miRNA Card

miRNA General Information
miRNA ID hsa-miR-548h-3p
Description Homo sapiens miR-548h-4 stem-loop
Comment None
Experiment
Sequence CAAAAACCGCAAUUACUUUUGCA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr18:70293049|70293195 hsa-miR-548h-3p 1 1 0
chr3:31593130|31593283 hsa-miR-548h-3p 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr2:147930096|147930287 hsa-miR-548h-3p 0 1 0
chr7:99968430|99968665 hsa-miR-548h-3p 0 1 0
chr11:18269739|18269928 hsa-miR-548h-3p 0 1 0
chr11:18269763|18269928 hsa-miR-548h-3p 0 1 0
chr11:18269801|18269928 hsa-miR-548h-3p 0 1 0
chr1:151248904|151249089 hsa-miR-548h-3p 0 1 0
chr10:97357016|97357196 hsa-miR-548h-3p 0 1 0
chr1:207794423|207794749 hsa-miR-548h-3p 0 1 0
chr6:7882432|7882659 hsa-miR-548h-3p 0 1 0
chr21:36375855|36375967 hsa-miR-548h-3p 0 1 0
chr6:7882538|7882659 hsa-miR-548h-3p 0 1 0
chr8:118110278|118110364 hsa-miR-548h-3p 0 1 0
chr8:46155644|46155815 hsa-miR-548h-3p 0 1 0
chr4:867173|867361 hsa-miR-548h-3p 0 1 0
chr15:73304115~73304334 hsa-miR-548h-3p 0 1 0
chr22:50625405~50625645 hsa-miR-548h-3p 0 1 0
chr19:1272623~1272878 hsa-miR-548h-3p 0 1 0
chr11:18269726|18269928 hsa-miR-548h-3p 0 1 0
chr11:78210010~78210237 hsa-miR-548h-3p 0 1 0
chr10:73553597|73553794 hsa-miR-548h-3p 0 1 0
chr8:128092390|128092497 hsa-miR-548h-3p 0 1 0
chr2:113957552|113957704 hsa-miR-548h-3p 0 1 0
chr9:34436803|34436965 hsa-miR-548h-3p 0 1 0
chr1:15928722|15928907 hsa-miR-548h-3p 0 1 0
chr1:19339262|19339360 hsa-miR-548h-3p 0 1 0
chr2:99394296|99394557 hsa-miR-548h-3p 0 1 0
chr6:7882538|7882652 hsa-miR-548h-3p 0 1 0
chr1:19339254|19339417 hsa-miR-548h-3p 0 1 0
chr4:867101|867289 hsa-miR-548h-3p 0 1 0
chr22:21002391|21002545 hsa-miR-548h-3p 0 1 0
chr5:176347050|176347232 hsa-miR-548h-3p 0 1 0
chr17:1678762|1679130 hsa-miR-548h-3p 0 1 0
chr18:9536163|9536379 hsa-miR-548h-3p 0 1 0
chr2:200419250|200419496 hsa-miR-548h-3p 0 1 0
chr5:58970987|58971115 hsa-miR-548h-3p 0 1 0
chr3:47586528|47586637 hsa-miR-548h-3p 0 1 0
chr11:68613458|68613602 hsa-miR-548h-3p 0 1 0
chr1:207794419|207794531 hsa-miR-548h-3p 2 1 0
chr1:9268852|9269108 hsa-miR-548h-3p 0 1 0
chr14:102033976|102034157 hsa-miR-548h-3p 0 1 0
chr15:43386206|43386300 hsa-miR-548h-3p 0 1 0
chr8:140532101|140532465 hsa-miR-548h-3p 0 1 0
chr1:16396641|16396726 hsa-miR-548h-3p 0 1 0
chr14:55065314|55065570 hsa-miR-548h-3p 0 1 0
chr5:176347042|176347189 hsa-miR-548h-3p 0 1 0
chr12:123597649|123597823 hsa-miR-548h-3p 0 1 0
chr12:55994459|55994657 hsa-miR-548h-3p 0 1 0
chr1:19339254|19339360 hsa-miR-548h-3p 0 1 0
chr10:246439|246703 hsa-miR-548h-3p 0 1 0
chr19:41683983|41684054 hsa-miR-548h-3p 0 1 0
chr6:31640873|31641190 hsa-miR-548h-3p 0 1 0
chr17:47118464|47118622 hsa-miR-548h-3p 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-548h-3p TMEM158 transmembrane protein 158 HGNC:30293 details
hsa-miR-548h-3p HMX3 H6 family homeobox 3 HGNC:5019 details
hsa-miR-548h-3p FRMD5 FERM domain containing 5 HGNC:28214 details
hsa-miR-548h-3p PTPRG protein tyrosine phosphatase receptor type G HGNC:9671 details
hsa-miR-548h-3p HSBP1 heat shock factor binding protein 1 HGNC:5203 details
hsa-miR-548h-3p EXD2 exonuclease 3'-5' domain containing 2 HGNC:20217 details
hsa-miR-548h-3p TNFSF15 TNF superfamily member 15 HGNC:11931 details
hsa-miR-548h-3p CD1D CD1d molecule HGNC:1637 details
hsa-miR-548h-3p RABIF RAB interacting factor HGNC:9797 details
hsa-miR-548h-3p ACSL3 acyl-CoA synthetase long chain family member 3 HGNC:3570 details
hsa-miR-548h-3p ABHD2 abhydrolase domain containing 2, acylglycerol lipase HGNC:18717 details
hsa-miR-548h-3p details
hsa-miR-548h-3p TMCC3 transmembrane and coiled-coil domain family 3 HGNC:29199 details
hsa-miR-548h-3p P2RY10 P2Y receptor family member 10 HGNC:19906 details
hsa-miR-548h-3p ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 HGNC:221 details
hsa-miR-548h-3p PALM2 paralemmin 2 HGNC:15845 details
hsa-miR-548h-3p IMP3 IMP U3 small nucleolar ribonucleoprotein 3 HGNC:14497 details
hsa-miR-548h-3p GABRB3 gamma-aminobutyric acid type A receptor subunit beta3 HGNC:4083 details
hsa-miR-548h-3p ZNF101 zinc finger protein 101 HGNC:12881 details
hsa-miR-548h-3p GRK2 G protein-coupled receptor kinase 2 HGNC:289 details
hsa-miR-548h-3p NUDT19 nudix hydrolase 19 HGNC:32036 details
hsa-miR-548h-3p UGCG UDP-glucose ceramide glucosyltransferase HGNC:12524 details
hsa-miR-548h-3p TSC22D2 TSC22 domain family member 2 HGNC:29095 details
hsa-miR-548h-3p TM9SF3 transmembrane 9 superfamily member 3 HGNC:21529 details
hsa-miR-548h-3p SUZ12 SUZ12 polycomb repressive complex 2 subunit HGNC:17101 details
hsa-miR-548h-3p SKIL SKI like proto-oncogene HGNC:10897 details
hsa-miR-548h-3p SDC4 syndecan 4 HGNC:10661 details
hsa-miR-548h-3p RHOB ras homolog family member B HGNC:668 details
hsa-miR-548h-3p POLR2D RNA polymerase II subunit D HGNC:9191 details
hsa-miR-548h-3p POGK pogo transposable element derived with KRAB domain HGNC:18800 details
hsa-miR-548h-3p PDIA6 protein disulfide isomerase family A member 6 HGNC:30168 details
hsa-miR-548h-3p PDE4D phosphodiesterase 4D HGNC:8783 details
hsa-miR-548h-3p NR2F2 nuclear receptor subfamily 2 group F member 2 HGNC:7976 details
hsa-miR-548h-3p NEK7 NIMA related kinase 7 HGNC:13386 details
hsa-miR-548h-3p M6PR mannose-6-phosphate receptor, cation dependent HGNC:6752 details
hsa-miR-548h-3p KANSL1 KAT8 regulatory NSL complex subunit 1 HGNC:24565 details
hsa-miR-548h-3p CDKN1B cyclin dependent kinase inhibitor 1B HGNC:1785 details
hsa-miR-548h-3p details
hsa-miR-548h-3p AR androgen receptor HGNC:644 details
hsa-miR-548h-3p AKAP11 A-kinase anchoring protein 11 HGNC:369 details
hsa-miR-548h-3p ACTB actin beta HGNC:132 details
hsa-miR-548h-3p ABCE1 ATP binding cassette subfamily E member 1 HGNC:69 details
hsa-miR-548h-3p INHBA inhibin subunit beta A HGNC:6066 details
hsa-miR-548h-3p IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-548h-3p ANKEF1 ankyrin repeat and EF-hand domain containing 1 HGNC:15803 details
hsa-miR-548h-3p YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta HGNC:12855 details
hsa-miR-548h-3p SOX4 SRY-box transcription factor 4 HGNC:11200 details
hsa-miR-548h-3p ARNTL aryl hydrocarbon receptor nuclear translocator like HGNC:701 details
hsa-miR-548h-3p SF1 splicing factor 1 HGNC:12950 details
hsa-miR-548h-3p HSPA1B heat shock protein family A (Hsp70) member 1B HGNC:5233 details
hsa-miR-548h-3p CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 HGNC:3230 details
hsa-miR-548h-3p CDC37L1 cell division cycle 37 like 1 HGNC:17179 details
hsa-miR-548h-3p FBXL13 F-box and leucine rich repeat protein 13 HGNC:21658 details
hsa-miR-548h-3p MYO6 myosin VI HGNC:7605 details
hsa-miR-548h-3p MC2R melanocortin 2 receptor HGNC:6930 details
hsa-miR-548h-3p PURA purine rich element binding protein A HGNC:9701 details
hsa-miR-548h-3p NHLRC3 NHL repeat containing 3 HGNC:33751 details
hsa-miR-548h-3p BCAT1 branched chain amino acid transaminase 1 HGNC:976 details
hsa-miR-548h-3p YES1 YES proto-oncogene 1, Src family tyrosine kinase HGNC:12841 details
hsa-miR-548h-3p MRGBP MRG domain binding protein HGNC:15866 details
hsa-miR-548h-3p HMGN2 high mobility group nucleosomal binding domain 2 HGNC:4986 details
hsa-miR-548h-3p AMER1 APC membrane recruitment protein 1 HGNC:26837 details
hsa-miR-548h-3p ID4 inhibitor of DNA binding 4, HLH protein HGNC:5363 details
hsa-miR-548h-3p XRCC3 X-ray repair cross complementing 3 HGNC:12830 details
hsa-miR-548h-3p MYBPC1 myosin binding protein C1 HGNC:7549 details
hsa-miR-548h-3p SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase HGNC:25016 details
hsa-miR-548h-3p UBE2D1 ubiquitin conjugating enzyme E2 D1 HGNC:12474 details
hsa-miR-548h-3p PSMA2 proteasome 20S subunit alpha 2 HGNC:9531 details
hsa-miR-548h-3p PPP3R1 protein phosphatase 3 regulatory subunit B, alpha HGNC:9317 details
hsa-miR-548h-3p MBNL3 muscleblind like splicing regulator 3 HGNC:20564 details
hsa-miR-548h-3p LRRC55 leucine rich repeat containing 55 HGNC:32324 details
hsa-miR-548h-3p SYNM synemin HGNC:24466 details
hsa-miR-548h-3p PPIA peptidylprolyl isomerase A HGNC:9253 details
hsa-miR-548h-3p CLASP1 cytoplasmic linker associated protein 1 HGNC:17088 details
hsa-miR-548h-3p FBLN2 fibulin 2 HGNC:3601 details
hsa-miR-548h-3p MGARP mitochondria localized glutamic acid rich protein HGNC:29969 details
hsa-miR-548h-3p SMU1 SMU1 DNA replication regulator and spliceosomal factor HGNC:18247 details
hsa-miR-548h-3p COL4A3 collagen type IV alpha 3 chain HGNC:2204 details
hsa-miR-548h-3p TBC1D22B TBC1 domain family member 22B HGNC:21602 details
hsa-miR-548h-3p TOMM20 translocase of outer mitochondrial membrane 20 HGNC:20947 details
hsa-miR-548h-3p ZNF100 zinc finger protein 100 HGNC:12880 details
hsa-miR-548h-3p ATRNL1 attractin like 1 HGNC:29063 details
hsa-miR-548h-3p PDE5A phosphodiesterase 5A HGNC:8784 details
hsa-miR-548h-3p SEL1L SEL1L adaptor subunit of ERAD E3 ubiquitin ligase HGNC:10717 details
hsa-miR-548h-3p MKRN3 makorin ring finger protein 3 HGNC:7114 details
hsa-miR-548h-3p TMEM18 transmembrane protein 18 HGNC:25257 details
hsa-miR-548h-3p WDR13 WD repeat domain 13 HGNC:14352 details
hsa-miR-548h-3p VKORC1L1 vitamin K epoxide reductase complex subunit 1 like 1 HGNC:21492 details
hsa-miR-548h-3p RNF20 ring finger protein 20 HGNC:10062 details
hsa-miR-548h-3p RAB33B RAB33B, member RAS oncogene family HGNC:16075 details
hsa-miR-548h-3p FAM169A family with sequence similarity 169 member A HGNC:29138 details
hsa-miR-548h-3p CABLES1 Cdk5 and Abl enzyme substrate 1 HGNC:25097 details
hsa-miR-548h-3p ARL10 ADP ribosylation factor like GTPase 10 HGNC:22042 details
hsa-miR-548h-3p SLC25A43 solute carrier family 25 member 43 HGNC:30557 details
hsa-miR-548h-3p CDC27 cell division cycle 27 HGNC:1728 details
hsa-miR-548h-3p details
hsa-miR-548h-3p ZNF829 zinc finger protein 829 HGNC:34032 details
hsa-miR-548h-3p MFAP3 microfibril associated protein 3 HGNC:7034 details
hsa-miR-548h-3p YY2 YY2 transcription factor HGNC:31684 details
hsa-miR-548h-3p SNCB synuclein beta HGNC:11140 details
hsa-miR-548h-3p SPC25 SPC25 component of NDC80 kinetochore complex HGNC:24031 details
hsa-miR-548h-3p VEZF1 vascular endothelial zinc finger 1 HGNC:12949 details
hsa-miR-548h-3p STRN3 striatin 3 HGNC:15720 details
hsa-miR-548h-3p DCUN1D3 defective in cullin neddylation 1 domain containing 3 HGNC:28734 details
hsa-miR-548h-3p DAZAP1 DAZ associated protein 1 HGNC:2683 details
hsa-miR-548h-3p CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 HGNC:1775 details
hsa-miR-548h-3p ZNF681 zinc finger protein 681 HGNC:26457 details
hsa-miR-548h-3p SLC29A1 solute carrier family 29 member 1 (Augustine blood group) HGNC:11003 details
hsa-miR-548h-3p LLGL2 LLGL scribble cell polarity complex component 2 HGNC:6629 details
hsa-miR-548h-3p SPPL3 signal peptide peptidase like 3 HGNC:30424 details
hsa-miR-548h-3p HDGFL2 HDGF like 2 HGNC:14680 details
hsa-miR-548h-3p ALG1 ALG1 chitobiosyldiphosphodolichol beta-mannosyltransferase HGNC:18294 details
hsa-miR-548h-3p YAF2 YY1 associated factor 2 HGNC:17363 details
hsa-miR-548h-3p TVP23C trans-golgi network vesicle protein 23 homolog C HGNC:30453 details
hsa-miR-548h-3p TSPAN3 tetraspanin 3 HGNC:17752 details
hsa-miR-548h-3p NPM3 nucleophosmin/nucleoplasmin 3 HGNC:7931 details
hsa-miR-548h-3p SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein HGNC:16918 details
hsa-miR-548h-3p RECK reversion inducing cysteine rich protein with kazal motifs HGNC:11345 details
hsa-miR-548h-3p MTF2 metal response element binding transcription factor 2 HGNC:29535 details
hsa-miR-548h-3p LEPROT leptin receptor overlapping transcript HGNC:29477 details
hsa-miR-548h-3p ITGA2 integrin subunit alpha 2 HGNC:6137 details
hsa-miR-548h-3p CNIH1 cornichon family AMPA receptor auxiliary protein 1 HGNC:19431 details
hsa-miR-548h-3p details
hsa-miR-548h-3p C18orf25 chromosome 18 open reading frame 25 HGNC:28172 details
hsa-miR-548h-3p ARF1 ADP ribosylation factor 1 HGNC:652 details
hsa-miR-548h-3p GSKIP GSK3B interacting protein HGNC:20343 details
hsa-miR-548h-3p GAL3ST3 galactose-3-O-sulfotransferase 3 HGNC:24144 details
hsa-miR-548h-3p SKI SKI proto-oncogene HGNC:10896 details
hsa-miR-548h-3p RBPJ recombination signal binding protein for immunoglobulin kappa J region HGNC:5724 details
hsa-miR-548h-3p GRB2 growth factor receptor bound protein 2 HGNC:4566 details
hsa-miR-548h-3p EIF2S2 eukaryotic translation initiation factor 2 subunit beta HGNC:3266 details
hsa-miR-548h-3p ARID1A AT-rich interaction domain 1A HGNC:11110 details
hsa-miR-548h-3p ZNF678 zinc finger protein 678 HGNC:28652 details
hsa-miR-548h-3p DEPDC1B DEP domain containing 1B HGNC:24902 details
hsa-miR-548h-3p TRA2B transformer 2 beta homolog HGNC:10781 details
hsa-miR-548h-3p TMEM64 transmembrane protein 64 HGNC:25441 details
hsa-miR-548h-3p RMND5A required for meiotic nuclear division 5 homolog A HGNC:25850 details
hsa-miR-548h-3p RFX1 regulatory factor X1 HGNC:9982 details
hsa-miR-548h-3p MTMR3 myotubularin related protein 3 HGNC:7451 details
hsa-miR-548h-3p GRPEL2 GrpE like 2, mitochondrial HGNC:21060 details
hsa-miR-548h-3p CELF2 CUGBP Elav-like family member 2 HGNC:2550 details
hsa-miR-548h-3p CBX3 chromobox 3 HGNC:1553 details
hsa-miR-548h-3p ATF7IP activating transcription factor 7 interacting protein HGNC:20092 details
hsa-miR-548h-3p MYBL1 MYB proto-oncogene like 1 HGNC:7547 details
hsa-miR-548h-3p THYN1 thymocyte nuclear protein 1 HGNC:29560 details
hsa-miR-548h-3p MPZL1 myelin protein zero like 1 HGNC:7226 details
hsa-miR-548h-3p PHF19 PHD finger protein 19 HGNC:24566 details
hsa-miR-548h-3p HOXA9 homeobox A9 HGNC:5109 details
hsa-miR-548h-3p CELF1 CUGBP Elav-like family member 1 HGNC:2549 details
hsa-miR-548h-3p ACOT9 acyl-CoA thioesterase 9 HGNC:17152 details
hsa-miR-548h-3p KHSRP KH-type splicing regulatory protein HGNC:6316 details
hsa-miR-548h-3p VPS50 VPS50 subunit of EARP/GARPII complex HGNC:25956 details
hsa-miR-548h-3p CMTM6 CKLF like MARVEL transmembrane domain containing 6 HGNC:19177 details
hsa-miR-548h-3p PSAT1 phosphoserine aminotransferase 1 HGNC:19129 details
hsa-miR-548h-3p NRBF2 nuclear receptor binding factor 2 HGNC:19692 details
hsa-miR-548h-3p H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase HGNC:4795 details
hsa-miR-548h-3p NKTR natural killer cell triggering receptor HGNC:7833 details
hsa-miR-548h-3p ATP9A ATPase phospholipid transporting 9A (putative) HGNC:13540 details
hsa-miR-548h-3p details
hsa-miR-548h-3p TCEAL4 transcription elongation factor A like 4 HGNC:26121 details
hsa-miR-548h-3p details
hsa-miR-548h-3p SYT2 synaptotagmin 2 HGNC:11510 details
hsa-miR-548h-3p NAV2 neuron navigator 2 HGNC:15997 details
hsa-miR-548h-3p SGO2 shugoshin 2 HGNC:30812 details
hsa-miR-548h-3p details
hsa-miR-548h-3p KCNK10 potassium two pore domain channel subfamily K member 10 HGNC:6273 details
hsa-miR-548h-3p SLC2A4 solute carrier family 2 member 4 HGNC:11009 details
hsa-miR-548h-3p HIPK3 homeodomain interacting protein kinase 3 HGNC:4915 details
hsa-miR-548h-3p EDIL3 EGF like repeats and discoidin domains 3 HGNC:3173 details
hsa-miR-548h-3p RPL3L ribosomal protein L3 like HGNC:10351 details
hsa-miR-548h-3p TRPC3 transient receptor potential cation channel subfamily C member 3 HGNC:12335 details
hsa-miR-548h-3p PCNX2 pecanex 2 HGNC:8736 details
hsa-miR-548h-3p TRIB2 tribbles pseudokinase 2 HGNC:30809 details
hsa-miR-548h-3p LSM14A LSM14A mRNA processing body assembly factor HGNC:24489 details
hsa-miR-548h-3p INO80C INO80 complex subunit C HGNC:26994 details
hsa-miR-548h-3p AMPD3 adenosine monophosphate deaminase 3 HGNC:470 details
hsa-miR-548h-3p MMS22L MMS22 like, DNA repair protein HGNC:21475 details
hsa-miR-548h-3p BRD4 bromodomain containing 4 HGNC:13575 details
hsa-miR-548h-3p PTPN11 protein tyrosine phosphatase non-receptor type 11 HGNC:9644 details
hsa-miR-548h-3p GDPGP1 GDP-D-glucose phosphorylase 1 HGNC:34360 details
hsa-miR-548h-3p ESR1 estrogen receptor 1 HGNC:3467 details
hsa-miR-548h-3p CD59 CD59 molecule (CD59 blood group) HGNC:1689 details
hsa-miR-548h-3p ALYREF Aly/REF export factor HGNC:19071 details
hsa-miR-548h-3p RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 HGNC:14436 details
hsa-miR-548h-3p CFAP65 cilia and flagella associated protein 65 HGNC:25325 details
hsa-miR-548h-3p CCR5 C-C motif chemokine receptor 5 HGNC:1606 details
hsa-miR-548h-3p TXNL1 thioredoxin like 1 HGNC:12436 details
hsa-miR-548h-3p UBE2V1 ubiquitin conjugating enzyme E2 V1 HGNC:12494 details
hsa-miR-548h-3p SLC25A51 solute carrier family 25 member 51 HGNC:23323 details
hsa-miR-548h-3p SALL1 spalt like transcription factor 1 HGNC:10524 details
hsa-miR-548h-3p RRAGC Ras related GTP binding C HGNC:19902 details
hsa-miR-548h-3p RC3H1 ring finger and CCCH-type domains 1 HGNC:29434 details
hsa-miR-548h-3p NRXN1 neurexin 1 HGNC:8008 details
hsa-miR-548h-3p MAX MYC associated factor X HGNC:6913 details
hsa-miR-548h-3p LUC7L2 LUC7 like 2, pre-mRNA splicing factor HGNC:21608 details
hsa-miR-548h-3p HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 HGNC:5031 details
hsa-miR-548h-3p FMNL3 formin like 3 HGNC:23698 details
hsa-miR-548h-3p details
hsa-miR-548h-3p details
hsa-miR-548h-3p ARID4A AT-rich interaction domain 4A HGNC:9885 details
hsa-miR-548h-3p ANGPTL2 angiopoietin like 2 HGNC:490 details
hsa-miR-548h-3p details
hsa-miR-548h-3p RNF2 ring finger protein 2 HGNC:10061 details
hsa-miR-548h-3p USF3 upstream transcription factor family member 3 HGNC:30494 details
hsa-miR-548h-3p AP3B1 adaptor related protein complex 3 subunit beta 1 HGNC:566 details
hsa-miR-548h-3p ZNF652 zinc finger protein 652 HGNC:29147 details
hsa-miR-548h-3p SFT2D2 SFT2 domain containing 2 HGNC:25140 details
hsa-miR-548h-3p RAP2B RAP2B, member of RAS oncogene family HGNC:9862 details
hsa-miR-548h-3p PTEN phosphatase and tensin homolog HGNC:9588 details
hsa-miR-548h-3p PRR3 proline rich 3 HGNC:21149 details
hsa-miR-548h-3p UNC93A unc-93 homolog A HGNC:12570 details
hsa-miR-548h-3p TNPO1 transportin 1 HGNC:6401 details
hsa-miR-548h-3p NOP53 NOP53 ribosome biogenesis factor HGNC:4333 details
hsa-miR-548h-3p SERBP1 SERPINE1 mRNA binding protein 1 HGNC:17860 details
hsa-miR-548h-3p PNRC1 proline rich nuclear receptor coactivator 1 HGNC:17278 details
hsa-miR-548h-3p TCF24 transcription factor 24 HGNC:32275 details
hsa-miR-548h-3p PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 HGNC:15882 details
hsa-miR-548h-3p C4orf3 chromosome 4 open reading frame 3 HGNC:19225 details
hsa-miR-548h-3p GIN1 gypsy retrotransposon integrase 1 HGNC:25959 details
hsa-miR-548h-3p VDR vitamin D receptor HGNC:12679 details
hsa-miR-548h-3p STEAP4 STEAP4 metalloreductase HGNC:21923 details
hsa-miR-548h-3p B3GALNT1 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) HGNC:918 details
hsa-miR-548h-3p TNFRSF13C TNF receptor superfamily member 13C HGNC:17755 details
hsa-miR-548h-3p ZCCHC9 zinc finger CCHC-type containing 9 HGNC:25424 details
hsa-miR-548h-3p UFM1 ubiquitin fold modifier 1 HGNC:20597 details
hsa-miR-548h-3p CLNK cytokine dependent hematopoietic cell linker HGNC:17438 details
hsa-miR-548h-3p ZNF518B zinc finger protein 518B HGNC:29365 details
hsa-miR-548h-3p SLC30A1 solute carrier family 30 member 1 HGNC:11012 details
hsa-miR-548h-3p SIX4 SIX homeobox 4 HGNC:10890 details
hsa-miR-548h-3p LCOR ligand dependent nuclear receptor corepressor HGNC:29503 details
hsa-miR-548h-3p details
hsa-miR-548h-3p KDM5A lysine demethylase 5A HGNC:9886 details
hsa-miR-548h-3p TOR1AIP2 torsin 1A interacting protein 2 HGNC:24055 details
hsa-miR-548h-3p GPC5 glypican 5 HGNC:4453 details
hsa-miR-548h-3p BTBD3 BTB domain containing 3 HGNC:15854 details
hsa-miR-548h-3p C9orf64 chromosome 9 open reading frame 64 HGNC:28144 details
hsa-miR-548h-3p TGIF2 TGFB induced factor homeobox 2 HGNC:15764 details
hsa-miR-548h-3p GINS2 GINS complex subunit 2 HGNC:24575 details
hsa-miR-548h-3p ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit HGNC:3433 details
hsa-miR-548h-3p AAGAB alpha and gamma adaptin binding protein HGNC:25662 details
hsa-miR-548h-3p TRIM45 tripartite motif containing 45 HGNC:19018 details
hsa-miR-548h-3p TMPPE transmembrane protein with metallophosphoesterase domain HGNC:33865 details
hsa-miR-548h-3p NHLRC2 NHL repeat containing 2 HGNC:24731 details
hsa-miR-548h-3p KCNJ15 potassium inwardly rectifying channel subfamily J member 15 HGNC:6261 details
hsa-miR-548h-3p HHIP hedgehog interacting protein HGNC:14866 details
hsa-miR-548h-3p SCIMP SLP adaptor and CSK interacting membrane protein HGNC:33504 details
hsa-miR-548h-3p NUDT7 nudix hydrolase 7 HGNC:8054 details
hsa-miR-548h-3p RSRC1 arginine and serine rich coiled-coil 1 HGNC:24152 details
hsa-miR-548h-3p ZNF845 zinc finger protein 845 HGNC:25112 details
hsa-miR-548h-3p XRN2 5'-3' exoribonuclease 2 HGNC:12836 details
hsa-miR-548h-3p details
hsa-miR-548h-3p ZFHX3 zinc finger homeobox 3 HGNC:777 details
hsa-miR-548h-3p TJP1 tight junction protein 1 HGNC:11827 details
hsa-miR-548h-3p SOAT1 sterol O-acyltransferase 1 HGNC:11177 details
hsa-miR-548h-3p SEMA4D semaphorin 4D HGNC:10732 details
hsa-miR-548h-3p NEO1 neogenin 1 HGNC:7754 details
hsa-miR-548h-3p MRO maestro HGNC:24121 details
hsa-miR-548h-3p MAP3K1 mitogen-activated protein kinase kinase kinase 1 HGNC:6848 details
hsa-miR-548h-3p LDLR low density lipoprotein receptor HGNC:6547 details
hsa-miR-548h-3p FAM126B family with sequence similarity 126 member B HGNC:28593 details
hsa-miR-548h-3p details
hsa-miR-548h-3p PGM3 phosphoglucomutase 3 HGNC:8907 details
hsa-miR-548h-3p LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 HGNC:26068 details
hsa-miR-548h-3p RHOA ras homolog family member A HGNC:667 details
hsa-miR-548h-3p CCBE1 collagen and calcium binding EGF domains 1 HGNC:29426 details
hsa-miR-548h-3p U2SURP U2 snRNP associated SURP domain containing HGNC:30855 details
hsa-miR-548h-3p PKIA cAMP-dependent protein kinase inhibitor alpha HGNC:9017 details
hsa-miR-548h-3p TADA3 transcriptional adaptor 3 HGNC:19422 details
hsa-miR-548h-3p NEGR1 neuronal growth regulator 1 HGNC:17302 details
hsa-miR-548h-3p G2E3 G2/M-phase specific E3 ubiquitin protein ligase HGNC:20338 details
hsa-miR-548h-3p MYOCD myocardin HGNC:16067 details
hsa-miR-548h-3p BUB3 BUB3 mitotic checkpoint protein HGNC:1151 details
hsa-miR-548h-3p ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-548h-3p GTF2F2 general transcription factor IIF subunit 2 HGNC:4653 details
hsa-miR-548h-3p TMLHE trimethyllysine hydroxylase, epsilon HGNC:18308 details
hsa-miR-548h-3p AGAP1 ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 HGNC:16922 details
hsa-miR-548h-3p FAM126A family with sequence similarity 126 member A HGNC:24587 details
hsa-miR-548h-3p GATM glycine amidinotransferase HGNC:4175 details
hsa-miR-548h-3p LRRC58 leucine rich repeat containing 58 HGNC:26968 details
hsa-miR-548h-3p PHF12 PHD finger protein 12 HGNC:20816 details
hsa-miR-548h-3p CAMLG calcium modulating ligand HGNC:1471 details
hsa-miR-548h-3p CAPZA1 capping actin protein of muscle Z-line subunit alpha 1 HGNC:1488 details
hsa-miR-548h-3p GEMIN6 gem nuclear organelle associated protein 6 HGNC:20044 details
hsa-miR-548h-3p HCFC1 host cell factor C1 HGNC:4839 details
hsa-miR-548h-3p MDM4 MDM4 regulator of p53 HGNC:6974 details
hsa-miR-548h-3p PF4 platelet factor 4 HGNC:8861 details
hsa-miR-548h-3p PTPRB protein tyrosine phosphatase receptor type B HGNC:9665 details
hsa-miR-548h-3p SRP19 signal recognition particle 19 HGNC:11300 details
hsa-miR-548h-3p SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone HGNC:16987 details
hsa-miR-548h-3p CCNI2 cyclin I family member 2 HGNC:33869 details
hsa-miR-548h-3p details
hsa-miR-548h-3p KIF1B kinesin family member 1B HGNC:16636 details
hsa-miR-548h-3p KLHDC10 kelch domain containing 10 HGNC:22194 details
hsa-miR-548h-3p LANCL3 LanC like 3 HGNC:24767 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab