miRNA Card

miRNA General Information
miRNA ID hsa-miR-548az-3p
Description Homo sapiens miR-548az stem-loop
Comment None
Experiment Illumina [1]
Sequence AAAAACUGCAAUCACUUUUGC
miRNA Expression in different cancers

    by mir_boxplot.py


circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr8:128092390|128092497 hsa-miR-548az-3p 1 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-548az-3p NDRG1 N-myc downstream regulated 1 HGNC:7679 details
hsa-miR-548az-3p ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like HGNC:22423 details
hsa-miR-548az-3p ILDR1 immunoglobulin like domain containing receptor 1 HGNC:28741 details
hsa-miR-548az-3p LRRC58 leucine rich repeat containing 58 HGNC:26968 details
hsa-miR-548az-3p INTS8 integrator complex subunit 8 HGNC:26048 details
hsa-miR-548az-3p details
hsa-miR-548az-3p PTCHD1 patched domain containing 1 HGNC:26392 details
hsa-miR-548az-3p HMGN4 high mobility group nucleosomal binding domain 4 HGNC:4989 details
hsa-miR-548az-3p ST6GAL2 ST6 beta-galactoside alpha-2,6-sialyltransferase 2 HGNC:10861 details
hsa-miR-548az-3p GRAMD1C GRAM domain containing 1C HGNC:25252 details
hsa-miR-548az-3p EML6 EMAP like 6 HGNC:35412 details
hsa-miR-548az-3p SNX1 sorting nexin 1 HGNC:11172 details
hsa-miR-548az-3p STK17A serine/threonine kinase 17a HGNC:11395 details
hsa-miR-548az-3p ABI2 abl interactor 2 HGNC:24011 details
hsa-miR-548az-3p ERP44 endoplasmic reticulum protein 44 HGNC:18311 details
hsa-miR-548az-3p ZNF774 zinc finger protein 774 HGNC:33108 details
hsa-miR-548az-3p FKBP1A FKBP prolyl isomerase 1A HGNC:3711 details
hsa-miR-548az-3p ZNF558 zinc finger protein 558 HGNC:26422 details
hsa-miR-548az-3p ZNF451 zinc finger protein 451 HGNC:21091 details
hsa-miR-548az-3p ZNF555 zinc finger protein 555 HGNC:28382 details
hsa-miR-548az-3p TRMT5 tRNA methyltransferase 5 HGNC:23141 details
hsa-miR-548az-3p ACTR2 actin related protein 2 HGNC:169 details
hsa-miR-548az-3p HMGN2 high mobility group nucleosomal binding domain 2 HGNC:4986 details
hsa-miR-548az-3p SKIL SKI like proto-oncogene HGNC:10897 details
hsa-miR-548az-3p POFUT1 protein O-fucosyltransferase 1 HGNC:14988 details
hsa-miR-548az-3p KANSL1 KAT8 regulatory NSL complex subunit 1 HGNC:24565 details
hsa-miR-548az-3p CFL2 cofilin 2 HGNC:1875 details
hsa-miR-548az-3p TERF2IP TERF2 interacting protein HGNC:19246 details
hsa-miR-548az-3p FEM1C fem-1 homolog C HGNC:16933 details
hsa-miR-548az-3p details
hsa-miR-548az-3p DIRAS2 DIRAS family GTPase 2 HGNC:19323 details
hsa-miR-548az-3p TMEM245 transmembrane protein 245 HGNC:1363 details
hsa-miR-548az-3p PRLR prolactin receptor HGNC:9446 details
hsa-miR-548az-3p ABCB7 ATP binding cassette subfamily B member 7 HGNC:48 details
hsa-miR-548az-3p ZBTB20 zinc finger and BTB domain containing 20 HGNC:13503 details
hsa-miR-548az-3p ACVR2B activin A receptor type 2B HGNC:174 details
hsa-miR-548az-3p MID1IP1 MID1 interacting protein 1 HGNC:20715 details
hsa-miR-548az-3p DDX3X DEAD-box helicase 3 X-linked HGNC:2745 details
hsa-miR-548az-3p SLC16A1 solute carrier family 16 member 1 HGNC:10922 details
hsa-miR-548az-3p PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 HGNC:8574 details
hsa-miR-548az-3p LMLN leishmanolysin like peptidase HGNC:15991 details
hsa-miR-548az-3p MRGBP MRG domain binding protein HGNC:15866 details
hsa-miR-548az-3p ARPP19 cAMP regulated phosphoprotein 19 HGNC:16967 details
hsa-miR-548az-3p ID4 inhibitor of DNA binding 4, HLH protein HGNC:5363 details
hsa-miR-548az-3p SCIN scinderin HGNC:21695 details
hsa-miR-548az-3p TRIM13 tripartite motif containing 13 HGNC:9976 details
hsa-miR-548az-3p SBNO1 strawberry notch homolog 1 HGNC:22973 details
hsa-miR-548az-3p LARP1 La ribonucleoprotein 1, translational regulator HGNC:29531 details
hsa-miR-548az-3p KLHL42 kelch like family member 42 HGNC:29252 details
hsa-miR-548az-3p ABHD13 abhydrolase domain containing 13 HGNC:20293 details
hsa-miR-548az-3p FRK fyn related Src family tyrosine kinase HGNC:3955 details
hsa-miR-548az-3p CD226 CD226 molecule HGNC:16961 details
hsa-miR-548az-3p FUNDC2 FUN14 domain containing 2 HGNC:24925 details
hsa-miR-548az-3p SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 HGNC:18398 details
hsa-miR-548az-3p ZNF81 zinc finger protein 81 HGNC:13156 details
hsa-miR-548az-3p TMLHE trimethyllysine hydroxylase, epsilon HGNC:18308 details
hsa-miR-548az-3p TNFRSF10D TNF receptor superfamily member 10d HGNC:11907 details
hsa-miR-548az-3p LDHD lactate dehydrogenase D HGNC:19708 details
hsa-miR-548az-3p WNK1 WNK lysine deficient protein kinase 1 HGNC:14540 details
hsa-miR-548az-3p TBL1XR1 TBL1X receptor 1 HGNC:29529 details
hsa-miR-548az-3p NLN neurolysin HGNC:16058 details
hsa-miR-548az-3p details
hsa-miR-548az-3p LEFTY1 left-right determination factor 1 HGNC:6552 details
hsa-miR-548az-3p DGKE diacylglycerol kinase epsilon HGNC:2852 details
hsa-miR-548az-3p DDX6 DEAD-box helicase 6 HGNC:2747 details
hsa-miR-548az-3p BMP2K BMP2 inducible kinase HGNC:18041 details
hsa-miR-548az-3p ARNTL aryl hydrocarbon receptor nuclear translocator like HGNC:701 details
hsa-miR-548az-3p details
hsa-miR-548az-3p DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 HGNC:24013 details
hsa-miR-548az-3p SPRY1 sprouty RTK signaling antagonist 1 HGNC:11269 details
hsa-miR-548az-3p GPC4 glypican 4 HGNC:4452 details
hsa-miR-548az-3p ZFP36L1 ZFP36 ring finger protein like 1 HGNC:1107 details
hsa-miR-548az-3p CYB5B cytochrome b5 type B HGNC:24374 details
hsa-miR-548az-3p PARP15 poly(ADP-ribose) polymerase family member 15 HGNC:26876 details
hsa-miR-548az-3p HHLA1 HERV-H LTR-associating 1 HGNC:4904 details
hsa-miR-548az-3p SLC16A9 solute carrier family 16 member 9 HGNC:23520 details
hsa-miR-548az-3p ESYT1 extended synaptotagmin 1 HGNC:29534 details
hsa-miR-548az-3p KLRC3 killer cell lectin like receptor C3 HGNC:6376 details
hsa-miR-548az-3p TTLL11 tubulin tyrosine ligase like 11 HGNC:18113 details
hsa-miR-548az-3p SPC25 SPC25 component of NDC80 kinetochore complex HGNC:24031 details
hsa-miR-548az-3p HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 HGNC:5194 details
hsa-miR-548az-3p XKR4 XK related 4 HGNC:29394 details
hsa-miR-548az-3p VEZF1 vascular endothelial zinc finger 1 HGNC:12949 details
hsa-miR-548az-3p RNPS1 RNA binding protein with serine rich domain 1 HGNC:10080 details
hsa-miR-548az-3p PURB purine rich element binding protein B HGNC:9702 details
hsa-miR-548az-3p FJX1 four-jointed box kinase 1 HGNC:17166 details
hsa-miR-548az-3p DYNC1LI2 dynein cytoplasmic 1 light intermediate chain 2 HGNC:2966 details
hsa-miR-548az-3p CCNT2 cyclin T2 HGNC:1600 details
hsa-miR-548az-3p MED10 mediator complex subunit 10 HGNC:28760 details
hsa-miR-548az-3p STARD3NL STARD3 N-terminal like HGNC:19169 details
hsa-miR-548az-3p SLX4 SLX4 structure-specific endonuclease subunit HGNC:23845 details
hsa-miR-548az-3p RAB33B RAB33B, member RAS oncogene family HGNC:16075 details
hsa-miR-548az-3p PNRC2 proline rich nuclear receptor coactivator 2 HGNC:23158 details
hsa-miR-548az-3p PHF12 PHD finger protein 12 HGNC:20816 details
hsa-miR-548az-3p JMY junction mediating and regulatory protein, p53 cofactor HGNC:28916 details
hsa-miR-548az-3p GJD3 gap junction protein delta 3 HGNC:19147 details
hsa-miR-548az-3p details
hsa-miR-548az-3p CDCA4 cell division cycle associated 4 HGNC:14625 details
hsa-miR-548az-3p CALM1 calmodulin 1 HGNC:1442 details
hsa-miR-548az-3p ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 HGNC:14573 details
hsa-miR-548az-3p RPLP0 ribosomal protein lateral stalk subunit P0 HGNC:10371 details
hsa-miR-548az-3p RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 HGNC:14436 details
hsa-miR-548az-3p DEPDC1B DEP domain containing 1B HGNC:24902 details
hsa-miR-548az-3p SOX4 SRY-box transcription factor 4 HGNC:11200 details
hsa-miR-548az-3p SCML2 Scm polycomb group protein like 2 HGNC:10581 details
hsa-miR-548az-3p IGFBP5 insulin like growth factor binding protein 5 HGNC:5474 details
hsa-miR-548az-3p ABT1 activator of basal transcription 1 HGNC:17369 details
hsa-miR-548az-3p ZBTB46 zinc finger and BTB domain containing 46 HGNC:16094 details
hsa-miR-548az-3p KHSRP KH-type splicing regulatory protein HGNC:6316 details
hsa-miR-548az-3p DDX21 DExD-box helicase 21 HGNC:2744 details
hsa-miR-548az-3p RPS16 ribosomal protein S16 HGNC:10396 details
hsa-miR-548az-3p ZRANB1 zinc finger RANBP2-type containing 1 HGNC:18224 details
hsa-miR-548az-3p NHSL1 NHS like 1 HGNC:21021 details
hsa-miR-548az-3p RSF1 remodeling and spacing factor 1 HGNC:18118 details
hsa-miR-548az-3p CLOCK clock circadian regulator HGNC:2082 details
hsa-miR-548az-3p GRK4 G protein-coupled receptor kinase 4 HGNC:4543 details
hsa-miR-548az-3p details
hsa-miR-548az-3p PCK1 phosphoenolpyruvate carboxykinase 1 HGNC:8724 details
hsa-miR-548az-3p TNPO2 transportin 2 HGNC:19998 details
hsa-miR-548az-3p ZNF652 zinc finger protein 652 HGNC:29147 details
hsa-miR-548az-3p IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 HGNC:28866 details
hsa-miR-548az-3p CRLS1 cardiolipin synthase 1 HGNC:16148 details
hsa-miR-548az-3p TTC26 tetratricopeptide repeat domain 26 HGNC:21882 details
hsa-miR-548az-3p PITPNB phosphatidylinositol transfer protein beta HGNC:9002 details
hsa-miR-548az-3p CLUAP1 clusterin associated protein 1 HGNC:19009 details
hsa-miR-548az-3p NCK1 NCK adaptor protein 1 HGNC:7664 details
hsa-miR-548az-3p ZNF566 zinc finger protein 566 HGNC:25919 details
hsa-miR-548az-3p LIPG lipase G, endothelial type HGNC:6623 details
hsa-miR-548az-3p ZNF280B zinc finger protein 280B HGNC:23022 details
hsa-miR-548az-3p PTAR1 protein prenyltransferase alpha subunit repeat containing 1 HGNC:30449 details
hsa-miR-548az-3p LRRC15 leucine rich repeat containing 15 HGNC:20818 details
hsa-miR-548az-3p APP amyloid beta precursor protein HGNC:620 details
hsa-miR-548az-3p AFAP1 actin filament associated protein 1 HGNC:24017 details
hsa-miR-548az-3p ATP6V1G3 ATPase H+ transporting V1 subunit G3 HGNC:18265 details
hsa-miR-548az-3p SPATS2L spermatogenesis associated serine rich 2 like HGNC:24574 details
hsa-miR-548az-3p SHMT1 serine hydroxymethyltransferase 1 HGNC:10850 details
hsa-miR-548az-3p NT5DC3 5'-nucleotidase domain containing 3 HGNC:30826 details
hsa-miR-548az-3p SPPL2A signal peptide peptidase like 2A HGNC:30227 details
hsa-miR-548az-3p LNPK lunapark, ER junction formation factor HGNC:21610 details
hsa-miR-548az-3p PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma HGNC:8978 details
hsa-miR-548az-3p KRT80 keratin 80 HGNC:27056 details
hsa-miR-548az-3p KCNK6 potassium two pore domain channel subfamily K member 6 HGNC:6281 details
hsa-miR-548az-3p CERK ceramide kinase HGNC:19256 details
hsa-miR-548az-3p UBL3 ubiquitin like 3 HGNC:12504 details
hsa-miR-548az-3p RAP2B RAP2B, member of RAS oncogene family HGNC:9862 details
hsa-miR-548az-3p INSIG1 insulin induced gene 1 HGNC:6083 details
hsa-miR-548az-3p AVL9 AVL9 cell migration associated HGNC:28994 details
hsa-miR-548az-3p ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 HGNC:812 details
hsa-miR-548az-3p MRPS10 mitochondrial ribosomal protein S10 HGNC:14502 details
hsa-miR-548az-3p MLLT1 MLLT1 super elongation complex subunit HGNC:7134 details
hsa-miR-548az-3p SUCO SUN domain containing ossification factor HGNC:1240 details
hsa-miR-548az-3p SKA2 spindle and kinetochore associated complex subunit 2 HGNC:28006 details
hsa-miR-548az-3p KCNS2 potassium voltage-gated channel modifier subfamily S member 2 HGNC:6301 details
hsa-miR-548az-3p PECR peroxisomal trans-2-enoyl-CoA reductase HGNC:18281 details
hsa-miR-548az-3p CKS2 CDC28 protein kinase regulatory subunit 2 HGNC:2000 details
hsa-miR-548az-3p DDR2 discoidin domain receptor tyrosine kinase 2 HGNC:2731 details
hsa-miR-548az-3p DNAJB14 DnaJ heat shock protein family (Hsp40) member B14 HGNC:25881 details
hsa-miR-548az-3p GOT1 glutamic-oxaloacetic transaminase 1 HGNC:4432 details
hsa-miR-548az-3p HMGB1 high mobility group box 1 HGNC:4983 details
hsa-miR-548az-3p STK4 serine/threonine kinase 4 HGNC:11408 details
hsa-miR-548az-3p TUBB2A tubulin beta 2A class IIa HGNC:12412 details
hsa-miR-548az-3p KCTD21 potassium channel tetramerization domain containing 21 HGNC:27452 details
hsa-miR-548az-3p MRPS21 mitochondrial ribosomal protein S21 HGNC:14046 details
hsa-miR-548az-3p NEK3 NIMA related kinase 3 HGNC:7746 details
hsa-miR-548az-3p TPRG1L tumor protein p63 regulated 1 like HGNC:27007 details
hsa-miR-548az-3p details
hsa-miR-548az-3p MAPKAPK5 MAPK activated protein kinase 5 HGNC:6889 details