miRNA Card

miRNA General Information
miRNA ID hsa-miR-548w
Description Homo sapiens miR-548w stem-loop
Comment None
Experiment Illumina [1]
Sequence AAAAGUAACUGCGGUUUUUGCCU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr1:2403539|2403625 hsa-miR-548w 1 0 0
chr9:134844189|134844349 hsa-miR-548w 0 1 0
chr6:21596057|21596219 hsa-miR-548w 0 1 0
chr7:157682725|157682937 hsa-miR-548w 0 1 0
chr15:40569694|40569789 hsa-miR-548w 0 1 0
chr3:71198202|71198392 hsa-miR-548w 0 1 0
chr9:134844150|134844349 hsa-miR-548w 0 1 0
chr6:21596062|21596219 hsa-miR-548w 0 1 0
chr4:54739728|54739854 hsa-miR-548w 0 1 0
chrX:81276984|81278411 hsa-miR-548w 0 1 0
chr3:179397647|179397764 hsa-miR-548w 0 1 0
chr11:46674099|46674404 hsa-miR-548w 1 0 0
chr5:168506158|168506831 hsa-miR-548w 0 1 0
chr9:134844172|134844349 hsa-miR-548w 0 1 0
chr16:69118999|69119151 hsa-miR-548w 0 1 0
chr1:214331830|214331948 hsa-miR-548w 0 1 0
chr2:241353529|241353622 hsa-miR-548w 0 1 0
chr1:151034039|151034168 hsa-miR-548w 0 1 0
chr9:134844141|134844349 hsa-miR-548w 0 1 0
chr17:28592402|28592553 hsa-miR-548w 0 1 0
chr1:221742057|221742292 hsa-miR-548w 0 1 0
chr1:222652002|222652332 hsa-miR-548w 0 1 0
chr16:23467438|23467664 hsa-miR-548w 0 1 0
chr14:20801417|20801586 hsa-miR-548w 0 1 0
chr18:9547362|9547501 hsa-miR-548w 0 1 0
chr2:24790332|24790455 hsa-miR-548w 0 1 0
chr5:168506722|168506831 hsa-miR-548w 0 1 0
chr17:7484447|7484623 hsa-miR-548w 0 1 0
chr16:69756780|69756976 hsa-miR-548w 0 1 0
chr1:107867614|107867706 hsa-miR-548w 0 1 0
chr6:21596046|21596219 hsa-miR-548w 0 1 0
chr17:15261749~15261918 hsa-miR-548w 0 1 0
chr20:49633737~49633942 hsa-miR-548w 0 1 0
chr7:157682725~157682937 hsa-miR-548w 0 1 0
chrX:81276984~81278411 hsa-miR-548w 0 1 0
chr9:134844189~134844349 hsa-miR-548w 0 1 0
chr13:32402982~32403150 hsa-miR-548w 0 1 0
chr3:179397647~179397764 hsa-miR-548w 0 1 0
chr11:32978168~32978326 hsa-miR-548w 0 1 0
chr1:25900191~25900449 hsa-miR-548w 0 1 0
chr9:131237807|131238006 hsa-miR-548w 1 0 0
chr21:46597718|46597850 hsa-miR-548w 0 1 0
chr16:69756756|69756951 hsa-miR-548w 0 1 0
chr10:48828976|48829196 hsa-miR-548w 0 1 0
chr16:11095974|11096173 hsa-miR-548w 0 1 0
chr7:75105931|75106087 hsa-miR-548w 0 1 0
chr2:241353529|241353776 hsa-miR-548w 0 1 0
chr3:128627384|128627473 hsa-miR-548w 0 1 0
chr6:7161209|7161369 hsa-miR-548w 0 1 0
chr8:37843088|37843271 hsa-miR-548w 0 1 0
chr1:41012388|41012472 hsa-miR-548w 0 1 0
chr7:76354557|76354666 hsa-miR-548w 0 1 0
chr1:207027224|207027309 hsa-miR-548w 1 0 0
chr10:29421355|29421500 hsa-miR-548w 1 0 0
chr6:21596040|21596219 hsa-miR-548w 0 1 0
chr7:155776859|155777017 hsa-miR-548w 0 1 0
chr7:6461206|6461413 hsa-miR-548w 0 1 0
chr11:66216243|66216611 hsa-miR-548w 0 1 0
chr6:127289424|127289571 hsa-miR-548w 0 1 0
chr5:10239214|10239356 hsa-miR-548w 0 1 0
