miRNA Card

miRNA General Information
miRNA ID hsa-miR-548t-5p
Description Homo sapiens miR-548t stem-loop
Comment None
Experiment Illumina [1], Northern [2]
Sequence CAAAAGUGAUCGUGGUUUUUG
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr10:71352695|71352922 hsa-miR-548t-5p 0 1 0
chr17:48050877|48051023 hsa-miR-548t-5p 0 1 0
chr1:12567967|12568128 hsa-miR-548t-5p 0 1 0
chr17:6770777|6770914 hsa-miR-548t-5p 0 1 0
chr17:81843698|81843874 hsa-miR-548t-5p 0 1 0
chrX:154366374|154366755 hsa-miR-548t-5p 0 1 0
chr17:48050859|48051023 hsa-miR-548t-5p 0 1 0
chr17:81843675|81843890 hsa-miR-548t-5p 0 1 0
chr5:64789004|64800327 hsa-miR-548t-5p 0 1 0
chr5:138467716|138467976 hsa-miR-548t-5p 0 1 0
chr17:81843599|81843890 hsa-miR-548t-5p 0 1 0
chr17:48050791|48051023 hsa-miR-548t-5p 0 1 0
chr3:47442890|47443087 hsa-miR-548t-5p 0 1 0
chr17:48050877|48051006 hsa-miR-548t-5p 0 1 0
chr1:28531907|28532269 hsa-miR-548t-5p 0 1 0
chr2:98599080|98599223 hsa-miR-548t-5p 0 1 0
chr6:167951255|167951504 hsa-miR-548t-5p 0 1 0
chr1:228244296|228244571 hsa-miR-548t-5p 0 1 0
chr1:41113360|41113466 hsa-miR-548t-5p 0 1 0
chr17:48050895|48051023 hsa-miR-548t-5p 0 1 0
chr11:62517841|62518044 hsa-miR-548t-5p 0 1 0
chr5:138467686|138467801 hsa-miR-548t-5p 0 1 0
chr6:16749741|16749938 hsa-miR-548t-5p 1 0 0
chr13:113323205|113323309 hsa-miR-548t-5p 1 0 0
chr8:143991895|143992059 hsa-miR-548t-5p 0 1 0
chr17:81843694|81843874 hsa-miR-548t-5p 0 1 0
chr20:45426061|45426168 hsa-miR-548t-5p 0 1 0
chr1:224190015|224190236 hsa-miR-548t-5p 0 1 0
chr1:206733653|206733978 hsa-miR-548t-5p 0 1 0
chr6:4063830|4063943 hsa-miR-548t-5p 0 1 0
chr5:138467658|138467976 hsa-miR-548t-5p 0 1 0
chr2:189923544|189923720 hsa-miR-548t-5p 0 1 0
chrX:44907020|44907152 hsa-miR-548t-5p 0 1 0
chr7:38217045|38217255 hsa-miR-548t-5p 0 1 0
chr8:143991745|143991981 hsa-miR-548t-5p 0 1 0
chr17:48050877|48050999 hsa-miR-548t-5p 0 1 0
chr6:13288865|13289022 hsa-miR-548t-5p 0 1 0
chr17:81843706|81843874 hsa-miR-548t-5p 0 1 0
chr17:48050884|48051023 hsa-miR-548t-5p 0 1 0
chr1:155087329|155087420 hsa-miR-548t-5p 0 1 0
chr17:48050879|48051023 hsa-miR-548t-5p 0 1 0
chr17:81843738|81843874 hsa-miR-548t-5p 0 1 0
chr18:67512863|67513012 hsa-miR-548t-5p 0 1 0
chr12:132775141|132775305 hsa-miR-548t-5p 0 1 0
chr15:74054500|74054666 hsa-miR-548t-5p 0 1 0
chr17:48050704|48050915 hsa-miR-548t-5p 0 1 0
chr10:70111937|70112073 hsa-miR-548t-5p 0 1 0
chr1:156068358|156068463 hsa-miR-548t-5p 0 1 0
chr14:90405972|90406110 hsa-miR-548t-5p 0 1 0
chr17:48050895|48050994 hsa-miR-548t-5p 0 1 0
chr11:62517982|62518251 hsa-miR-548t-5p 0 1 0
chr17:47678140|47678406 hsa-miR-548t-5p 0 1 0
chr2:120294486|120294582 hsa-miR-548t-5p 0 1 0
chr20:35654110|35654233 hsa-miR-548t-5p 0 1 0
chr8:143991712~143991998 hsa-miR-548t-5p 0 1 0
chr17:48050859~48051023 hsa-miR-548t-5p 0 1 0
chr11:65552109~65552341 hsa-miR-548t-5p 0 1 0
chr17:48050895~48051023 hsa-miR-548t-5p 0 1 0
chr8:143991742~143991981 hsa-miR-548t-5p 0 1 0
chr12:95658403~95658516 hsa-miR-548t-5p 0 1 0
chr1:155087334~155087449 hsa-miR-548t-5p 0 1 0
chr16:8848929~8849089 hsa-miR-548t-5p 0 1 0
chr20:20033212~20033317 hsa-miR-548t-5p 0 1 0
chr5:138467716~138467952 hsa-miR-548t-5p 0 1 0
chr17:81843698~81843874 hsa-miR-548t-5p 0 1 0
chr8:143991745~143991981 hsa-miR-548t-5p 0 1 0
chr17:48050704~48050917 hsa-miR-548t-5p 0 1 0
chr3:71656705~71657004 hsa-miR-548t-5p 0 1 0
chr17:48050884~48051023 hsa-miR-548t-5p 0 1 0
chr22:29731033~29731204 hsa-miR-548t-5p 0 1 0
chr1:32773253~32773431 hsa-miR-548t-5p 0 1 0
chr19:40396934~40397004 hsa-miR-548t-5p 0 1 0
chr1:28531949~28532272 hsa-miR-548t-5p 0 1 0
chr1:156068358~156068463 hsa-miR-548t-5p 0 1 0
chr11:62517841~62518044 hsa-miR-548t-5p 0 1 0
chr22:24571926~24572123 hsa-miR-548t-5p 0 1 0
chr11:65551996~65552341 hsa-miR-548t-5p 0 1 0
chr11:65551996~65552330 hsa-miR-548t-5p 0 1 0
chr15:65556787~65556903 hsa-miR-548t-5p 0 1 0
chr6:24718540~24718823 hsa-miR-548t-5p 0 1 0
chr21:46597718|46597850 hsa-miR-548t-5p 0 1 0
chr9:112605160|112605411 hsa-miR-548t-5p 0 1 0
chr3:185745900|185746012 hsa-miR-548t-5p 0 1 0
chr6:34284399|34284590 hsa-miR-548t-5p 0 1 0
chr10:43406853|43406998 hsa-miR-548t-5p 0 1 0
chr20:21382049|21382145 hsa-miR-548t-5p 0 1 0
chrX:102599573|102599711 hsa-miR-548t-5p 0 1 0
chr4:69196584|69196843 hsa-miR-548t-5p 0 1 0
chr22:19117881|19118034 hsa-miR-548t-5p 0 1 0
chrX:151419249|151419405 hsa-miR-548t-5p 0 1 0
chr11:58526970|58527111 hsa-miR-548t-5p 0 1 0
chr15:75844611|75844787 hsa-miR-548t-5p 0 1 0
chr13:113323205|113323307 hsa-miR-548t-5p 1 0 0
chr13:113323055|113323309 hsa-miR-548t-5p 1 0 0
chr7:6461206|6461413 hsa-miR-548t-5p 0 1 0
chr1:1387521|1387859 hsa-miR-548t-5p 0 1 0
chr20:33238136|33239842 hsa-miR-548t-5p 0 1 0
chr22:24571928|24572061 hsa-miR-548t-5p 0 1 0
chr17:81843702|81843874 hsa-miR-548t-5p 0 1 0
chrX:154366562|154366639 hsa-miR-548t-5p 0 1 0
chr1:6621452|6621590 hsa-miR-548t-5p 0 1 0
chr1:6621546|6621885 hsa-miR-548t-5p 0 1 0
chr5:138467688|138467976 hsa-miR-548t-5p 0 1 0
chr6:89643300|89643452 hsa-miR-548t-5p 0 1 0
chr1:156068287|156068463 hsa-miR-548t-5p 0 1 0
chr17:81843610|81843874 hsa-miR-548t-5p 0 1 0
chr8:89925784|89925921 hsa-miR-548t-5p 0 1 0
chr17:77090639|77090812 hsa-miR-548t-5p 0 1 0
chr7:152181829|152181963 hsa-miR-548t-5p 0 1 0
chr2:172487051|172487401 hsa-miR-548t-5p 0 1 0
chr5:140246209|140246459 hsa-miR-548t-5p 0 1 0
chr19:2046025|2046185 hsa-miR-548t-5p 0 1 0
chr8:56073725|56074120 hsa-miR-548t-5p 0 1 0
chr7:6461222|6461330 hsa-miR-548t-5p 0 1 0
chr8:143991762|143991981 hsa-miR-548t-5p 0 1 0
chr17:48050879|48051006 hsa-miR-548t-5p 0 1 0
chr1:156068355|156068463 hsa-miR-548t-5p 0 1 0
chr9:34635835|34637089 hsa-miR-548t-5p 0 1 0
chr10:84511588|84511797 hsa-miR-548t-5p 0 1 0
chr1:155087329|155087429 hsa-miR-548t-5p 0 1 0
chr17:48050892|48051023 hsa-miR-548t-5p 0 1 0
chr6:13288863|13289022 hsa-miR-548t-5p 0 1 0
chr5:138467589|138467976 hsa-miR-548t-5p 0 1 0
chr6:89643300|89643400 hsa-miR-548t-5p 0 1 0
chr8:143991766|143991981 hsa-miR-548t-5p 0 1 0
chr20:13775873|13776043 hsa-miR-548t-5p 0 1 0
chr3:113961361|113961516 hsa-miR-548t-5p 0 1 0
chr11:61119444|61121624 hsa-miR-548t-5p 0 1 0
chr17:81843656|81843874 hsa-miR-548t-5p 0 1 0
chr20:45425884|45426168 hsa-miR-548t-5p 0 1 0
chr16:68300932|68301101 hsa-miR-548t-5p 0 1 0
chr16:89646616|89646881 hsa-miR-548t-5p 0 1 0
chr1:155087229|155087420 hsa-miR-548t-5p 0 1 0
chr1:150617542|150617697 hsa-miR-548t-5p 0 1 0
chr11:65551996|65552330 hsa-miR-548t-5p 0 1 0
chr11:119052158|119052429 hsa-miR-548t-5p 0 1 0
chr16:68300914|68301106 hsa-miR-548t-5p 0 1 0
chr3:4983085|4983256 hsa-miR-548t-5p 0 1 0
chr12:50120308|50120450 hsa-miR-548t-5p 0 1 0
chr8:143991745|143991984 hsa-miR-548t-5p -4 1 0
chr8:143991742|143991981 hsa-miR-548t-5p -4 1 0
chr16:8848929|8849089 hsa-miR-548t-5p -5 1 0
chr8:143991736|143991981 hsa-miR-548t-5p -4 1 0
chr13:113323094|113323329 hsa-miR-548t-5p 1 0 0
chr13:113323076|113323329 hsa-miR-548t-5p 1 0 0
chr13:113323057|113323329 hsa-miR-548t-5p 1 0 0
chr2:195659258|195659474 hsa-miR-548t-5p 0 1 0
chr5:74629005|74629152 hsa-miR-548t-5p 0 1 0
chr1:155087334|155087420 hsa-miR-548t-5p 0 1 0
chr17:48050842|48051023 hsa-miR-548t-5p 0 1 0
chr17:760013|760238 hsa-miR-548t-5p 0 1 0
chr2:65090553|65090694 hsa-miR-548t-5p 0 1 0
chr15:65556823|65556903 hsa-miR-548t-5p 0 1 0
chr17:48050884|48051006 hsa-miR-548t-5p 0 1 0
chr8:143991742|143992002 hsa-miR-548t-5p 0 1 0
chr8:56073695|56074085 hsa-miR-548t-5p 0 1 0
chr8:143991913|143991981 hsa-miR-548t-5p 0 1 0
chr20:63888911|63889042 hsa-miR-548t-5p 0 1 0
chr5:138467688|138467856 hsa-miR-548t-5p 0 1 0
chr17:42323004|42323336 hsa-miR-548t-5p 0 1 0
chr19:13115626|13115753 hsa-miR-548t-5p 0 1 0
chr7:100099683|100100058 hsa-miR-548t-5p 0 1 0
chr19:13115626|13115756 hsa-miR-548t-5p 0 1 0
chr8:143991712|143991981 hsa-miR-548t-5p 0 1 0
chr2:172487105|172487401 hsa-miR-548t-5p 0 1 0
chr5:138467670|138467801 hsa-miR-548t-5p 0 1 0
chr15:89903216|89903359 hsa-miR-548t-5p 0 1 0
chr6:85609614|85609738 hsa-miR-548t-5p 0 1 0
chr22:24571928|24572123 hsa-miR-548t-5p 0 1 0
chr20:20033169|20033317 hsa-miR-548t-5p 0 1 0
chrX:100843360|100843451 hsa-miR-548t-5p 0 1 0
chr5:138467670|138467856 hsa-miR-548t-5p 0 1 0
chr6:30604353|30604709 hsa-miR-548t-5p 0 1 0
chr4:173332821|173333199 hsa-miR-548t-5p 0 1 0
chr3:47443006|47443094 hsa-miR-548t-5p 0 1 0
chr20:25297259|25297487 hsa-miR-548t-5p 0 1 0
chr3:197673428|197673565 hsa-miR-548t-5p 0 1 0
chr22:24571934|24572061 hsa-miR-548t-5p 0 1 0
chr6:82364293|82364667 hsa-miR-548t-5p 0 1 0
chr5:138467722|138467808 hsa-miR-548t-5p 0 1 0
chr6:107870951|107871132 hsa-miR-548t-5p 0 1 0
chr7:6461222|6461346 hsa-miR-548t-5p 0 1 0
chr12:50120310|50120450 hsa-miR-548t-5p 0 1 0
chr17:81720012|81720115 hsa-miR-548t-5p 0 1 0
chr17:81843596|81843874 hsa-miR-548t-5p 0 1 0
chr2:28788706|28793900 hsa-miR-548t-5p 1 0 0
chr5:179729856|179730047 hsa-miR-548t-5p 1 0 0
chr13:113323055|113323329 hsa-miR-548t-5p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-548t-5p PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 HGNC:8873 details
hsa-miR-548t-5p VPS50 VPS50 subunit of EARP/GARPII complex HGNC:25956 details
hsa-miR-548t-5p SLCO5A1 solute carrier organic anion transporter family member 5A1 HGNC:19046 details
hsa-miR-548t-5p CEP170 centrosomal protein 170 HGNC:28920 details
hsa-miR-548t-5p ANKRD26 ankyrin repeat domain 26 HGNC:29186 details
hsa-miR-548t-5p A1CF APOBEC1 complementation factor HGNC:24086 details
hsa-miR-548t-5p ZNF623 zinc finger protein 623 HGNC:29084 details
hsa-miR-548t-5p SRSF11 serine and arginine rich splicing factor 11 HGNC:10782 details
hsa-miR-548t-5p SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase HGNC:25016 details
hsa-miR-548t-5p NDST4 N-deacetylase and N-sulfotransferase 4 HGNC:20779 details
hsa-miR-548t-5p SYNJ2BP synaptojanin 2 binding protein HGNC:18955 details
hsa-miR-548t-5p ITGA2 integrin subunit alpha 2 HGNC:6137 details
hsa-miR-548t-5p GMFB glia maturation factor beta HGNC:4373 details
hsa-miR-548t-5p GLIS3 GLIS family zinc finger 3 HGNC:28510 details
hsa-miR-548t-5p FAM120AOS family with sequence similarity 120A opposite strand HGNC:23389 details
hsa-miR-548t-5p TM6SF1 transmembrane 6 superfamily member 1 HGNC:11860 details
hsa-miR-548t-5p ST8SIA5 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5 HGNC:17827 details
hsa-miR-548t-5p DLC1 DLC1 Rho GTPase activating protein HGNC:2897 details
hsa-miR-548t-5p CADM2 cell adhesion molecule 2 HGNC:29849 details
hsa-miR-548t-5p ATAD2 ATPase family AAA domain containing 2 HGNC:30123 details
hsa-miR-548t-5p ATP6V0B ATPase H+ transporting V0 subunit b HGNC:861 details
hsa-miR-548t-5p CITED2 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2 HGNC:1987 details
hsa-miR-548t-5p MORF4L2 mortality factor 4 like 2 HGNC:16849 details
hsa-miR-548t-5p SPAM1 sperm adhesion molecule 1 HGNC:11217 details
hsa-miR-548t-5p NCOA3 nuclear receptor coactivator 3 HGNC:7670 details
hsa-miR-548t-5p MRI1 methylthioribose-1-phosphate isomerase 1 HGNC:28469 details
hsa-miR-548t-5p CD55 CD55 molecule (Cromer blood group) HGNC:2665 details
hsa-miR-548t-5p S100A11 S100 calcium binding protein A11 HGNC:10488 details
hsa-miR-548t-5p L2HGDH L-2-hydroxyglutarate dehydrogenase HGNC:20499 details
hsa-miR-548t-5p WAC WW domain containing adaptor with coiled-coil HGNC:17327 details
hsa-miR-548t-5p TSC22D3 TSC22 domain family member 3 HGNC:3051 details
hsa-miR-548t-5p PRICKLE4 prickle planar cell polarity protein 4 HGNC:16805 details
hsa-miR-548t-5p STMN1 stathmin 1 HGNC:6510 details
hsa-miR-548t-5p SPRED1 sprouty related EVH1 domain containing 1 HGNC:20249 details
hsa-miR-548t-5p SNAPIN SNAP associated protein HGNC:17145 details
hsa-miR-548t-5p SHOC2 SHOC2 leucine rich repeat scaffold protein HGNC:15454 details
hsa-miR-548t-5p SGMS1 sphingomyelin synthase 1 HGNC:29799 details
hsa-miR-548t-5p RRAS2 RAS related 2 HGNC:17271 details
hsa-miR-548t-5p RHOB ras homolog family member B HGNC:668 details
hsa-miR-548t-5p REL REL proto-oncogene, NF-kB subunit HGNC:9954 details
hsa-miR-548t-5p RAB22A RAB22A, member RAS oncogene family HGNC:9764 details
hsa-miR-548t-5p PRR14L proline rich 14 like HGNC:28738 details
hsa-miR-548t-5p PPP1R15B protein phosphatase 1 regulatory subunit 15B HGNC:14951 details
hsa-miR-548t-5p POU2F1 POU class 2 homeobox 1 HGNC:9212 details
hsa-miR-548t-5p PITPNA phosphatidylinositol transfer protein alpha HGNC:9001 details
hsa-miR-548t-5p PGM2L1 phosphoglucomutase 2 like 1 HGNC:20898 details
hsa-miR-548t-5p MAP3K2 mitogen-activated protein kinase kinase kinase 2 HGNC:6854 details
hsa-miR-548t-5p LCOR ligand dependent nuclear receptor corepressor HGNC:29503 details
hsa-miR-548t-5p LASP1 LIM and SH3 protein 1 HGNC:6513 details
hsa-miR-548t-5p KPNA2 karyopherin subunit alpha 2 HGNC:6395 details
hsa-miR-548t-5p KLHL28 kelch like family member 28 HGNC:19741 details
hsa-miR-548t-5p KDM5B lysine demethylase 5B HGNC:18039 details
hsa-miR-548t-5p GNS glucosamine (N-acetyl)-6-sulfatase HGNC:4422 details
hsa-miR-548t-5p GID4 GID complex subunit 4 homolog HGNC:28453 details
hsa-miR-548t-5p CSNK1A1 casein kinase 1 alpha 1 HGNC:2451 details
hsa-miR-548t-5p CCDC86 coiled-coil domain containing 86 HGNC:28359 details
hsa-miR-548t-5p BBX BBX high mobility group box domain containing HGNC:14422 details
hsa-miR-548t-5p ARPC5 actin related protein 2/3 complex subunit 5 HGNC:708 details
hsa-miR-548t-5p ARHGAP1 Rho GTPase activating protein 1 HGNC:673 details
hsa-miR-548t-5p ANKRD50 ankyrin repeat domain 50 HGNC:29223 details
hsa-miR-548t-5p ZNF652 zinc finger protein 652 HGNC:29147 details
hsa-miR-548t-5p SOX4 SRY-box transcription factor 4 HGNC:11200 details
hsa-miR-548t-5p MYO1D myosin ID HGNC:7598 details
hsa-miR-548t-5p ARID4B AT-rich interaction domain 4B HGNC:15550 details
hsa-miR-548t-5p CNOT4 CCR4-NOT transcription complex subunit 4 HGNC:7880 details
hsa-miR-548t-5p EFNA2 ephrin A2 HGNC:3222 details
hsa-miR-548t-5p PDRG1 p53 and DNA damage regulated 1 HGNC:16119 details
hsa-miR-548t-5p YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta HGNC:12855 details
hsa-miR-548t-5p UGCG UDP-glucose ceramide glucosyltransferase HGNC:12524 details
hsa-miR-548t-5p NAA50 N-alpha-acetyltransferase 50, NatE catalytic subunit HGNC:29533 details
hsa-miR-548t-5p ZNF99 zinc finger protein 99 HGNC:13175 details
hsa-miR-548t-5p GPM6A glycoprotein M6A HGNC:4460 details
hsa-miR-548t-5p C3orf38 chromosome 3 open reading frame 38 HGNC:28384 details
hsa-miR-548t-5p ZBTB4 zinc finger and BTB domain containing 4 HGNC:23847 details
hsa-miR-548t-5p TRIM37 tripartite motif containing 37 HGNC:7523 details
hsa-miR-548t-5p SUCO SUN domain containing ossification factor HGNC:1240 details
hsa-miR-548t-5p SLC12A5 solute carrier family 12 member 5 HGNC:13818 details
hsa-miR-548t-5p SKIL SKI like proto-oncogene HGNC:10897 details
hsa-miR-548t-5p SECISBP2L SECIS binding protein 2 like HGNC:28997 details
hsa-miR-548t-5p IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-548t-5p EEF2 eukaryotic translation elongation factor 2 HGNC:3214 details
hsa-miR-548t-5p DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 HGNC:6968 details
hsa-miR-548t-5p ZNF12 zinc finger protein 12 HGNC:12902 details
hsa-miR-548t-5p ZNF180 zinc finger protein 180 HGNC:12970 details
hsa-miR-548t-5p CEP104 centrosomal protein 104 HGNC:24866 details
hsa-miR-548t-5p ZC3H12C zinc finger CCCH-type containing 12C HGNC:29362 details
hsa-miR-548t-5p QKI QKI, KH domain containing RNA binding HGNC:21100 details
hsa-miR-548t-5p PHTF2 putative homeodomain transcription factor 2 HGNC:13411 details
hsa-miR-548t-5p MORF4L1 mortality factor 4 like 1 HGNC:16989 details
hsa-miR-548t-5p PCLAF PCNA clamp associated factor HGNC:28961 details
hsa-miR-548t-5p KBTBD8 kelch repeat and BTB domain containing 8 HGNC:30691 details
hsa-miR-548t-5p SINHCAF SIN3-HDAC complex associated factor HGNC:30702 details
hsa-miR-548t-5p details
hsa-miR-548t-5p E2F7 E2F transcription factor 7 HGNC:23820 details
hsa-miR-548t-5p E2F3 E2F transcription factor 3 HGNC:3115 details
hsa-miR-548t-5p BNIP2 BCL2 interacting protein 2 HGNC:1083 details
hsa-miR-548t-5p ZNF850 zinc finger protein 850 HGNC:27994 details
hsa-miR-548t-5p SMAD4 SMAD family member 4 HGNC:6770 details
hsa-miR-548t-5p SGMS2 sphingomyelin synthase 2 HGNC:28395 details
hsa-miR-548t-5p SENP3 SUMO specific peptidase 3 HGNC:17862 details
hsa-miR-548t-5p RAN RAN, member RAS oncogene family HGNC:9846 details
hsa-miR-548t-5p NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-548t-5p NABP1 nucleic acid binding protein 1 HGNC:26232 details
hsa-miR-548t-5p FNBP1L formin binding protein 1 like HGNC:20851 details
hsa-miR-548t-5p RBM20 RNA binding motif protein 20 HGNC:27424 details
hsa-miR-548t-5p PKNOX1 PBX/knotted 1 homeobox 1 HGNC:9022 details
hsa-miR-548t-5p PEX5L peroxisomal biogenesis factor 5 like HGNC:30024 details
hsa-miR-548t-5p GRB10 growth factor receptor bound protein 10 HGNC:4564 details
hsa-miR-548t-5p LAPTM4B lysosomal protein transmembrane 4 beta HGNC:13646 details
hsa-miR-548t-5p ITM2C integral membrane protein 2C HGNC:6175 details
hsa-miR-548t-5p SOCS5 suppressor of cytokine signaling 5 HGNC:16852 details
hsa-miR-548t-5p RRAGD Ras related GTP binding D HGNC:19903 details
hsa-miR-548t-5p RAB9A RAB9A, member RAS oncogene family HGNC:9792 details
hsa-miR-548t-5p NR2F6 nuclear receptor subfamily 2 group F member 6 HGNC:7977 details
hsa-miR-548t-5p ID2 inhibitor of DNA binding 2 HGNC:5361 details
hsa-miR-548t-5p details
hsa-miR-548t-5p DONSON DNA replication fork stabilization factor DONSON HGNC:2993 details
hsa-miR-548t-5p CRIM1 cysteine rich transmembrane BMP regulator 1 HGNC:2359 details
hsa-miR-548t-5p CDCA4 cell division cycle associated 4 HGNC:14625 details
hsa-miR-548t-5p TPK1 thiamin pyrophosphokinase 1 HGNC:17358 details
hsa-miR-548t-5p RBM4B RNA binding motif protein 4B HGNC:28842 details
hsa-miR-548t-5p TMEM196 transmembrane protein 196 HGNC:22431 details
hsa-miR-548t-5p ZMYM1 zinc finger MYM-type containing 1 HGNC:26253 details
hsa-miR-548t-5p CCNB1 cyclin B1 HGNC:1579 details
hsa-miR-548t-5p YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon HGNC:12851 details
hsa-miR-548t-5p UNK unk zinc finger HGNC:29369 details
hsa-miR-548t-5p TNRC6A trinucleotide repeat containing adaptor 6A HGNC:11969 details
hsa-miR-548t-5p TIMM17A translocase of inner mitochondrial membrane 17A HGNC:17315 details
hsa-miR-548t-5p STC2 stanniocalcin 2 HGNC:11374 details
hsa-miR-548t-5p SLC7A11 solute carrier family 7 member 11 HGNC:11059 details
hsa-miR-548t-5p SALL3 spalt like transcription factor 3 HGNC:10527 details
hsa-miR-548t-5p PYGO1 pygopus family PHD finger 1 HGNC:30256 details
hsa-miR-548t-5p PTBP2 polypyrimidine tract binding protein 2 HGNC:17662 details
hsa-miR-548t-5p PRKAR1A protein kinase cAMP-dependent type I regulatory subunit alpha HGNC:9388 details
hsa-miR-548t-5p PANX1 pannexin 1 HGNC:8599 details
hsa-miR-548t-5p MCMBP minichromosome maintenance complex binding protein HGNC:25782 details
hsa-miR-548t-5p MAP4K5 mitogen-activated protein kinase kinase kinase kinase 5 HGNC:6867 details
hsa-miR-548t-5p LIMA1 LIM domain and actin binding 1 HGNC:24636 details
hsa-miR-548t-5p KMT2B lysine methyltransferase 2B HGNC:15840 details
hsa-miR-548t-5p KLF3 Kruppel like factor 3 HGNC:16516 details
hsa-miR-548t-5p TMEM131L transmembrane 131 like HGNC:29146 details
hsa-miR-548t-5p JMJD1C jumonji domain containing 1C HGNC:12313 details
hsa-miR-548t-5p HMBOX1 homeobox containing 1 HGNC:26137 details
hsa-miR-548t-5p GPR176 G protein-coupled receptor 176 HGNC:32370 details
hsa-miR-548t-5p FCHO2 FCH and mu domain containing endocytic adaptor 2 HGNC:25180 details
hsa-miR-548t-5p ELL2 elongation factor for RNA polymerase II 2 HGNC:17064 details
hsa-miR-548t-5p DPYSL2 dihydropyrimidinase like 2 HGNC:3014 details
hsa-miR-548t-5p CLOCK clock circadian regulator HGNC:2082 details
hsa-miR-548t-5p BTG1 BTG anti-proliferation factor 1 HGNC:1130 details
hsa-miR-548t-5p BTBD9 BTB domain containing 9 HGNC:21228 details
hsa-miR-548t-5p AVL9 AVL9 cell migration associated HGNC:28994 details
hsa-miR-548t-5p AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-548t-5p ADAT2 adenosine deaminase tRNA specific 2 HGNC:21172 details
hsa-miR-548t-5p SLC25A36 solute carrier family 25 member 36 HGNC:25554 details
hsa-miR-548t-5p PGK1 phosphoglycerate kinase 1 HGNC:8896 details
hsa-miR-548t-5p IFNGR1 interferon gamma receptor 1 HGNC:5439 details
hsa-miR-548t-5p EGLN1 egl-9 family hypoxia inducible factor 1 HGNC:1232 details
hsa-miR-548t-5p PTBP1 polypyrimidine tract binding protein 1 HGNC:9583 details
hsa-miR-548t-5p CSDE1 cold shock domain containing E1 HGNC:29905 details
hsa-miR-548t-5p NDRG1 N-myc downstream regulated 1 HGNC:7679 details
hsa-miR-548t-5p ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif 9 HGNC:13202 details
hsa-miR-548t-5p TRIAP1 TP53 regulated inhibitor of apoptosis 1 HGNC:26937 details
hsa-miR-548t-5p TPRG1L tumor protein p63 regulated 1 like HGNC:27007 details
hsa-miR-548t-5p SMOC1 SPARC related modular calcium binding 1 HGNC:20318 details
hsa-miR-548t-5p RLIM ring finger protein, LIM domain interacting HGNC:13429 details
hsa-miR-548t-5p NETO2 neuropilin and tolloid like 2 HGNC:14644 details
hsa-miR-548t-5p KATNAL1 katanin catalytic subunit A1 like 1 HGNC:28361 details
hsa-miR-548t-5p EPHA4 EPH receptor A4 HGNC:3388 details
hsa-miR-548t-5p DR1 down-regulator of transcription 1 HGNC:3017 details
hsa-miR-548t-5p BRIX1 biogenesis of ribosomes BRX1 HGNC:24170 details
hsa-miR-548t-5p BCLAF1 BCL2 associated transcription factor 1 HGNC:16863 details
hsa-miR-548t-5p ARHGAP12 Rho GTPase activating protein 12 HGNC:16348 details
hsa-miR-548t-5p ACSL4 acyl-CoA synthetase long chain family member 4 HGNC:3571 details
hsa-miR-548t-5p ZNF107 zinc finger protein 107 HGNC:12887 details
hsa-miR-548t-5p MED21 mediator complex subunit 21 HGNC:11473 details
hsa-miR-548t-5p DUSP3 dual specificity phosphatase 3 HGNC:3069 details
hsa-miR-548t-5p ZCCHC2 zinc finger CCHC-type containing 2 HGNC:22916 details
hsa-miR-548t-5p YTHDC1 YTH domain containing 1 HGNC:30626 details
hsa-miR-548t-5p TSC22D2 TSC22 domain family member 2 HGNC:29095 details
hsa-miR-548t-5p STK11IP serine/threonine kinase 11 interacting protein HGNC:19184 details
hsa-miR-548t-5p SIX4 SIX homeobox 4 HGNC:10890 details
hsa-miR-548t-5p SIPA1L2 signal induced proliferation associated 1 like 2 HGNC:23800 details
hsa-miR-548t-5p RAB5C RAB5C, member RAS oncogene family HGNC:9785 details
hsa-miR-548t-5p PPP6R3 protein phosphatase 6 regulatory subunit 3 HGNC:1173 details
hsa-miR-548t-5p OCLN occludin HGNC:8104 details
hsa-miR-548t-5p MCC MCC regulator of WNT signaling pathway HGNC:6935 details
hsa-miR-548t-5p HOXB3 homeobox B3 HGNC:5114 details
hsa-miR-548t-5p GNPTAB N-acetylglucosamine-1-phosphate transferase subunits alpha and beta HGNC:29670 details
hsa-miR-548t-5p EFCAB14 EF-hand calcium binding domain 14 HGNC:29051 details
hsa-miR-548t-5p DHX33 DEAH-box helicase 33 HGNC:16718 details
hsa-miR-548t-5p C19orf47 chromosome 19 open reading frame 47 HGNC:26723 details
hsa-miR-548t-5p COMMD3-BMI1 COMMD3-BMI1 readthrough HGNC:48326 details
hsa-miR-548t-5p ATRAID all-trans retinoic acid induced differentiation factor HGNC:24090 details
hsa-miR-548t-5p BMI1 BMI1 proto-oncogene, polycomb ring finger HGNC:1066 details
hsa-miR-548t-5p ZWINT ZW10 interacting kinetochore protein HGNC:13195 details
hsa-miR-548t-5p YY1 YY1 transcription factor HGNC:12856 details
hsa-miR-548t-5p LSM12 LSM12 homolog HGNC:26407 details
hsa-miR-548t-5p HMGB2 high mobility group box 2 HGNC:5000 details
hsa-miR-548t-5p ZNF714 zinc finger protein 714 HGNC:27124 details
hsa-miR-548t-5p DCK deoxycytidine kinase HGNC:2704 details
hsa-miR-548t-5p CDCA8 cell division cycle associated 8 HGNC:14629 details
hsa-miR-548t-5p AKAP17A A-kinase anchoring protein 17A HGNC:18783 details
hsa-miR-548t-5p details
hsa-miR-548t-5p CEBPB CCAAT enhancer binding protein beta HGNC:1834 details
hsa-miR-548t-5p ASB1 ankyrin repeat and SOCS box containing 1 HGNC:16011 details
hsa-miR-548t-5p ZBTB7A zinc finger and BTB domain containing 7A HGNC:18078 details
hsa-miR-548t-5p SMG1 SMG1 nonsense mediated mRNA decay associated PI3K related kinase HGNC:30045 details
hsa-miR-548t-5p SESN3 sestrin 3 HGNC:23060 details
hsa-miR-548t-5p NHS NHS actin remodeling regulator HGNC:7820 details
hsa-miR-548t-5p PPP2R2A protein phosphatase 2 regulatory subunit Balpha HGNC:9304 details
hsa-miR-548t-5p NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit HGNC:21042 details
hsa-miR-548t-5p NFATC3 nuclear factor of activated T cells 3 HGNC:7777 details
hsa-miR-548t-5p MYLIP myosin regulatory light chain interacting protein HGNC:21155 details
hsa-miR-548t-5p ITGB1 integrin subunit beta 1 HGNC:6153 details
hsa-miR-548t-5p IGFBP5 insulin like growth factor binding protein 5 HGNC:5474 details
hsa-miR-548t-5p DGAT2 diacylglycerol O-acyltransferase 2 HGNC:16940 details
hsa-miR-548t-5p CLIP4 CAP-Gly domain containing linker protein family member 4 HGNC:26108 details
hsa-miR-548t-5p CCDC6 coiled-coil domain containing 6 HGNC:18782 details
hsa-miR-548t-5p BICD2 BICD cargo adaptor 2 HGNC:17208 details
hsa-miR-548t-5p RGS5 regulator of G protein signaling 5 HGNC:10001 details
hsa-miR-548t-5p SHH sonic hedgehog signaling molecule HGNC:10848 details
hsa-miR-548t-5p RBM12B RNA binding motif protein 12B HGNC:32310 details
hsa-miR-548t-5p GPR137B G protein-coupled receptor 137B HGNC:11862 details
hsa-miR-548t-5p DESI1 desumoylating isopeptidase 1 HGNC:24577 details
hsa-miR-548t-5p CAMLG calcium modulating ligand HGNC:1471 details
hsa-miR-548t-5p RPAP2 RNA polymerase II associated protein 2 HGNC:25791 details
hsa-miR-548t-5p SH3KBP1 SH3 domain containing kinase binding protein 1 HGNC:13867 details
hsa-miR-548t-5p TM4SF5 transmembrane 4 L six family member 5 HGNC:11857 details
hsa-miR-548t-5p ATAT1 alpha tubulin acetyltransferase 1 HGNC:21186 details
hsa-miR-548t-5p KCNE4 potassium voltage-gated channel subfamily E regulatory subunit 4 HGNC:6244 details
hsa-miR-548t-5p SOWAHA sosondowah ankyrin repeat domain family member A HGNC:27033 details
hsa-miR-548t-5p ZNF429 zinc finger protein 429 HGNC:20817 details
hsa-miR-548t-5p SLC35B3 solute carrier family 35 member B3 HGNC:21601 details
hsa-miR-548t-5p ERP44 endoplasmic reticulum protein 44 HGNC:18311 details
hsa-miR-548t-5p BMPR1A bone morphogenetic protein receptor type 1A HGNC:1076 details
hsa-miR-548t-5p NT5DC1 5'-nucleotidase domain containing 1 HGNC:21556 details
hsa-miR-548t-5p FZD8 frizzled class receptor 8 HGNC:4046 details
hsa-miR-548t-5p ATXN3 ataxin 3 HGNC:7106 details
hsa-miR-548t-5p ARL4C ADP ribosylation factor like GTPase 4C HGNC:698 details
hsa-miR-548t-5p DHODH dihydroorotate dehydrogenase (quinone) HGNC:2867 details
hsa-miR-548t-5p RPF2 ribosome production factor 2 homolog HGNC:20870 details
hsa-miR-548t-5p RBMXL1 RBMX like 1 HGNC:25073 details
hsa-miR-548t-5p CD300LG CD300 molecule like family member g HGNC:30455 details
hsa-miR-548t-5p THAP6 THAP domain containing 6 HGNC:23189 details
hsa-miR-548t-5p PTDSS2 phosphatidylserine synthase 2 HGNC:15463 details
hsa-miR-548t-5p AQP3 aquaporin 3 (Gill blood group) HGNC:636 details
hsa-miR-548t-5p PACRGL parkin coregulated like HGNC:28442 details
hsa-miR-548t-5p LEPROT leptin receptor overlapping transcript HGNC:29477 details
hsa-miR-548t-5p HERPUD2 HERPUD family member 2 HGNC:21915 details
hsa-miR-548t-5p details
hsa-miR-548t-5p APOL4 apolipoprotein L4 HGNC:14867 details
hsa-miR-548t-5p PCNX2 pecanex 2 HGNC:8736 details
hsa-miR-548t-5p CRIPT CXXC repeat containing interactor of PDZ3 domain HGNC:14312 details
hsa-miR-548t-5p ZMAT1 zinc finger matrin-type 1 HGNC:29377 details
hsa-miR-548t-5p TOGARAM2 TOG array regulator of axonemal microtubules 2 HGNC:33715 details
hsa-miR-548t-5p GOLGA2 golgin A2 HGNC:4425 details
hsa-miR-548t-5p details
hsa-miR-548t-5p PPP1R3F protein phosphatase 1 regulatory subunit 3F HGNC:14944 details
hsa-miR-548t-5p EREG epiregulin HGNC:3443 details
hsa-miR-548t-5p KLF13 Kruppel like factor 13 HGNC:13672 details
hsa-miR-548t-5p PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma HGNC:23786 details
hsa-miR-548t-5p PPP1R18 protein phosphatase 1 regulatory subunit 18 HGNC:29413 details
hsa-miR-548t-5p PRRC2B proline rich coiled-coil 2B HGNC:28121 details
hsa-miR-548t-5p EVC EvC ciliary complex subunit 1 HGNC:3497 details
hsa-miR-548t-5p HCCS holocytochrome c synthase HGNC:4837 details
hsa-miR-548t-5p NDNF neuron derived neurotrophic factor HGNC:26256 details
hsa-miR-548t-5p FGF23 fibroblast growth factor 23 HGNC:3680 details
hsa-miR-548t-5p SON SON DNA and RNA binding protein HGNC:11183 details
hsa-miR-548t-5p PFKFB3 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 HGNC:8874 details
hsa-miR-548t-5p STON2 stonin 2 HGNC:30652 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab