miRNA Card

miRNA General Information
miRNA ID hsa-miR-548t-3p
Description Homo sapiens miR-548t stem-loop
Comment None
Experiment
Sequence AAAAACCACAAUUACUUUUGCACCA
miRNA Expression in different cancers

    by mir_boxplot.py


circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr3:47586528|47586637 hsa-miR-548t-3p 1 1 0
chr17:1678762|1679130 hsa-miR-548t-3p 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr16:400265|400586 hsa-miR-548t-3p 1 0 0
chr22:41907035|41907238 hsa-miR-548t-3p 0 1 0
chr3:13637938|13638037 hsa-miR-548t-3p 0 1 0
chr17:50185555|50185822 hsa-miR-548t-3p 0 1 0
chr1:154467346|154467481 hsa-miR-548t-3p 0 1 0
chr13:95794223|95794388 hsa-miR-548t-3p 0 1 0
chr4:105682943|105683076 hsa-miR-548t-3p 0 1 0
chr5:97031986|97032353 hsa-miR-548t-3p 0 1 0
chr10:44374507|44374757 hsa-miR-548t-3p 0 1 0
chr7:6024006|6024179 hsa-miR-548t-3p 0 1 0
chr11:46672807|46673070 hsa-miR-548t-3p 0 1 0
chr6:20492024|20492201 hsa-miR-548t-3p 0 1 0
chr1:151248904|151249089 hsa-miR-548t-3p 0 1 0
chr20:41123240|41123437 hsa-miR-548t-3p 0 1 0
chr5:42718792|42718942 hsa-miR-548t-3p 1 0 0
chr5:42718843|42718996 hsa-miR-548t-3p 0 1 0
chr16:15703568|15703824 hsa-miR-548t-3p 0 1 0
chr17:50185559|50185852 hsa-miR-548t-3p 0 1 0
chr11:27366129|27366394 hsa-miR-548t-3p 0 1 0
chr7:6024006|6024109 hsa-miR-548t-3p 0 1 0
chr11:66345803|66346072 hsa-miR-548t-3p 0 1 0
chr3:105527523|105527699 hsa-miR-548t-3p 0 1 0
chr3:11556380|11556571 hsa-miR-548t-3p 0 1 0
chr10:103089606|103089692 hsa-miR-548t-3p 0 1 0
chr16:23465313|23465489 hsa-miR-548t-3p 0 1 0
chrX:53533624|53533769 hsa-miR-548t-3p 0 1 0
chr17:50185517|50185648 hsa-miR-548t-3p 0 1 0
chr19:38730221|38730429 hsa-miR-548t-3p 0 1 0
chr4:867173|867361 hsa-miR-548t-3p 0 1 0
chr17:50185526|50185635 hsa-miR-548t-3p 0 1 0
chr4:105682943~105683076 hsa-miR-548t-3p 0 1 0
chr14:77116688~77116881 hsa-miR-548t-3p 0 1 0
chr5:42718792~42718942 hsa-miR-548t-3p 0 1 0
chr17:50185526~50185822 hsa-miR-548t-3p 0 1 0
chr15:29700687~29700834 hsa-miR-548t-3p 0 1 0
chr1:32334284|32334463 hsa-miR-548t-3p 0 1 0
chr1:150960923~150961070 hsa-miR-548t-3p 0 1 0
chr15:73304115~73304334 hsa-miR-548t-3p 0 1 0
chr17:50185517~50185646 hsa-miR-548t-3p 0 1 0
chr13:95794223~95794388 hsa-miR-548t-3p 0 1 0
chr7:6024006~6024163 hsa-miR-548t-3p 0 1 0
chr11:46672909~46672998 hsa-miR-548t-3p 0 1 0
chr1:206733056~206733168 hsa-miR-548t-3p 0 1 0
chr17:4032982~4034145 hsa-miR-548t-3p 0 1 0
chr17:50185517~50185822 hsa-miR-548t-3p 0 1 0
chr17:29639157|29639279 hsa-miR-548t-3p 0 1 0
chr18:70293049|70293195 hsa-miR-548t-3p 0 1 0
chr19:38730248|38730429 hsa-miR-548t-3p 0 1 0
chr5:157789753|157789857 hsa-miR-548t-3p 0 1 0
chr2:113957552|113957704 hsa-miR-548t-3p 0 1 0
chr6:2782188|2782389 hsa-miR-548t-3p 0 1 0
chr8:128092390|128092497 hsa-miR-548t-3p 0 1 0
chr5:128276038|128276160 hsa-miR-548t-3p 0 1 0
chrX:124102106|124102294 hsa-miR-548t-3p 0 1 0
chr8:130007135|130007312 hsa-miR-548t-3p 0 1 0
chr19:19906202|19906327 hsa-miR-548t-3p 0 1 0
chr17:3935273|3935412 hsa-miR-548t-3p 0 1 0
chr13:41462155|41462279 hsa-miR-548t-3p 0 1 0
chr19:38730248|38730425 hsa-miR-548t-3p 0 1 0
chr3:31593130|31593283 hsa-miR-548t-3p 0 1 0
chr11:115209574|115209657 hsa-miR-548t-3p 1 0 0
chr14:77116729|77116948 hsa-miR-548t-3p 0 1 0
chr1:206732995|206733200 hsa-miR-548t-3p 0 1 0
chr5:58970987|58971115 hsa-miR-548t-3p 0 1 0
chr2:201167486|201167592 hsa-miR-548t-3p 0 1 0
chr10:103089555|103089692 hsa-miR-548t-3p 0 1 0
chr20:482677|482840 hsa-miR-548t-3p 0 1 0
chr7:6024006|6024163 hsa-miR-548t-3p 0 1 0
chr17:82265686|82265796 hsa-miR-548t-3p 0 1 0
chr2:99394296|99394557 hsa-miR-548t-3p 0 1 0
chr1:214038500|214038676 hsa-miR-548t-3p 0 1 0
chr6:99545112|99545188 hsa-miR-548t-3p 0 1 0
chr17:4034015|4034150 hsa-miR-548t-3p 0 1 0
chr19:39399750|39399933 hsa-miR-548t-3p 0 1 0
chr8:30568927|30569151 hsa-miR-548t-3p 0 1 0
chr2:19238838|19238937 hsa-miR-548t-3p 0 1 0
chr4:87981553|87981756 hsa-miR-548t-3p 0 1 0
chr16:29816985|29817292 hsa-miR-548t-3p 0 1 0
chr13:52414649|52414790 hsa-miR-548t-3p 0 1 0
chr11:62625032|62625364 hsa-miR-548t-3p 0 1 0
chr10:103089559|103089686 hsa-miR-548t-3p 0 1 0
chr19:38730256|38730429 hsa-miR-548t-3p 0 1 0
chr4:87981613|87981756 hsa-miR-548t-3p 0 1 0
chr1:150574956|150575108 hsa-miR-548t-3p 0 1 0
chr20:41123286|41123403 hsa-miR-548t-3p 0 1 0
chr9:33986760|34017189 hsa-miR-548t-3p 0 1 0
chr4:75790150|75790797 hsa-miR-548t-3p 0 1 0
chr14:50437894|50438008 hsa-miR-548t-3p 0 1 0
chr15:42794644|42840433 hsa-miR-548t-3p 0 1 0
chr19:34194478|34215661 hsa-miR-548t-3p 0 1 0
chr2:63887497|63887630 hsa-miR-548t-3p 0 1 0
chr4:87981544|87981756 hsa-miR-548t-3p 0 1 0
chr11:62625032|62625380 hsa-miR-548t-3p 0 1 0
chr12:132776652|132776993 hsa-miR-548t-3p 0 1 0
chr14:100833836|100834017 hsa-miR-548t-3p 0 1 0
chr19:39399679|39399933 hsa-miR-548t-3p 0 1 0
chr17:50185555|50185942 hsa-miR-548t-3p 0 1 0
chr4:867101|867289 hsa-miR-548t-3p 0 1 0
chr19:896974|897114 hsa-miR-548t-3p 0 1 0
chr6:136557187|136557366 hsa-miR-548t-3p 0 1 0
chr22:21002391|21002545 hsa-miR-548t-3p 0 1 0
chr12:132776640|132776977 hsa-miR-548t-3p 0 1 0
chr19:45379778|45379984 hsa-miR-548t-3p 0 1 0
chr7:6024006|6024288 hsa-miR-548t-3p 0 1 0
chr22:41906912|41907228 hsa-miR-548t-3p 0 1 0
chr2:200419250|200419496 hsa-miR-548t-3p 0 1 0
chr3:11556440|11556613 hsa-miR-548t-3p 0 1 0
chr9:115086433|115086584 hsa-miR-548t-3p 0 1 0
chr6:16376425|16376546 hsa-miR-548t-3p 0 1 0
chr1:207887171|207887365 hsa-miR-548t-3p 0 1 0
chr9:115086448|115086563 hsa-miR-548t-3p 0 1 0
chr9:115086530|115086675 hsa-miR-548t-3p 0 1 0
chr2:233462757|233462885 hsa-miR-548t-3p 0 1 0
chr3:13637938|13638045 hsa-miR-548t-3p -2 1 0
chr1:43359771|43360061 hsa-miR-548t-3p -8 1 0
chr5:37020573|37020877 hsa-miR-548t-3p -5 1 0
chr10:246439|246703 hsa-miR-548t-3p 0 1 0
chr6:20492095|20492201 hsa-miR-548t-3p 0 1 0
chr9:117715990|117716150 hsa-miR-548t-3p 0 1 0
chr12:132776661|132776993 hsa-miR-548t-3p 0 1 0
chr7:16706110|16706292 hsa-miR-548t-3p 0 1 0
chr1:32334141|32334309 hsa-miR-548t-3p 0 1 0
chr7:102257479|102257702 hsa-miR-548t-3p 0 1 0
chr10:103089555|103089689 hsa-miR-548t-3p 0 1 0
chr4:87981676|87981787 hsa-miR-548t-3p 0 1 0
chr5:37020607|37020877 hsa-miR-548t-3p 0 1 0
chr15:43386206|43386300 hsa-miR-548t-3p 0 1 0
chr19:41683983|41684054 hsa-miR-548t-3p 0 1 0
chr20:482636|482793 hsa-miR-548t-3p 0 1 0
chr8:140532101|140532465 hsa-miR-548t-3p 0 1 0
chr1:206733000|206733168 hsa-miR-548t-3p 0 1 0
chr16:31134820|31134969 hsa-miR-548t-3p 0 1 0
chr1:16396641|16396726 hsa-miR-548t-3p 0 1 0
chr20:1442234|1442406 hsa-miR-548t-3p 0 1 0
chr6:99543584|99545213 hsa-miR-548t-3p 0 1 0
chr2:201167496|201167592 hsa-miR-548t-3p 0 1 0
chr7:16706126|16706265 hsa-miR-548t-3p 0 1 0
chr12:55994459|55994657 hsa-miR-548t-3p 0 1 0
chr17:4032982|4034147 hsa-miR-548t-3p 0 1 0
chr5:37020556|37020877 hsa-miR-548t-3p 0 1 0
chr5:82019616|82019725 hsa-miR-548t-3p 0 1 0
chr20:41123240|41123459 hsa-miR-548t-3p 0 1 0
chr4:121813232|121813310 hsa-miR-548t-3p 0 1 0
chrX:53533624|53533707 hsa-miR-548t-3p 0 1 0
chr19:18867217|18867400 hsa-miR-548t-3p 0 1 0
chr4:122921996|122922156 hsa-miR-548t-3p 0 1 0
chr2:201167453|201167620 hsa-miR-548t-3p 0 1 0
chr17:17187757|17187845 hsa-miR-548t-3p 0 1 0
chrX:41519460|41519615 hsa-miR-548t-3p 0 1 0
chr17:47118464|47118622 hsa-miR-548t-3p 0 1 0
chr1:150574956|150575069 hsa-miR-548t-3p 0 1 0
chr11:78079779|78079910 hsa-miR-548t-3p 0 1 0
chr11:107564341|107564477 hsa-miR-548t-3p 1 0 0
chr4:121127239|121127384 hsa-miR-548t-3p 1 0 0
chr18:31066867|31067054 hsa-miR-548t-3p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-548t-3p LMOD3 leiomodin 3 HGNC:6649 details
hsa-miR-548t-3p CEBPG CCAAT enhancer binding protein gamma HGNC:1837 details
hsa-miR-548t-3p ZC3H12C zinc finger CCCH-type containing 12C HGNC:29362 details
hsa-miR-548t-3p ARL5B ADP ribosylation factor like GTPase 5B HGNC:23052 details
hsa-miR-548t-3p HMX3 H6 family homeobox 3 HGNC:5019 details
hsa-miR-548t-3p NR5A2 nuclear receptor subfamily 5 group A member 2 HGNC:7984 details
hsa-miR-548t-3p ZNF652 zinc finger protein 652 HGNC:29147 details
hsa-miR-548t-3p KCNB1 potassium voltage-gated channel subfamily B member 1 HGNC:6231 details
hsa-miR-548t-3p ATP6V0B ATPase H+ transporting V0 subunit b HGNC:861 details
hsa-miR-548t-3p CCDC115 coiled-coil domain containing 115 HGNC:28178 details
hsa-miR-548t-3p PPP2R2B protein phosphatase 2 regulatory subunit Bbeta HGNC:9305 details
hsa-miR-548t-3p CITED2 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2 HGNC:1987 details
hsa-miR-548t-3p DNALI1 dynein axonemal light intermediate chain 1 HGNC:14353 details
hsa-miR-548t-3p ZNF385A zinc finger protein 385A HGNC:17521 details
hsa-miR-548t-3p YPEL2 yippee like 2 HGNC:18326 details
hsa-miR-548t-3p SFT2D2 SFT2 domain containing 2 HGNC:25140 details
hsa-miR-548t-3p POLR2D RNA polymerase II subunit D HGNC:9191 details
hsa-miR-548t-3p CTTN cortactin HGNC:3338 details
hsa-miR-548t-3p details
hsa-miR-548t-3p ACTB actin beta HGNC:132 details
hsa-miR-548t-3p INHBA inhibin subunit beta A HGNC:6066 details
hsa-miR-548t-3p HMGN2 high mobility group nucleosomal binding domain 2 HGNC:4986 details
hsa-miR-548t-3p SLC38A9 solute carrier family 38 member 9 HGNC:26907 details
hsa-miR-548t-3p ANKEF1 ankyrin repeat and EF-hand domain containing 1 HGNC:15803 details
hsa-miR-548t-3p YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta HGNC:12855 details
hsa-miR-548t-3p CEP120 centrosomal protein 120 HGNC:26690 details
hsa-miR-548t-3p AKAP11 A-kinase anchoring protein 11 HGNC:369 details
hsa-miR-548t-3p TRIM24 tripartite motif containing 24 HGNC:11812 details
hsa-miR-548t-3p CDK1 cyclin dependent kinase 1 HGNC:1722 details
hsa-miR-548t-3p TMEM237 transmembrane protein 237 HGNC:14432 details
hsa-miR-548t-3p ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-548t-3p CHD4 chromodomain helicase DNA binding protein 4 HGNC:1919 details
hsa-miR-548t-3p TXNIP thioredoxin interacting protein HGNC:16952 details
hsa-miR-548t-3p FBXL13 F-box and leucine rich repeat protein 13 HGNC:21658 details
hsa-miR-548t-3p RNF11 ring finger protein 11 HGNC:10056 details
hsa-miR-548t-3p PPP2R2A protein phosphatase 2 regulatory subunit Balpha HGNC:9304 details
hsa-miR-548t-3p MIER3 MIER family member 3 HGNC:26678 details
hsa-miR-548t-3p MAT2A methionine adenosyltransferase 2A HGNC:6904 details
hsa-miR-548t-3p KIF23 kinesin family member 23 HGNC:6392 details
hsa-miR-548t-3p RPP14 ribonuclease P/MRP subunit p14 HGNC:30327 details
hsa-miR-548t-3p ZNF354B zinc finger protein 354B HGNC:17197 details
hsa-miR-548t-3p MBNL3 muscleblind like splicing regulator 3 HGNC:20564 details
hsa-miR-548t-3p COX6B1 cytochrome c oxidase subunit 6B1 HGNC:2280 details
hsa-miR-548t-3p ID4 inhibitor of DNA binding 4, HLH protein HGNC:5363 details
hsa-miR-548t-3p XRCC3 X-ray repair cross complementing 3 HGNC:12830 details
hsa-miR-548t-3p AJAP1 adherens junctions associated protein 1 HGNC:30801 details
hsa-miR-548t-3p PNISR PNN interacting serine and arginine rich protein HGNC:21222 details
hsa-miR-548t-3p PCGF2 polycomb group ring finger 2 HGNC:12929 details
hsa-miR-548t-3p ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 HGNC:689 details
hsa-miR-548t-3p SYNM synemin HGNC:24466 details
hsa-miR-548t-3p details
hsa-miR-548t-3p ARHGAP15 Rho GTPase activating protein 15 HGNC:21030 details
hsa-miR-548t-3p FBLN2 fibulin 2 HGNC:3601 details
hsa-miR-548t-3p COL4A3 collagen type IV alpha 3 chain HGNC:2204 details
hsa-miR-548t-3p CD300E CD300e molecule HGNC:28874 details
hsa-miR-548t-3p TBC1D22B TBC1 domain family member 22B HGNC:21602 details
hsa-miR-548t-3p EXOC8 exocyst complex component 8 HGNC:24659 details
hsa-miR-548t-3p PDE5A phosphodiesterase 5A HGNC:8784 details
hsa-miR-548t-3p TRPV2 transient receptor potential cation channel subfamily V member 2 HGNC:18082 details
hsa-miR-548t-3p SMTN smoothelin HGNC:11126 details
hsa-miR-548t-3p ZNF431 zinc finger protein 431 HGNC:20809 details
hsa-miR-548t-3p GPR85 G protein-coupled receptor 85 HGNC:4536 details
hsa-miR-548t-3p KDR kinase insert domain receptor HGNC:6307 details
hsa-miR-548t-3p KLF2 Kruppel like factor 2 HGNC:6347 details
hsa-miR-548t-3p CBX7 chromobox 7 HGNC:1557 details
hsa-miR-548t-3p TMX3 thioredoxin related transmembrane protein 3 HGNC:24718 details
hsa-miR-548t-3p RAB33B RAB33B, member RAS oncogene family HGNC:16075 details
hsa-miR-548t-3p PSD3 pleckstrin and Sec7 domain containing 3 HGNC:19093 details
hsa-miR-548t-3p ITPKB inositol-trisphosphate 3-kinase B HGNC:6179 details
hsa-miR-548t-3p HNRNPD heterogeneous nuclear ribonucleoprotein D HGNC:5036 details
hsa-miR-548t-3p CABLES1 Cdk5 and Abl enzyme substrate 1 HGNC:25097 details
hsa-miR-548t-3p ANGEL2 angel homolog 2 HGNC:30534 details
hsa-miR-548t-3p SHISA9 shisa family member 9 HGNC:37231 details
hsa-miR-548t-3p BUB1 BUB1 mitotic checkpoint serine/threonine kinase HGNC:1148 details
hsa-miR-548t-3p NWD1 NACHT and WD repeat domain containing 1 HGNC:27619 details
hsa-miR-548t-3p OPHN1 oligophrenin 1 HGNC:8148 details
hsa-miR-548t-3p PITPNC1 phosphatidylinositol transfer protein cytoplasmic 1 HGNC:21045 details
hsa-miR-548t-3p CDC27 cell division cycle 27 HGNC:1728 details
hsa-miR-548t-3p HSBP1 heat shock factor binding protein 1 HGNC:5203 details
hsa-miR-548t-3p EIF5AL1 eukaryotic translation initiation factor 5A like 1 HGNC:17419 details
hsa-miR-548t-3p EIF5A eukaryotic translation initiation factor 5A HGNC:3300 details
hsa-miR-548t-3p MFF mitochondrial fission factor HGNC:24858 details
hsa-miR-548t-3p TFAP2C transcription factor AP-2 gamma HGNC:11744 details
hsa-miR-548t-3p CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 HGNC:1775 details
hsa-miR-548t-3p FEM1A fem-1 homolog A HGNC:16934 details
hsa-miR-548t-3p TSPAN3 tetraspanin 3 HGNC:17752 details
hsa-miR-548t-3p TNRC6C trinucleotide repeat containing adaptor 6C HGNC:29318 details
hsa-miR-548t-3p TAF13 TATA-box binding protein associated factor 13 HGNC:11546 details
hsa-miR-548t-3p ROBO1 roundabout guidance receptor 1 HGNC:10249 details
hsa-miR-548t-3p PURB purine rich element binding protein B HGNC:9702 details
hsa-miR-548t-3p PLEKHA3 pleckstrin homology domain containing A3 HGNC:14338 details
hsa-miR-548t-3p HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 HGNC:5031 details
hsa-miR-548t-3p ETS2 ETS proto-oncogene 2, transcription factor HGNC:3489 details
hsa-miR-548t-3p ARF1 ADP ribosylation factor 1 HGNC:652 details
hsa-miR-548t-3p GAL3ST3 galactose-3-O-sulfotransferase 3 HGNC:24144 details
hsa-miR-548t-3p SON SON DNA and RNA binding protein HGNC:11183 details
hsa-miR-548t-3p PRELID3B PRELI domain containing 3B HGNC:15892 details
hsa-miR-548t-3p ZNF678 zinc finger protein 678 HGNC:28652 details
hsa-miR-548t-3p SIX4 SIX homeobox 4 HGNC:10890 details
hsa-miR-548t-3p RREB1 ras responsive element binding protein 1 HGNC:10449 details
hsa-miR-548t-3p MIDN midnolin HGNC:16298 details
hsa-miR-548t-3p IGFBP5 insulin like growth factor binding protein 5 HGNC:5474 details
hsa-miR-548t-3p GRPEL2 GrpE like 2, mitochondrial HGNC:21060 details
hsa-miR-548t-3p CELF2 CUGBP Elav-like family member 2 HGNC:2550 details
hsa-miR-548t-3p ANP32E acidic nuclear phosphoprotein 32 family member E HGNC:16673 details
hsa-miR-548t-3p MYBL1 MYB proto-oncogene like 1 HGNC:7547 details
hsa-miR-548t-3p CADM2 cell adhesion molecule 2 HGNC:29849 details
hsa-miR-548t-3p THYN1 thymocyte nuclear protein 1 HGNC:29560 details
hsa-miR-548t-3p CDKN2AIP CDKN2A interacting protein HGNC:24325 details
hsa-miR-548t-3p PHF19 PHD finger protein 19 HGNC:24566 details
hsa-miR-548t-3p NCL nucleolin HGNC:7667 details
hsa-miR-548t-3p DKK3 dickkopf WNT signaling pathway inhibitor 3 HGNC:2893 details
hsa-miR-548t-3p KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-548t-3p SLC24A4 solute carrier family 24 member 4 HGNC:10978 details
hsa-miR-548t-3p SLC30A3 solute carrier family 30 member 3 HGNC:11014 details
hsa-miR-548t-3p PIWIL2 piwi like RNA-mediated gene silencing 2 HGNC:17644 details
hsa-miR-548t-3p NKTR natural killer cell triggering receptor HGNC:7833 details
hsa-miR-548t-3p details
hsa-miR-548t-3p EDIL3 EGF like repeats and discoidin domains 3 HGNC:3173 details
hsa-miR-548t-3p TRA2B transformer 2 beta homolog HGNC:10781 details
hsa-miR-548t-3p PTPN11 protein tyrosine phosphatase non-receptor type 11 HGNC:9644 details
hsa-miR-548t-3p SALL1 spalt like transcription factor 1 HGNC:10524 details
hsa-miR-548t-3p CDK12 cyclin dependent kinase 12 HGNC:24224 details
hsa-miR-548t-3p ZNF665 zinc finger protein 665 HGNC:25885 details
hsa-miR-548t-3p AP3B1 adaptor related protein complex 3 subunit beta 1 HGNC:566 details
hsa-miR-548t-3p RAP2B RAP2B, member of RAS oncogene family HGNC:9862 details
hsa-miR-548t-3p ADAT2 adenosine deaminase tRNA specific 2 HGNC:21172 details
hsa-miR-548t-3p PLEKHG7 pleckstrin homology and RhoGEF domain containing G7 HGNC:33829 details
hsa-miR-548t-3p NOP53 NOP53 ribosome biogenesis factor HGNC:4333 details
hsa-miR-548t-3p SERBP1 SERPINE1 mRNA binding protein 1 HGNC:17860 details
hsa-miR-548t-3p RNF115 ring finger protein 115 HGNC:18154 details
hsa-miR-548t-3p CTNNA3 catenin alpha 3 HGNC:2511 details
hsa-miR-548t-3p NOL9 nucleolar protein 9 HGNC:26265 details
hsa-miR-548t-3p ZNF639 zinc finger protein 639 HGNC:30950 details
hsa-miR-548t-3p PCK1 phosphoenolpyruvate carboxykinase 1 HGNC:8724 details
hsa-miR-548t-3p MYOZ3 myozenin 3 HGNC:18565 details
hsa-miR-548t-3p ZCCHC9 zinc finger CCHC-type containing 9 HGNC:25424 details
hsa-miR-548t-3p ZNF518B zinc finger protein 518B HGNC:29365 details
hsa-miR-548t-3p ZADH2 zinc binding alcohol dehydrogenase domain containing 2 HGNC:28697 details
hsa-miR-548t-3p XKR4 XK related 4 HGNC:29394 details
hsa-miR-548t-3p SLC30A4 solute carrier family 30 member 4 HGNC:11015 details
hsa-miR-548t-3p SLC30A1 solute carrier family 30 member 1 HGNC:11012 details
hsa-miR-548t-3p POU2F1 POU class 2 homeobox 1 HGNC:9212 details
hsa-miR-548t-3p MAP3K9 mitogen-activated protein kinase kinase kinase 9 HGNC:6861 details
hsa-miR-548t-3p GABRA4 gamma-aminobutyric acid type A receptor subunit alpha4 HGNC:4078 details
hsa-miR-548t-3p FZD10 frizzled class receptor 10 HGNC:4039 details
hsa-miR-548t-3p BTBD3 BTB domain containing 3 HGNC:15854 details
hsa-miR-548t-3p ASH1L ASH1 like histone lysine methyltransferase HGNC:19088 details
hsa-miR-548t-3p MAGEF1 MAGE family member F1 HGNC:29639 details
hsa-miR-548t-3p TGIF2 TGFB induced factor homeobox 2 HGNC:15764 details
hsa-miR-548t-3p CEP128 centrosomal protein 128 HGNC:20359 details
hsa-miR-548t-3p AAGAB alpha and gamma adaptin binding protein HGNC:25662 details
hsa-miR-548t-3p SNX2 sorting nexin 2 HGNC:11173 details
hsa-miR-548t-3p SOD2 superoxide dismutase 2 HGNC:11180 details
hsa-miR-548t-3p GLRX2 glutaredoxin 2 HGNC:16065 details
hsa-miR-548t-3p BCAR1 BCAR1 scaffold protein, Cas family member HGNC:971 details
hsa-miR-548t-3p GID4 GID complex subunit 4 homolog HGNC:28453 details
hsa-miR-548t-3p DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 HGNC:3093 details
hsa-miR-548t-3p CDC6 cell division cycle 6 HGNC:1744 details
hsa-miR-548t-3p GK5 glycerol kinase 5 HGNC:28635 details
hsa-miR-548t-3p KLHL30 kelch like family member 30 HGNC:24770 details
hsa-miR-548t-3p RWDD2A RWD domain containing 2A HGNC:21385 details
hsa-miR-548t-3p PPP1CB protein phosphatase 1 catalytic subunit beta HGNC:9282 details
hsa-miR-548t-3p POU6F2 POU class 6 homeobox 2 HGNC:21694 details
hsa-miR-548t-3p TMTC1 transmembrane O-mannosyltransferase targeting cadherins 1 HGNC:24099 details
hsa-miR-548t-3p TADA3 transcriptional adaptor 3 HGNC:19422 details
hsa-miR-548t-3p NCKAP1 NCK associated protein 1 HGNC:7666 details
hsa-miR-548t-3p ARHGAP35 Rho GTPase activating protein 35 HGNC:4591 details
hsa-miR-548t-3p E2F6 E2F transcription factor 6 HGNC:3120 details
hsa-miR-548t-3p FAM126A family with sequence similarity 126 member A HGNC:24587 details
hsa-miR-548t-3p PTPA protein phosphatase 2 phosphatase activator HGNC:9308 details
hsa-miR-548t-3p FBXO21 F-box protein 21 HGNC:13592 details
hsa-miR-548t-3p OTULIN OTU deubiquitinase with linear linkage specificity HGNC:25118 details
hsa-miR-548t-3p RIPPLY3 ripply transcriptional repressor 3 HGNC:3047 details
hsa-miR-548t-3p SAMD5 sterile alpha motif domain containing 5 HGNC:21180 details
hsa-miR-548t-3p SLC24A3 solute carrier family 24 member 3 HGNC:10977 details
hsa-miR-548t-3p SLC28A1 solute carrier family 28 member 1 HGNC:11001 details
hsa-miR-548t-3p AAK1 AP2 associated kinase 1 HGNC:19679 details
hsa-miR-548t-3p CCNI2 cyclin I family member 2 HGNC:33869 details
hsa-miR-548t-3p LANCL3 LanC like 3 HGNC:24767 details
hsa-miR-548t-3p AFF2 AF4/FMR2 family member 2 HGNC:3776 details