miRNA Card

miRNA General Information
miRNA ID hsa-miR-548ay-3p
Description Homo sapiens miR-548ay stem-loop
Comment None
Experiment Illumina [1]
Sequence CAAAACCGCGAUUACUCUUGCA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr3:31593130|31593283 hsa-miR-548ay-3p 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr19:18307214|18307373 hsa-miR-548ay-3p 0 1 0
chr7:7877433|7877557 hsa-miR-548ay-3p 0 1 0
chr1:15931692|15932069 hsa-miR-548ay-3p 0 1 0
chr5:136063242|136063431 hsa-miR-548ay-3p 0 1 0
chr11:46672807|46673070 hsa-miR-548ay-3p 0 1 0
chr7:128256426|128256525 hsa-miR-548ay-3p 0 1 0
chr2:130347377|130347491 hsa-miR-548ay-3p 0 1 0
chr2:65022065|65022208 hsa-miR-548ay-3p 0 1 0
chr7:6028632|6028960 hsa-miR-548ay-3p 0 1 0
chr10:274792|274919 hsa-miR-548ay-3p 0 1 0
chr20:51261696|51261839 hsa-miR-548ay-3p 0 1 0
chr7:128256433|128256525 hsa-miR-548ay-3p 0 1 0
chr14:102048991~102049198 hsa-miR-548ay-3p 0 1 0
chr3:23208692~23208875 hsa-miR-548ay-3p 0 1 0
chr15:29700687~29700834 hsa-miR-548ay-3p 0 1 0
chr7:30160615~30160772 hsa-miR-548ay-3p 0 1 0
chr11:46672909~46672998 hsa-miR-548ay-3p 0 1 0
chr11:78210010~78210237 hsa-miR-548ay-3p 0 1 0
chr18:70293049|70293195 hsa-miR-548ay-3p 0 1 0
chrX:57596613|57596717 hsa-miR-548ay-3p 0 1 0
chr8:128092390|128092497 hsa-miR-548ay-3p 0 1 0
chr17:58270815|58271815 hsa-miR-548ay-3p 0 1 0
chrX:2338713|2338893 hsa-miR-548ay-3p 0 1 0
chr7:112203937|112204147 hsa-miR-548ay-3p 0 1 0
chr21:46284458|46284652 hsa-miR-548ay-3p 0 1 0
chr17:58270683|58279398 hsa-miR-548ay-3p 0 1 0
chr1:15928722|15928907 hsa-miR-548ay-3p 0 1 0
chr11:115209574|115209657 hsa-miR-548ay-3p 1 0 0
chr5:136063214|136063396 hsa-miR-548ay-3p 0 1 0
chr5:136063221|136063431 hsa-miR-548ay-3p 0 1 0
chr5:136063242|136063359 hsa-miR-548ay-3p 0 1 0
chr4:2835474|2835610 hsa-miR-548ay-3p 0 1 0
chr6:26545370|26545475 hsa-miR-548ay-3p 0 1 0
chr13:52414649|52414790 hsa-miR-548ay-3p 0 1 0
chr12:30754191|30754334 hsa-miR-548ay-3p 0 1 0
chr20:58438945|58441083 hsa-miR-548ay-3p 0 1 0
chr1:40067932|40068104 hsa-miR-548ay-3p 0 1 0
chr1:114732704|114733775 hsa-miR-548ay-3p 0 1 0
chr1:114732717|114733775 hsa-miR-548ay-3p 0 1 0
chr5:136063214|136063431 hsa-miR-548ay-3p 0 1 0
chr11:1260069|1260684 hsa-miR-548ay-3p 0 1 0
chr7:6028632|6028964 hsa-miR-548ay-3p 0 1 0
chr6:32901113|32901340 hsa-miR-548ay-3p 0 1 0
chr17:7931731|7932069 hsa-miR-548ay-3p 0 1 0
chr19:18307151|18307362 hsa-miR-548ay-3p 0 1 0
chr10:246439|246703 hsa-miR-548ay-3p 0 1 0
chr17:81029528|81029663 hsa-miR-548ay-3p 0 1 0
chr19:18307151|18307369 hsa-miR-548ay-3p 0 1 0
chr5:136063212|136063359 hsa-miR-548ay-3p 0 1 0
chr5:136063212|136063431 hsa-miR-548ay-3p 0 1 0
chr5:136063210|136063431 hsa-miR-548ay-3p 0 1 0
chr12:123597649|123597823 hsa-miR-548ay-3p 0 1 0
chr11:121632231|121632311 hsa-miR-548ay-3p 0 1 0
chr17:47118464|47118622 hsa-miR-548ay-3p 0 1 0
chr11:78079779|78079910 hsa-miR-548ay-3p 0 1 0
chr5:38480208|38480321 hsa-miR-548ay-3p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-548ay-3p ARL5B ADP ribosylation factor like GTPase 5B HGNC:23052 details
hsa-miR-548ay-3p SREK1IP1 SREK1 interacting protein 1 HGNC:26716 details
hsa-miR-548ay-3p CITED2 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2 HGNC:1987 details