chr2:27365715|27365839 hsa-miR-548w 0 1 0
chr14:64747843|64747940 hsa-miR-548w 0 1 0
chr11:3003111|3003217 hsa-miR-548w 0 1 0
chr9:134844169|134844349 hsa-miR-548w 0 1 0
chr5:94628902|94629167 hsa-miR-548w 0 1 0
chr6:36602287|36602456 hsa-miR-548w 0 1 0
chr11:106939701|106939819 hsa-miR-548w 0 1 0
chr14:94378383|94378544 hsa-miR-548w 0 1 0
chr3:141925804|141925907 hsa-miR-548w 0 1 0
chr7:93881811|93882004 hsa-miR-548w 0 1 0
chr14:89350446|89350589 hsa-miR-548w 0 1 0
chr16:70160511|70160739 hsa-miR-548w 0 1 0
chr7:6461222|6461330 hsa-miR-548w 0 1 0
chr14:20801436|20801596 hsa-miR-548w 0 1 0
chr18:9547348|9547511 hsa-miR-548w 0 1 0
chr11:33077813|33077928 hsa-miR-548w 0 1 0
chr6:112082705|112083010 hsa-miR-548w 0 1 0
chr6:127289452|127289566 hsa-miR-548w 0 1 0
chr6:127289424|127289584 hsa-miR-548w 0 1 0
chr4:170096493|170096599 hsa-miR-548w 0 1 0
chr19:37827419|37827546 hsa-miR-548w 0 1 0
chr9:99959917|99960155 hsa-miR-548w 0 1 0
chr11:33077811|33077928 hsa-miR-548w 0 1 0
chr6:36602287|36602500 hsa-miR-548w 0 1 0
chr14:93184194|93184352 hsa-miR-548w 0 1 0
chr6:21596055|21596219 hsa-miR-548w 0 1 0
chr14:94378383|94378628 hsa-miR-548w 0 1 0
chr17:39557639|39557769 hsa-miR-548w 0 1 0
chr2:151493353|151493445 hsa-miR-548w 0 1 0
chr12:110347240|110347453 hsa-miR-548w 0 1 0
chr4:145557110|145557287 hsa-miR-548w 0 1 0
chrX:108078226|108078362 hsa-miR-548w 0 1 0
chr17:7484434|7484623 hsa-miR-548w 0 1 0
chr8:61606937|61607082 hsa-miR-548w 0 1 0
chr17:78991765|78991892 hsa-miR-548w 0 1 0
chr1:174999494|174999648 hsa-miR-548w 0 1 0
chr8:85215981|85216110 hsa-miR-548w -9 1 0
chr2:127702434|127702591 hsa-miR-548w -12 1 0
chr17:48728732|48728864 hsa-miR-548w 1 0 0
chr3:40465576|40465882 hsa-miR-548w 0 1 0
chr10:246439|246703 hsa-miR-548w 0 1 0
chr6:21595997|21596219 hsa-miR-548w 0 1 0
chr11:66216223|66216611 hsa-miR-548w 0 1 0
chr22:39131644|39131747 hsa-miR-548w 0 1 0
chr20:49633748|49633960 hsa-miR-548w 0 1 0
chr5:5468839|5468949 hsa-miR-548w 0 1 0
chr5:14290803|14290899 hsa-miR-548w 0 1 0
chr1:182887421|182887554 hsa-miR-548w 0 1 0
chr9:134844128|134844349 hsa-miR-548w 0 1 0
chr6:30723957|30724159 hsa-miR-548w 0 1 0
chr10:32271748|32271917 hsa-miR-548w 0 1 0
chr17:78991820|78992075 hsa-miR-548w 0 1 0
chr22:45620114|45620274 hsa-miR-548w 0 1 0
chr3:188881973|188882100 hsa-miR-548w 0 1 0
chr1:151034012|151034117 hsa-miR-548w 0 1 0
chr22:30906784|30907006 hsa-miR-548w 0 1 0
chr7:6461222|6461346 hsa-miR-548w 0 1 0
chr17:47118464|47118622 hsa-miR-548w 0 1 0
chr17:56997724|56997891 hsa-miR-548w 1 0 0
chr14:69571415|69571579 hsa-miR-548w 1 0 0
chr9:137211265|137211379 hsa-miR-548w 1 0 0
chr1:66373126|66373365 hsa-miR-548w 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-548w ZNRF2 zinc and ring finger 2 HGNC:22316 details
hsa-miR-548w GTF2H5 general transcription factor IIH subunit 5 HGNC:21157 details
hsa-miR-548w VLDLR very low density lipoprotein receptor HGNC:12698 details
hsa-miR-548w ZDHHC21 zinc finger DHHC-type palmitoyltransferase 21 HGNC:20750 details
hsa-miR-548w PRPS1L1 phosphoribosyl pyrophosphate synthetase 1 like 1 HGNC:9463 details
hsa-miR-548w ZNF207 zinc finger protein 207 HGNC:12998 details
hsa-miR-548w PTCHD1 patched domain containing 1 HGNC:26392 details
hsa-miR-548w NEK7 NIMA related kinase 7 HGNC:13386 details
hsa-miR-548w MCC MCC regulator of WNT signaling pathway HGNC:6935 details
hsa-miR-548w ZNF562 zinc finger protein 562 HGNC:25950 details
hsa-miR-548w MRPS5 mitochondrial ribosomal protein S5 HGNC:14498 details
hsa-miR-548w FEM1C fem-1 homolog C HGNC:16933 details
hsa-miR-548w TM6SF1 transmembrane 6 superfamily member 1 HGNC:11860 details
hsa-miR-548w SAMD8 sterile alpha motif domain containing 8 HGNC:26320 details
hsa-miR-548w PLET1 placenta expressed transcript 1 HGNC:30053 details
hsa-miR-548w SEM1 SEM1 26S proteasome subunit HGNC:10845 details
hsa-miR-548w NECTIN3 nectin cell adhesion molecule 3 HGNC:17664 details
hsa-miR-548w XRCC6 X-ray repair cross complementing 6 HGNC:4055 details
hsa-miR-548w ANKEF1 ankyrin repeat and EF-hand domain containing 1 HGNC:15803 details
hsa-miR-548w KIF2C kinesin family member 2C HGNC:6393 details
hsa-miR-548w ZBTB38 zinc finger and BTB domain containing 38 HGNC:26636 details
hsa-miR-548w YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon HGNC:12851 details
hsa-miR-548w SMAD5 SMAD family member 5 HGNC:6771 details
hsa-miR-548w PHB2 prohibitin 2 HGNC:30306 details
hsa-miR-548w PEG10 paternally expressed 10 HGNC:14005 details
hsa-miR-548w MTMR6 myotubularin related protein 6 HGNC:7453 details
hsa-miR-548w KLHL11 kelch like family member 11 HGNC:19008 details
hsa-miR-548w GTPBP2 GTP binding protein 2 HGNC:4670 details
hsa-miR-548w AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-548w ALG9 ALG9 alpha-1,2-mannosyltransferase HGNC:15672 details
hsa-miR-548w ERH ERH mRNA splicing and mitosis factor HGNC:3447 details
hsa-miR-548w FAM3C FAM3 metabolism regulating signaling molecule C HGNC:18664 details
hsa-miR-548w DDB1 damage specific DNA binding protein 1 HGNC:2717 details
hsa-miR-548w MDFIC MyoD family inhibitor domain containing HGNC:28870 details
hsa-miR-548w IPMK inositol polyphosphate multikinase HGNC:20739 details
hsa-miR-548w IL6ST interleukin 6 cytokine family signal transducer HGNC:6021 details
hsa-miR-548w CEP120 centrosomal protein 120 HGNC:26690 details
hsa-miR-548w ZBTB20 zinc finger and BTB domain containing 20 HGNC:13503 details
hsa-miR-548w PTBP2 polypyrimidine tract binding protein 2 HGNC:17662 details
hsa-miR-548w TMEM30B transmembrane protein 30B HGNC:27254 details
hsa-miR-548w SVOP SV2 related protein HGNC:25417 details
hsa-miR-548w INHBA inhibin subunit beta A HGNC:6066 details
hsa-miR-548w USP53 ubiquitin specific peptidase 53 HGNC:29255 details
hsa-miR-548w UBE2D1 ubiquitin conjugating enzyme E2 D1 HGNC:12474 details
hsa-miR-548w TRIM37 tripartite motif containing 37 HGNC:7523 details
hsa-miR-548w SPRYD4 SPRY domain containing 4 HGNC:27468 details
hsa-miR-548w SPPL2A signal peptide peptidase like 2A HGNC:30227 details
hsa-miR-548w SMG1 SMG1 nonsense mediated mRNA decay associated PI3K related kinase HGNC:30045 details
hsa-miR-548w CLIP1 CAP-Gly domain containing linker protein 1 HGNC:10461 details
hsa-miR-548w CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 HGNC:3230 details
hsa-miR-548w CDK4 cyclin dependent kinase 4 HGNC:1773 details
hsa-miR-548w CAPZA1 capping actin protein of muscle Z-line subunit alpha 1 HGNC:1488 details
hsa-miR-548w ZNF154 zinc finger protein 154 HGNC:12939 details
hsa-miR-548w LRRC55 leucine rich repeat containing 55 HGNC:32324 details
hsa-miR-548w GRM5 glutamate metabotropic receptor 5 HGNC:4597 details
hsa-miR-548w ZNF711 zinc finger protein 711 HGNC:13128 details
hsa-miR-548w YOD1 YOD1 deubiquitinase HGNC:25035 details
hsa-miR-548w RSBN1 round spermatid basic protein 1 HGNC:25642 details
hsa-miR-548w POLR1B RNA polymerase I subunit B HGNC:20454 details
hsa-miR-548w DDIT4 DNA damage inducible transcript 4 HGNC:24944 details
hsa-miR-548w NPM3 nucleophosmin/nucleoplasmin 3 HGNC:7931 details
hsa-miR-548w MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase HGNC:7434 details
hsa-miR-548w ANP32B acidic nuclear phosphoprotein 32 family member B HGNC:16677 details
hsa-miR-548w CYP20A1 cytochrome P450 family 20 subfamily A member 1 HGNC:20576 details
hsa-miR-548w TRA2B transformer 2 beta homolog HGNC:10781 details
hsa-miR-548w TM9SF3 transmembrane 9 superfamily member 3 HGNC:21529 details
hsa-miR-548w BRIX1 biogenesis of ribosomes BRX1 HGNC:24170 details
hsa-miR-548w ACTN4 actinin alpha 4 HGNC:166 details
hsa-miR-548w SHISA9 shisa family member 9 HGNC:37231 details
hsa-miR-548w ARL13B ADP ribosylation factor like GTPase 13B HGNC:25419 details
hsa-miR-548w RBM4B RNA binding motif protein 4B HGNC:28842 details
hsa-miR-548w TMEM41B transmembrane protein 41B HGNC:28948 details
hsa-miR-548w FRY FRY microtubule binding protein HGNC:20367 details
hsa-miR-548w RAB32 RAB32, member RAS oncogene family HGNC:9772 details
hsa-miR-548w SLC9A4 solute carrier family 9 member A4 HGNC:11077 details
hsa-miR-548w CCNB1 cyclin B1 HGNC:1579 details
hsa-miR-548w PANX1 pannexin 1 HGNC:8599 details
hsa-miR-548w PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 HGNC:8575 details
hsa-miR-548w IKZF5 IKAROS family zinc finger 5 HGNC:14283 details
hsa-miR-548w HMBOX1 homeobox containing 1 HGNC:26137 details
hsa-miR-548w GDE1 glycerophosphodiester phosphodiesterase 1 HGNC:29644 details
hsa-miR-548w ETNK1 ethanolamine kinase 1 HGNC:24649 details
hsa-miR-548w EFNA5 ephrin A5 HGNC:3225 details
hsa-miR-548w CSE1L chromosome segregation 1 like HGNC:2431 details
hsa-miR-548w GPC4 glypican 4 HGNC:4452 details
hsa-miR-548w HMGN2 high mobility group nucleosomal binding domain 2 HGNC:4986 details
hsa-miR-548w PEX7 peroxisomal biogenesis factor 7 HGNC:8860 details
hsa-miR-548w FAM53C family with sequence similarity 53 member C HGNC:1336 details
hsa-miR-548w SPCS3 signal peptidase complex subunit 3 HGNC:26212 details
hsa-miR-548w PARP15 poly(ADP-ribose) polymerase family member 15 HGNC:26876 details
hsa-miR-548w FAM135A family with sequence similarity 135 member A HGNC:21084 details
hsa-miR-548w XKR9 XK related 9 HGNC:20937 details
hsa-miR-548w ESYT1 extended synaptotagmin 1 HGNC:29534 details
hsa-miR-548w KLRC3 killer cell lectin like receptor C3 HGNC:6376 details
hsa-miR-548w METTL8 methyltransferase 8, methylcytidine HGNC:25856 details
hsa-miR-548w SH3BGRL SH3 domain binding glutamate rich protein like HGNC:10823 details
hsa-miR-548w ANGPTL3 angiopoietin like 3 HGNC:491 details
hsa-miR-548w PTBP1 polypyrimidine tract binding protein 1 HGNC:9583 details
hsa-miR-548w ACSM2B acyl-CoA synthetase medium chain family member 2B HGNC:30931 details
hsa-miR-548w PRELID1 PRELI domain containing 1 HGNC:30255 details
hsa-miR-548w details
hsa-miR-548w SPC25 SPC25 component of NDC80 kinetochore complex HGNC:24031 details
hsa-miR-548w GIMAP4 GTPase, IMAP family member 4 HGNC:21872 details
hsa-miR-548w WBP4 WW domain binding protein 4 HGNC:12739 details
hsa-miR-548w SLC5A3 solute carrier family 5 member 3 HGNC:11038 details
hsa-miR-548w SIK1 salt inducible kinase 1 HGNC:11142 details
hsa-miR-548w PTP4A1 protein tyrosine phosphatase 4A1 HGNC:9634 details
hsa-miR-548w PDE12 phosphodiesterase 12 HGNC:25386 details
hsa-miR-548w KPNA1 karyopherin subunit alpha 1 HGNC:6394 details
hsa-miR-548w KATNAL1 katanin catalytic subunit A1 like 1 HGNC:28361 details
hsa-miR-548w G3BP1 G3BP stress granule assembly factor 1 HGNC:30292 details
hsa-miR-548w FOXN2 forkhead box N2 HGNC:5281 details
hsa-miR-548w DR1 down-regulator of transcription 1 HGNC:3017 details
hsa-miR-548w CRNKL1 crooked neck pre-mRNA splicing factor 1 HGNC:15762 details
hsa-miR-548w CHEK2 checkpoint kinase 2 HGNC:16627 details
hsa-miR-548w RPL7L1 ribosomal protein L7 like 1 HGNC:21370 details
hsa-miR-548w TMEM241 transmembrane protein 241 HGNC:31723 details
hsa-miR-548w MKLN1 muskelin 1 HGNC:7109 details
hsa-miR-548w XIAP X-linked inhibitor of apoptosis HGNC:592 details
hsa-miR-548w UBE2H ubiquitin conjugating enzyme E2 H HGNC:12484 details
hsa-miR-548w UBE2D2 ubiquitin conjugating enzyme E2 D2 HGNC:12475 details
hsa-miR-548w SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein HGNC:16918 details
hsa-miR-548w SIX4 SIX homeobox 4 HGNC:10890 details
hsa-miR-548w RGPD4 RANBP2 like and GRIP domain containing 4 HGNC:32417 details
hsa-miR-548w PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 HGNC:30483 details
hsa-miR-548w MAP2K4 mitogen-activated protein kinase kinase 4 HGNC:6844 details
hsa-miR-548w LIPA lipase A, lysosomal acid type HGNC:6617 details
hsa-miR-548w KLHL28 kelch like family member 28 HGNC:19741 details
hsa-miR-548w KLF7 Kruppel like factor 7 HGNC:6350 details
hsa-miR-548w HPRT1 hypoxanthine phosphoribosyltransferase 1 HGNC:5157 details
hsa-miR-548w HOXA13 homeobox A13 HGNC:5102 details
hsa-miR-548w GPR27 G protein-coupled receptor 27 HGNC:4482 details
hsa-miR-548w ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase family member 5 HGNC:13717 details
hsa-miR-548w details
hsa-miR-548w ABHD5 abhydrolase domain containing 5, lysophosphatidic acid acyltransferase HGNC:21396 details
hsa-miR-548w COMMD3-BMI1 COMMD3-BMI1 readthrough HGNC:48326 details
hsa-miR-548w BMI1 BMI1 proto-oncogene, polycomb ring finger HGNC:1066 details
hsa-miR-548w ZWINT ZW10 interacting kinetochore protein HGNC:13195 details
hsa-miR-548w YAP1 Yes1 associated transcriptional regulator HGNC:16262 details
hsa-miR-548w ZBTB43 zinc finger and BTB domain containing 43 HGNC:17908 details
hsa-miR-548w MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils HGNC:29383 details
hsa-miR-548w MFSD9 major facilitator superfamily domain containing 9 HGNC:28158 details
hsa-miR-548w CBX3 chromobox 3 HGNC:1553 details
hsa-miR-548w TNIP2 TNFAIP3 interacting protein 2 HGNC:19118 details
hsa-miR-548w BBS10 Bardet-Biedl syndrome 10 HGNC:26291 details
hsa-miR-548w KIF3A kinesin family member 3A HGNC:6319 details
hsa-miR-548w TBC1D13 TBC1 domain family member 13 HGNC:25571 details
hsa-miR-548w KIAA1586 KIAA1586 HGNC:21360 details
hsa-miR-548w THRAP3 thyroid hormone receptor associated protein 3 HGNC:22964 details
hsa-miR-548w NHS NHS actin remodeling regulator HGNC:7820 details
hsa-miR-548w RCC2 regulator of chromosome condensation 2 HGNC:30297 details
hsa-miR-548w RAB8B RAB8B, member RAS oncogene family HGNC:30273 details
hsa-miR-548w PRRC1 proline rich coiled-coil 1 HGNC:28164 details
hsa-miR-548w PLAGL2 PLAG1 like zinc finger 2 HGNC:9047 details
hsa-miR-548w LEPROT leptin receptor overlapping transcript HGNC:29477 details
hsa-miR-548w HSP90AA1 heat shock protein 90 alpha family class A member 1 HGNC:5253 details
hsa-miR-548w GRPEL2 GrpE like 2, mitochondrial HGNC:21060 details
hsa-miR-548w FOXK1 forkhead box K1 HGNC:23480 details
hsa-miR-548w CLDN12 claudin 12 HGNC:2034 details
hsa-miR-548w BACH1 BTB domain and CNC homolog 1 HGNC:935 details
hsa-miR-548w MPZL1 myelin protein zero like 1 HGNC:7226 details
hsa-miR-548w CCDC80 coiled-coil domain containing 80 HGNC:30649 details
hsa-miR-548w VDAC2 voltage dependent anion channel 2 HGNC:12672 details
hsa-miR-548w ZNF724 zinc finger protein 724 HGNC:32460 details
hsa-miR-548w KHSRP KH-type splicing regulatory protein HGNC:6316 details
hsa-miR-548w MAP2K1 mitogen-activated protein kinase kinase 1 HGNC:6840 details
hsa-miR-548w SMIM15 small integral membrane protein 15 HGNC:33861 details
hsa-miR-548w EBNA1BP2 EBNA1 binding protein 2 HGNC:15531 details
hsa-miR-548w PRKG2 protein kinase cGMP-dependent 2 HGNC:9416 details
hsa-miR-548w PLEKHG7 pleckstrin homology and RhoGEF domain containing G7 HGNC:33829 details
hsa-miR-548w KDM5A lysine demethylase 5A HGNC:9886 details
hsa-miR-548w CTCFL CCCTC-binding factor like HGNC:16234 details
hsa-miR-548w LYRM2 LYR motif containing 2 HGNC:25229 details
hsa-miR-548w CLDN16 claudin 16 HGNC:2037 details
hsa-miR-548w MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 HGNC:7432 details
hsa-miR-548w ITGB8 integrin subunit beta 8 HGNC:6163 details
hsa-miR-548w SLC43A3 solute carrier family 43 member 3 HGNC:17466 details
hsa-miR-548w MKI67 marker of proliferation Ki-67 HGNC:7107 details
hsa-miR-548w AQP3 aquaporin 3 (Gill blood group) HGNC:636 details
hsa-miR-548w PCGF5 polycomb group ring finger 5 HGNC:28264 details
hsa-miR-548w RYBP RING1 and YY1 binding protein HGNC:10480 details
hsa-miR-548w ZBTB37 zinc finger and BTB domain containing 37 HGNC:28365 details
hsa-miR-548w SETD7 SET domain containing 7, histone lysine methyltransferase HGNC:30412 details
hsa-miR-548w SDAD1 SDA1 domain containing 1 HGNC:25537 details
hsa-miR-548w NACC2 NACC family member 2 HGNC:23846 details
hsa-miR-548w PKD1 polycystin 1, transient receptor potential channel interacting HGNC:9008 details
hsa-miR-548w PPP1R18 protein phosphatase 1 regulatory subunit 18 HGNC:29413 details
hsa-miR-548w PTPN1 protein tyrosine phosphatase non-receptor type 1 HGNC:9642 details
hsa-miR-548w SDE2 SDE2 telomere maintenance homolog HGNC:26643 details
hsa-miR-548w UHMK1 U2AF homology motif kinase 1 HGNC:19683 details
hsa-miR-548w CD47 CD47 molecule HGNC:1682 details
hsa-miR-548w CDKL2 cyclin dependent kinase like 2 HGNC:1782 details
hsa-miR-548w RBMS2 RNA binding motif single stranded interacting protein 2 HGNC:9909 details
hsa-miR-548w RDH11 retinol dehydrogenase 11 HGNC:17964 details
hsa-miR-548w TPRA1 transmembrane protein adipocyte associated 1 HGNC:30413 details
hsa-miR-548w ZMPSTE24 zinc metallopeptidase STE24 HGNC:12877 details
hsa-miR-548w AKAP11 A-kinase anchoring protein 11 HGNC:369 details
hsa-miR-548w TIAF1 TGFB1-induced anti-apoptotic factor 1 HGNC:11803 details
hsa-miR-548w ZNF395 zinc finger protein 395 HGNC:18737 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab