548aw				details
hsa-miR-548aw	MYBL1	MYB proto-oncogene like 1	HGNC:7547	details
hsa-miR-548aw	MLEC	malectin	HGNC:28973	details
hsa-miR-548aw	MCC	MCC regulator of WNT signaling pathway	HGNC:6935	details
hsa-miR-548aw	MARCKS	myristoylated alanine rich protein kinase C substrate	HGNC:6759	details
hsa-miR-548aw	ITGA2	integrin subunit alpha 2	HGNC:6137	details
hsa-miR-548aw	HNRNPF	heterogeneous nuclear ribonucleoprotein F	HGNC:5039	details
hsa-miR-548aw	HBP1	HMG-box transcription factor 1	HGNC:23200	details
hsa-miR-548aw	GNPTAB	N-acetylglucosamine-1-phosphate transferase subunits alpha and beta	HGNC:29670	details
hsa-miR-548aw	GATA6	GATA binding protein 6	HGNC:4174	details
hsa-miR-548aw	FBXO8	F-box protein 8	HGNC:13587	details
hsa-miR-548aw	EVI5L	ecotropic viral integration site 5 like	HGNC:30464	details
hsa-miR-548aw	ETS2	ETS proto-oncogene 2, transcription factor	HGNC:3489	details
hsa-miR-548aw	ENPP4	ectonucleotide pyrophosphatase/phosphodiesterase 4	HGNC:3359	details
hsa-miR-548aw	EDEM1	ER degradation enhancing alpha-mannosidase like protein 1	HGNC:18967	details
hsa-miR-548aw	DBN1	drebrin 1	HGNC:2695	details
hsa-miR-548aw	CYP2U1	cytochrome P450 family 2 subfamily U member 1	HGNC:20582	details
hsa-miR-548aw	CHIC1	cysteine rich hydrophobic domain 1	HGNC:1934	details
hsa-miR-548aw	CFL2	cofilin 2	HGNC:1875	details
hsa-miR-548aw				details
hsa-miR-548aw	ARL8A	ADP ribosylation factor like GTPase 8A	HGNC:25192	details
hsa-miR-548aw	AGO3	argonaute RISC catalytic component 3	HGNC:18421	details
hsa-miR-548aw	ABHD2	abhydrolase domain containing 2, acylglycerol lipase	HGNC:18717	details
hsa-miR-548aw	ZNF680	zinc finger protein 680	HGNC:26897	details
hsa-miR-548aw	ZNF107	zinc finger protein 107	HGNC:12887	details
hsa-miR-548aw	ZMYND11	zinc finger MYND-type containing 11	HGNC:16966	details
hsa-miR-548aw	ZDHHC18	zinc finger DHHC-type palmitoyltransferase 18	HGNC:20712	details
hsa-miR-548aw	KIAA0895	KIAA0895	HGNC:22206	details
hsa-miR-548aw	CBX3	chromobox 3	HGNC:1553	details
hsa-miR-548aw	RPLP0	ribosomal protein lateral stalk subunit P0	HGNC:10371	details
hsa-miR-548aw	CLVS2	clavesin 2	HGNC:23046	details
hsa-miR-548aw	CCDC80	coiled-coil domain containing 80	HGNC:30649	details
hsa-miR-548aw	TMPPE	transmembrane protein with metallophosphoesterase domain	HGNC:33865	details
hsa-miR-548aw	TMEM41A	transmembrane protein 41A	HGNC:30544	details
hsa-miR-548aw	NFYA	nuclear transcription factor Y subunit alpha	HGNC:7804	details
hsa-miR-548aw	MAPK8	mitogen-activated protein kinase 8	HGNC:6881	details
hsa-miR-548aw	KCNJ2	potassium inwardly rectifying channel subfamily J member 2	HGNC:6263	details
hsa-miR-548aw	HSPA13	heat shock protein family A (Hsp70) member 13	HGNC:11375	details
hsa-miR-548aw				details
hsa-miR-548aw	GDNF	glial cell derived neurotrophic factor	HGNC:4232	details
hsa-miR-548aw	AKAP10	A-kinase anchoring protein 10	HGNC:368	details
hsa-miR-548aw	ACVR2A	activin A receptor type 2A	HGNC:173	details
hsa-miR-548aw	FZD5	frizzled class receptor 5	HGNC:4043	details
hsa-miR-548aw	HCFC2	host cell factor C2	HGNC:24972	details
hsa-miR-548aw	AKR7A2	aldo-keto reductase family 7 member A2	HGNC:389	details
hsa-miR-548aw	B3GNT6	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6	HGNC:24141	details
hsa-miR-548aw	ODF4	outer dense fiber of sperm tails 4	HGNC:19056	details
hsa-miR-548aw	TAOK3	TAO kinase 3	HGNC:18133	details
hsa-miR-548aw	MLLT6	MLLT6, PHD finger containing	HGNC:7138	details
hsa-miR-548aw	FAM104A	family with sequence similarity 104 member A	HGNC:25918	details
hsa-miR-548aw	EPHB1	EPH receptor B1	HGNC:3392	details
hsa-miR-548aw	PEX26	peroxisomal biogenesis factor 26	HGNC:22965	details
hsa-miR-548aw	RAB30	RAB30, member RAS oncogene family	HGNC:9770	details
hsa-miR-548aw	ZBTB33	zinc finger and BTB domain containing 33	HGNC:16682	details
hsa-miR-548aw	SPOP	speckle type BTB/POZ protein	HGNC:11254	details
hsa-miR-548aw	NHLRC2	NHL repeat containing 2	HGNC:24731	details
hsa-miR-548aw	PTPN14	protein tyrosine phosphatase non-receptor type 14	HGNC:9647	details
hsa-miR-548aw	ZNF429	zinc finger protein 429	HGNC:20817	details
hsa-miR-548aw	RAB23	RAB23, member RAS oncogene family	HGNC:14263	details
hsa-miR-548aw	HSD17B12	hydroxysteroid 17-beta dehydrogenase 12	HGNC:18646	details
hsa-miR-548aw	PYCARD	PYD and CARD domain containing	HGNC:16608	details
hsa-miR-548aw	UNC5D	unc-5 netrin receptor D	HGNC:18634	details
hsa-miR-548aw	PRRC2B	proline rich coiled-coil 2B	HGNC:28121	details
hsa-miR-548aw	MAPK14	mitogen-activated protein kinase 14	HGNC:6876	details
hsa-miR-548aw	JCAD	junctional cadherin 5 associated	HGNC:29283	details
hsa-miR-548aw	ENAH	ENAH actin regulator	HGNC:18271	details
hsa-miR-548aw	EMP2	epithelial membrane protein 2	HGNC:3334	details
hsa-miR-548aw	DCTN5	dynactin subunit 5	HGNC:24594	details
hsa-miR-548aw	EEF1AKMT2	EEF1A lysine methyltransferase 2	HGNC:33787	details
hsa-miR-548aw	LIMD1	LIM domain containing 1	HGNC:6612	details
hsa-miR-548aw	ZZZ3	zinc finger ZZ-type containing 3	HGNC:24523	details
hsa-miR-548aw	C19orf44	chromosome 19 open reading frame 44	HGNC:26141	details
hsa-miR-548aw				details
hsa-miR-548aw	DIP2A	disco interacting protein 2 homolog A	HGNC:17217	details
hsa-miR-548aw	MTHFD1	methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1	HGNC:7432	details
hsa-miR-548aw	KIAA0513	KIAA0513	HGNC:29058	details
hsa-miR-548aw	FOXRED2	FAD dependent oxidoreductase domain containing 2	HGNC:26264	details
hsa-miR-548aw	SPIN4	spindlin family member 4	HGNC:27040	details
hsa-miR-548aw	SNX19	sorting nexin 19	HGNC:21532	details
hsa-miR-548aw	UBXN7	UBX domain protein 7	HGNC:29119	details
hsa-miR-548aw	FKBP15	FKBP prolyl isomerase family member 15	HGNC:23397	details
hsa-miR-548aw	CNEP1R1	CTD nuclear envelope phosphatase 1 regulatory subunit 1	HGNC:26759	details
hsa-miR-548aw	CAMSAP1	calmodulin regulated spectrin associated protein 1	HGNC:19946	details
hsa-miR-548aw	AMMECR1L	AMMECR1 like	HGNC:28658	details
hsa-miR-548aw	NWD1	NACHT and WD repeat domain containing 1	HGNC:27619	details
hsa-miR-548aw	PPFIBP1	PPFIA binding protein 1	HGNC:9249	details
hsa-miR-548aw	WNK3	WNK lysine deficient protein kinase 3	HGNC:14543	details
hsa-miR-548aw	SLC30A7	solute carrier family 30 member 7	HGNC:19306	details
hsa-miR-548aw	ARMC10	armadillo repeat containing 10	HGNC:21706	details
hsa-miR-548aw	TMTC1	transmembrane O-mannosyltransferase targeting cadherins 1	HGNC:24099	details
hsa-miR-548aw	CHERP	calcium homeostasis endoplasmic reticulum protein	HGNC:16930	details
hsa-miR-548aw	CD209	CD209 molecule	HGNC:1641	details
hsa-miR-548aw	MUC21	mucin 21, cell surface associated	HGNC:21661	details
hsa-miR-548aw	HNRNPA3	heterogeneous nuclear ribonucleoprotein A3	HGNC:24941	details
hsa-miR-548aw	EREG	epiregulin	HGNC:3443	details
hsa-miR-548aw	FXR1	FMR1 autosomal homolog 1	HGNC:4023	details
hsa-miR-548aw	MYH9	myosin heavy chain 9	HGNC:7579	details
hsa-miR-548aw	SECISBP2L	SECIS binding protein 2 like	HGNC:28997	details
hsa-miR-548aw	ZBTB7B	zinc finger and BTB domain containing 7B	HGNC:18668	details
hsa-miR-548aw	ATP6V0E1	ATPase H+ transporting V0 subunit e1	HGNC:863	details
hsa-miR-548aw	CAMK2N1	calcium/calmodulin dependent protein kinase II inhibitor 1	HGNC:24190	details
hsa-miR-548aw	RTL8C	retrotransposon Gag like 8C	HGNC:2569	details
hsa-miR-548aw	SP140L	SP140 nuclear body protein like	HGNC:25105	details
hsa-miR-548aw	IGSF10	immunoglobulin superfamily member 10	HGNC:26384	details
hsa-miR-548aw	PHIP	pleckstrin homology domain interacting protein	HGNC:15673	details
hsa-miR-548aw	CPE	carboxypeptidase E	HGNC:2303	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)