hsa-miR-548ay-3p ZNF385A zinc finger protein 385A HGNC:17521 details
hsa-miR-548ay-3p YPEL2 yippee like 2 HGNC:18326 details
hsa-miR-548ay-3p SFT2D2 SFT2 domain containing 2 HGNC:25140 details
hsa-miR-548ay-3p FOXK1 forkhead box K1 HGNC:23480 details
hsa-miR-548ay-3p CTTN cortactin HGNC:3338 details
hsa-miR-548ay-3p HMGN2 high mobility group nucleosomal binding domain 2 HGNC:4986 details
hsa-miR-548ay-3p SLC38A9 solute carrier family 38 member 9 HGNC:26907 details
hsa-miR-548ay-3p CEP120 centrosomal protein 120 HGNC:26690 details
hsa-miR-548ay-3p TRIM24 tripartite motif containing 24 HGNC:11812 details
hsa-miR-548ay-3p CDK1 cyclin dependent kinase 1 HGNC:1722 details
hsa-miR-548ay-3p CHD4 chromodomain helicase DNA binding protein 4 HGNC:1919 details
hsa-miR-548ay-3p FBXL13 F-box and leucine rich repeat protein 13 HGNC:21658 details
hsa-miR-548ay-3p RNF11 ring finger protein 11 HGNC:10056 details
hsa-miR-548ay-3p MIER3 MIER family member 3 HGNC:26678 details
hsa-miR-548ay-3p MAT2A methionine adenosyltransferase 2A HGNC:6904 details
hsa-miR-548ay-3p KIF23 kinesin family member 23 HGNC:6392 details
hsa-miR-548ay-3p RPP14 ribonuclease P/MRP subunit p14 HGNC:30327 details
hsa-miR-548ay-3p COX6B1 cytochrome c oxidase subunit 6B1 HGNC:2280 details
hsa-miR-548ay-3p ID4 inhibitor of DNA binding 4, HLH protein HGNC:5363 details
hsa-miR-548ay-3p SKI SKI proto-oncogene HGNC:10896 details
hsa-miR-548ay-3p AJAP1 adherens junctions associated protein 1 HGNC:30801 details
hsa-miR-548ay-3p PNISR PNN interacting serine and arginine rich protein HGNC:21222 details
hsa-miR-548ay-3p PCGF2 polycomb group ring finger 2 HGNC:12929 details
hsa-miR-548ay-3p LRRC55 leucine rich repeat containing 55 HGNC:32324 details
hsa-miR-548ay-3p CDC5L cell division cycle 5 like HGNC:1743 details
hsa-miR-548ay-3p PPIA peptidylprolyl isomerase A HGNC:9253 details
hsa-miR-548ay-3p details
hsa-miR-548ay-3p ARHGAP15 Rho GTPase activating protein 15 HGNC:21030 details
hsa-miR-548ay-3p SMU1 SMU1 DNA replication regulator and spliceosomal factor HGNC:18247 details
hsa-miR-548ay-3p TBC1D22B TBC1 domain family member 22B HGNC:21602 details
hsa-miR-548ay-3p TOMM20 translocase of outer mitochondrial membrane 20 HGNC:20947 details
hsa-miR-548ay-3p EXOC8 exocyst complex component 8 HGNC:24659 details
hsa-miR-548ay-3p ZNF431 zinc finger protein 431 HGNC:20809 details
hsa-miR-548ay-3p KDR kinase insert domain receptor HGNC:6307 details
hsa-miR-548ay-3p KLF2 Kruppel like factor 2 HGNC:6347 details
hsa-miR-548ay-3p CBX7 chromobox 7 HGNC:1557 details
hsa-miR-548ay-3p TMX3 thioredoxin related transmembrane protein 3 HGNC:24718 details
hsa-miR-548ay-3p KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-548ay-3p ITPKB inositol-trisphosphate 3-kinase B HGNC:6179 details
hsa-miR-548ay-3p HNRNPD heterogeneous nuclear ribonucleoprotein D HGNC:5036 details
hsa-miR-548ay-3p ANGEL2 angel homolog 2 HGNC:30534 details
hsa-miR-548ay-3p STRN3 striatin 3 HGNC:15720 details
hsa-miR-548ay-3p HSBP1 heat shock factor binding protein 1 HGNC:5203 details
hsa-miR-548ay-3p TFAP2C transcription factor AP-2 gamma HGNC:11744 details
hsa-miR-548ay-3p ZNF681 zinc finger protein 681 HGNC:26457 details
hsa-miR-548ay-3p SPPL3 signal peptide peptidase like 3 HGNC:30424 details
hsa-miR-548ay-3p FEM1A fem-1 homolog A HGNC:16934 details
hsa-miR-548ay-3p TNRC6C trinucleotide repeat containing adaptor 6C HGNC:29318 details
hsa-miR-548ay-3p TAF13 TATA-box binding protein associated factor 13 HGNC:11546 details
hsa-miR-548ay-3p ROBO1 roundabout guidance receptor 1 HGNC:10249 details
hsa-miR-548ay-3p PURB purine rich element binding protein B HGNC:9702 details
hsa-miR-548ay-3p PLEKHA3 pleckstrin homology domain containing A3 HGNC:14338 details
hsa-miR-548ay-3p PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 HGNC:29149 details
hsa-miR-548ay-3p HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 HGNC:5031 details
hsa-miR-548ay-3p ETS2 ETS proto-oncogene 2, transcription factor HGNC:3489 details
hsa-miR-548ay-3p SON SON DNA and RNA binding protein HGNC:11183 details
hsa-miR-548ay-3p PRELID3B PRELI domain containing 3B HGNC:15892 details
hsa-miR-548ay-3p RREB1 ras responsive element binding protein 1 HGNC:10449 details
hsa-miR-548ay-3p MIDN midnolin HGNC:16298 details
hsa-miR-548ay-3p ANP32E acidic nuclear phosphoprotein 32 family member E HGNC:16673 details
hsa-miR-548ay-3p CADM2 cell adhesion molecule 2 HGNC:29849 details
hsa-miR-548ay-3p CDKN2AIP CDKN2A interacting protein HGNC:24325 details
hsa-miR-548ay-3p SLC24A4 solute carrier family 24 member 4 HGNC:10978 details
hsa-miR-548ay-3p CCDC117 coiled-coil domain containing 117 HGNC:26599 details
hsa-miR-548ay-3p details
hsa-miR-548ay-3p FMNL3 formin like 3 HGNC:23698 details
hsa-miR-548ay-3p AAGAB alpha and gamma adaptin binding protein HGNC:25662 details
hsa-miR-548ay-3p ZNF665 zinc finger protein 665 HGNC:25885 details
hsa-miR-548ay-3p CTNNA3 catenin alpha 3 HGNC:2511 details
hsa-miR-548ay-3p MYOZ3 myozenin 3 HGNC:18565 details
hsa-miR-548ay-3p ZADH2 zinc binding alcohol dehydrogenase domain containing 2 HGNC:28697 details
hsa-miR-548ay-3p XKR4 XK related 4 HGNC:29394 details
hsa-miR-548ay-3p MAP3K9 mitogen-activated protein kinase kinase kinase 9 HGNC:6861 details
hsa-miR-548ay-3p SNX2 sorting nexin 2 HGNC:11173 details
hsa-miR-548ay-3p GLRX2 glutaredoxin 2 HGNC:16065 details
hsa-miR-548ay-3p DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 HGNC:3093 details
hsa-miR-548ay-3p CDC6 cell division cycle 6 HGNC:1744 details
hsa-miR-548ay-3p PGM3 phosphoglucomutase 3 HGNC:8907 details
hsa-miR-548ay-3p GK5 glycerol kinase 5 HGNC:28635 details
hsa-miR-548ay-3p KLHL30 kelch like family member 30 HGNC:24770 details
hsa-miR-548ay-3p RWDD2A RWD domain containing 2A HGNC:21385 details
hsa-miR-548ay-3p PPP1CB protein phosphatase 1 catalytic subunit beta HGNC:9282 details
hsa-miR-548ay-3p IL6R interleukin 6 receptor HGNC:6019 details
hsa-miR-548ay-3p NCKAP1 NCK associated protein 1 HGNC:7666 details
hsa-miR-548ay-3p E2F6 E2F transcription factor 6 HGNC:3120 details
hsa-miR-548ay-3p OTULIN OTU deubiquitinase with linear linkage specificity HGNC:25118 details
hsa-miR-548ay-3p RIPPLY3 ripply transcriptional repressor 3 HGNC:3047 details
hsa-miR-548ay-3p SAMD5 sterile alpha motif domain containing 5 HGNC:21180 details
hsa-miR-548ay-3p AFF2 AF4/FMR2 family member 2 HGNC:3776 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab