CircNet

miRNA General Information

Basic
Network

miRNA ID	hsa-miR-548x-5p
Description	Homo sapiens miR-548x stem-loop
Comment	None
Experiment
Sequence	UGCAAAAGUAAUUGCAGUUUUUG

miRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan
chr1:155514292\|155514473	hsa-miR-548x-5p	1	1	0
chr6:8014187\|8014387	hsa-miR-548x-5p	1	1	0

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr11:9059303\|9059425	hsa-miR-548x-5p	0	1
chr17:1465090\|1465222	hsa-miR-548x-5p	0	1
chr13:19647099\|19647291	hsa-miR-548x-5p	0	1
chr4:39551976\|39552092	hsa-miR-548x-5p	0	1
chr10:124045885\|124046027	hsa-miR-548x-5p	0	1
chr15:85747290\|85747460	hsa-miR-548x-5p	0	1
chr2:232681990\|232682221	hsa-miR-548x-5p	0	1
chr6:32443794\|32443906	hsa-miR-548x-5p	0	1
chr1:119711962\|119712142	hsa-miR-548x-5p	0	1
chr10:46000776\|46000880	hsa-miR-548x-5p	0	1
chr5:140459186\|140459287	hsa-miR-548x-5p	0	1
chr12:56639980\|56640077	hsa-miR-548x-5p	0	1
chr11:18407220\|18407338	hsa-miR-548x-5p	0	1
chr3:195568774\|195568898	hsa-miR-548x-5p	1	0
chr10:116885090\|116885187	hsa-miR-548x-5p	1	0
chr1:16459413\|16459657	hsa-miR-548x-5p	0	1
chr1:39486280\|39486450	hsa-miR-548x-5p	0	1
chr10:6233726\|6233834	hsa-miR-548x-5p	0	1
chr8:22689231\|22689399	hsa-miR-548x-5p	0	1
chr17:78223765\|78223995	hsa-miR-548x-5p	0	1
chr12:131922394\|131922503	hsa-miR-548x-5p	0	1
chr17:1465148\|1465243	hsa-miR-548x-5p	0	1
chr6:32443758\|32443921	hsa-miR-548x-5p	0	1
chr1:37978783\|37979055	hsa-miR-548x-5p	0	1
chr7:100813108\|100813161	hsa-miR-548x-5p	0	1
chr16:23467438\|23467664	hsa-miR-548x-5p	0	1
chr1:15507142\|15507284	hsa-miR-548x-5p	0	1
chr8:30063147\|30063222	hsa-miR-548x-5p	0	1
chr19:47002580\|47002809	hsa-miR-548x-5p	0	1
chr11:129863856\|129863952	hsa-miR-548x-5p	0	1
chr2:66577716\|66577847	hsa-miR-548x-5p	0	1
chr8:30063098\|30063307	hsa-miR-548x-5p	0	1
chr10:6233701\|6233866	hsa-miR-548x-5p	0	1
chr1:119711994\|119712103	hsa-miR-548x-5p	0	1
chr3:45678504\|45678638	hsa-miR-548x-5p	0	1
chr4:76158809\|76158967	hsa-miR-548x-5p	0	1
chr14:90405972\|90406110	hsa-miR-548x-5p	0	1
chr2:241500560\|241500680	hsa-miR-548x-5p	0	1
chr10:6233618\|6233834	hsa-miR-548x-5p	0	1
chr11:18407198\|18407332	hsa-miR-548x-5p	0	1
chr4:39551976~39552092	hsa-miR-548x-5p	0	1
chr2:96860534~96860715	hsa-miR-548x-5p	0	1
chr11:9059303~9059425	hsa-miR-548x-5p	0	1
chr17:28882118~28882408	hsa-miR-548x-5p	0	1
chr9:129011094~129011202	hsa-miR-548x-5p	0	1
chr11:18407117\|18407338	hsa-miR-548x-5p	0	1
chr6:32443792~32443921	hsa-miR-548x-5p	0	1
chr8:17655829~17655968	hsa-miR-548x-5p	0	1
chr3:127706533~127706683	hsa-miR-548x-5p	0	1
chr19:12791491\|12791700	hsa-miR-548x-5p	0	1
chr13:113640815\|113640947	hsa-miR-548x-5p	0	1
chr13:19647063\|19647291	hsa-miR-548x-5p	0	1
chr13:51666963\|51667035	hsa-miR-548x-5p	0	1
chr1:150577287\|150577458	hsa-miR-548x-5p	0	1
chr10:102479639\|102479748	hsa-miR-548x-5p	0	1
chr7:92690023\|92690190	hsa-miR-548x-5p	0	1
chr3:50102606\|50102738	hsa-miR-548x-5p	0	1
chr5:138029364\|138029598	hsa-miR-548x-5p	0	1
chr8:66922216\|66922328	hsa-miR-548x-5p	0	1
chr7:45101594\|45101927	hsa-miR-548x-5p	0	1
chr15:55237277\|55237410	hsa-miR-548x-5p	0	1
chr10:116885086\|116885226	hsa-miR-548x-5p	1	0
chr6:32443792\|32443921	hsa-miR-548x-5p	0	1
chr13:41462634\|41462772	hsa-miR-548x-5p	0	1
chr22:38491064\|38491229	hsa-miR-548x-5p	0	1
chr20:31569359\|31569464	hsa-miR-548x-5p	0	1
chr13:36168382\|36168526	hsa-miR-548x-5p	0	1
chr3:53229303\|53229410	hsa-miR-548x-5p	0	1
chr14:54941475\|54941594	hsa-miR-548x-5p	0	1
chr10:114938237\|114938418	hsa-miR-548x-5p	0	1
chr2:202037796\|202037993	hsa-miR-548x-5p	0	1
chr6:32443785\|32443921	hsa-miR-548x-5p	0	1
chr7:5311306\|5311460	hsa-miR-548x-5p	0	1
chr17:28882130\|28882360	hsa-miR-548x-5p	0	1
chr15:58597497\|58597620	hsa-miR-548x-5p	0	1
chr6:32443794\|32443921	hsa-miR-548x-5p	0	1
chr10:68683921\|68684140	hsa-miR-548x-5p	0	1
chr4:158675761\|158676026	hsa-miR-548x-5p	0	1
chr2:105097226\|105097310	hsa-miR-548x-5p	0	1
chr6:32443756\|32443921	hsa-miR-548x-5p	0	1
chr1:228278886\|228279253	hsa-miR-548x-5p	0	1
chr10:124045885\|124046017	hsa-miR-548x-5p	0	1
chr3:45678538\|45678724	hsa-miR-548x-5p	0	1
chr3:45083428\|45083609	hsa-miR-548x-5p	0	1
chr15:57708855\|57709083	hsa-miR-548x-5p	0	1
chr17:81206779\|81207170	hsa-miR-548x-5p	0	1
chr9:127885775\|127886024	hsa-miR-548x-5p	0	1
chr4:94249654\|94285069	hsa-miR-548x-5p	0	1
chr2:144208603\|144211579	hsa-miR-548x-5p	0	1
chr19:40736986\|40737769	hsa-miR-548x-5p	0	1
chr12:100282943\|100298175	hsa-miR-548x-5p	0	1
chr13:110178971\|110179354	hsa-miR-548x-5p	0	1
chr6:75084655\|75084861	hsa-miR-548x-5p	0	1
chr5:61472681\|61473037	hsa-miR-548x-5p	0	1
chr2:240021371\|240022240	hsa-miR-548x-5p	0	1
chr17:28553842\|28554033	hsa-miR-548x-5p	0	1
chr17:1465141\|1465269	hsa-miR-548x-5p	0	1
chr8:17655829\|17655935	hsa-miR-548x-5p	0	1
chr3:45678504\|45678636	hsa-miR-548x-5p	0	1
chr20:438244\|438402	hsa-miR-548x-5p	0	1
chr3:45678538\|45678638	hsa-miR-548x-5p	0	1
chr16:57185848\|57186007	hsa-miR-548x-5p	0	1
chr16:68300932\|68301101	hsa-miR-548x-5p	0	1
chr3:45678504\|45678640	hsa-miR-548x-5p	0	1
chr5:37124077\|37124186	hsa-miR-548x-5p	0	1
chr8:61651050\|61653660	hsa-miR-548x-5p	0	1
chr16:68300914\|68301106	hsa-miR-548x-5p	0	1
chr3:16316069\|16316245	hsa-miR-548x-5p	0	1
chr11:18407220\|18407438	hsa-miR-548x-5p	0	1
chr18:76849526\|76851939	hsa-miR-548x-5p	0	1
chr11:18407222\|18407332	hsa-miR-548x-5p	0	1
chr12:56639980\|56640062	hsa-miR-548x-5p	0	1
chr1:26883021\|26883286	hsa-miR-548x-5p	-11	1
chr3:30692110\|30692277	hsa-miR-548x-5p	-13	1
chr10:246439\|246703	hsa-miR-548x-5p	0	1
chr17:28882118\|28882222	hsa-miR-548x-5p	0	1
chr17:78223765\|78223880	hsa-miR-548x-5p	0	1
chr4:119029852\|119030072	hsa-miR-548x-5p	0	1
chr22:39131644\|39131747	hsa-miR-548x-5p	0	1
chr5:92991672\|92991913	hsa-miR-548x-5p	0	1
chr20:31569355\|31569464	hsa-miR-548x-5p	0	1
chr5:57246354\|57246449	hsa-miR-548x-5p	0	1
chr9:127885710\|127885965	hsa-miR-548x-5p	0	1
chr13:48046945\|48047094	hsa-miR-548x-5p	0	1
chr4:145134341\|145134646	hsa-miR-548x-5p	0	1
chr4:183447202\|183447338	hsa-miR-548x-5p	0	1
chr3:75687155\|75687295	hsa-miR-548x-5p	0	1
chrX:24061847\|24061965	hsa-miR-548x-5p	0	1
chr19:47002712\|47002896	hsa-miR-548x-5p	0	1
chr12:2858433\|2858522	hsa-miR-548x-5p	0	1
chr19:42511878\|42511981	hsa-miR-548x-5p	0	1
chr20:31569251\|31569464	hsa-miR-548x-5p	0	1
chr1:957914\|958060	hsa-miR-548x-5p	0	1
chr2:65205776\|65205924	hsa-miR-548x-5p	0	1
chr15:58597502\|58597620	hsa-miR-548x-5p	0	1
chr1:28743052\|28743175	hsa-miR-548x-5p	0	1
chr17:1465164\|1465269	hsa-miR-548x-5p	0	1
chr13:19647112\|19647242	hsa-miR-548x-5p	0	1
chr5:177211539\|177211625	hsa-miR-548x-5p	0	1
chr20:6069897\|6069987	hsa-miR-548x-5p	0	1
chr17:80339401\|80339628	hsa-miR-548x-5p	0	1
chr11:18407135\|18407292	hsa-miR-548x-5p	0	1
chr11:18407234\|18407508	hsa-miR-548x-5p	0	1
chr11:18407216\|18407332	hsa-miR-548x-5p	0	1
chr17:47118464\|47118622	hsa-miR-548x-5p	0	1
chr4:140532090\|140532225	hsa-miR-548x-5p	0	1
chr1:6185528\|6185737	hsa-miR-548x-5p	0	1
chr18:31546085\|31546236	hsa-miR-548x-5p	0	1
chr10:14897182\|14897332	hsa-miR-548x-5p	0	1
chr1:66373126\|66373365	hsa-miR-548x-5p	1	0

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-miR-548x-5p	ZNF701	zinc finger protein 701	HGNC:25597	details
hsa-miR-548x-5p	ZNF525	zinc finger protein 525	HGNC:29423	details
hsa-miR-548x-5p	CRYBG3	crystallin beta-gamma domain containing 3	HGNC:34427	details
hsa-miR-548x-5p	RCC2	regulator of chromosome condensation 2	HGNC:30297	details
hsa-miR-548x-5p	FOXP1	forkhead box P1	HGNC:3823	details
hsa-miR-548x-5p	ADRB1	adrenoceptor beta 1	HGNC:285	details
hsa-miR-548x-5p	POLI	DNA polymerase iota	HGNC:9182	details
hsa-miR-548x-5p	OTUD7A	OTU deubiquitinase 7A	HGNC:20718	details
hsa-miR-548x-5p	ANKEF1	ankyrin repeat and EF-hand domain containing 1	HGNC:15803	details
hsa-miR-548x-5p	DDX39B	DExD-box helicase 39B	HGNC:13917	details
hsa-miR-548x-5p	EIF4EBP2	eukaryotic translation initiation factor 4E binding protein 2	HGNC:3289	details
hsa-miR-548x-5p				details
hsa-miR-548x-5p	YY1	YY1 transcription factor	HGNC:12856	details
hsa-miR-548x-5p	WNT7B	Wnt family member 7B	HGNC:12787	details
hsa-miR-548x-5p	TMBIM6	transmembrane BAX inhibitor motif containing 6	HGNC:11723	details
hsa-miR-548x-5p	STX6	syntaxin 6	HGNC:11441	details
hsa-miR-548x-5p	STX16	syntaxin 16	HGNC:11431	details
hsa-miR-548x-5p	SMG1	SMG1 nonsense mediated mRNA decay associated PI3K related kinase	HGNC:30045	details
hsa-miR-548x-5p	SGK1	serum/glucocorticoid regulated kinase 1	HGNC:10810	details
hsa-miR-548x-5p	SELENOT	selenoprotein T	HGNC:18136	details
hsa-miR-548x-5p	PPP2R5E	protein phosphatase 2 regulatory subunit B'epsilon	HGNC:9313	details
hsa-miR-548x-5p	PITPNA	phosphatidylinositol transfer protein alpha	HGNC:9001	details
hsa-miR-548x-5p	PATL1	PAT1 homolog 1, processing body mRNA decay factor	HGNC:26721	details
hsa-miR-548x-5p	NFIB	nuclear factor I B	HGNC:7785	details
hsa-miR-548x-5p	MTMR6	myotubularin related protein 6	HGNC:7453	details
hsa-miR-548x-5p	KIF13A	kinesin family member 13A	HGNC:14566	details
hsa-miR-548x-5p				details
hsa-miR-548x-5p				details
hsa-miR-548x-5p	GMFB	glia maturation factor beta	HGNC:4373	details
hsa-miR-548x-5p	FZD6	frizzled class receptor 6	HGNC:4044	details
hsa-miR-548x-5p	MIGA2	mitoguardin 2	HGNC:23621	details
hsa-miR-548x-5p	EOGT	EGF domain specific O-linked N-acetylglucosamine transferase	HGNC:28526	details
hsa-miR-548x-5p	ELL2	elongation factor for RNA polymerase II 2	HGNC:17064	details
hsa-miR-548x-5p	DLG5	discs large MAGUK scaffold protein 5	HGNC:2904	details
hsa-miR-548x-5p	CCNA2	cyclin A2	HGNC:1578	details
hsa-miR-548x-5p	BLCAP	BLCAP apoptosis inducing factor	HGNC:1055	details
hsa-miR-548x-5p	ATP6V1B2	ATPase H+ transporting V1 subunit B2	HGNC:854	details
hsa-miR-548x-5p	ARL5B	ADP ribosylation factor like GTPase 5B	HGNC:23052	details
hsa-miR-548x-5p	ANKRD11	ankyrin repeat domain 11	HGNC:21316	details
hsa-miR-548x-5p	EXT2	exostosin glycosyltransferase 2	HGNC:3513	details
hsa-miR-548x-5p	LRRC45	leucine rich repeat containing 45	HGNC:28302	details
hsa-miR-548x-5p	ZFYVE26	zinc finger FYVE-type containing 26	HGNC:20761	details
hsa-miR-548x-5p	SOX4	SRY-box transcription factor 4	HGNC:11200	details
hsa-miR-548x-5p	DICER1	dicer 1, ribonuclease III	HGNC:17098	details
hsa-miR-548x-5p	ARPP19	cAMP regulated phosphoprotein 19	HGNC:16967	details
hsa-miR-548x-5p	SEC23A	SEC23 homolog A, COPII coat complex component	HGNC:10701	details
hsa-miR-548x-5p	CNOT4	CCR4-NOT transcription complex subunit 4	HGNC:7880	details
hsa-miR-548x-5p	LFNG	LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	HGNC:6560	details
hsa-miR-548x-5p	PDRG1	p53 and DNA damage regulated 1	HGNC:16119	details
hsa-miR-548x-5p	WDR45B	WD repeat domain 45B	HGNC:25072	details
hsa-miR-548x-5p	SLC48A1	solute carrier family 48 member 1	HGNC:26035	details
hsa-miR-548x-5p	MMGT1	membrane magnesium transporter 1	HGNC:28100	details
hsa-miR-548x-5p	CCND2	cyclin D2	HGNC:1583	details
hsa-miR-548x-5p	BTF3L4	basic transcription factor 3 like 4	HGNC:30547	details
hsa-miR-548x-5p	BRWD3	bromodomain and WD repeat domain containing 3	HGNC:17342	details
hsa-miR-548x-5p	ROCK1	Rho associated coiled-coil containing protein kinase 1	HGNC:10251	details
hsa-miR-548x-5p	ARIH1	ariadne RBR E3 ubiquitin protein ligase 1	HGNC:689	details
hsa-miR-548x-5p	PTBP2	polypyrimidine tract binding protein 2	HGNC:17662	details
hsa-miR-548x-5p	NBPF11	NBPF member 11	HGNC:31993	details
hsa-miR-548x-5p	SVOP	SV2 related protein	HGNC:25417	details
hsa-miR-548x-5p	ZNF622	zinc finger protein 622	HGNC:30958	details
hsa-miR-548x-5p	TUBB2A	tubulin beta 2A class IIa	HGNC:12412	details
hsa-miR-548x-5p	SKIL	SKI like proto-oncogene	HGNC:10897	details
hsa-miR-548x-5p	SEMA4C	semaphorin 4C	HGNC:10731	details
hsa-miR-548x-5p	PPP1R15B	protein phosphatase 1 regulatory subunit 15B	HGNC:14951	details
hsa-miR-548x-5p	PLEKHF2	pleckstrin homology and FYVE domain containing 2	HGNC:20757	details
hsa-miR-548x-5p	G3BP2	G3BP stress granule assembly factor 2	HGNC:30291	details
hsa-miR-548x-5p	CCNL1	cyclin L1	HGNC:20569	details
hsa-miR-548x-5p	ZNF154	zinc finger protein 154	HGNC:12939	details
hsa-miR-548x-5p	LRRC55	leucine rich repeat containing 55	HGNC:32324	details
hsa-miR-548x-5p	ERCC4	ERCC excision repair 4, endonuclease catalytic subunit	HGNC:3436	details
hsa-miR-548x-5p	ZNRF2	zinc and ring finger 2	HGNC:22316	details
hsa-miR-548x-5p	UBN2	ubinuclein 2	HGNC:21931	details
hsa-miR-548x-5p	UBE2D3	ubiquitin conjugating enzyme E2 D3	HGNC:12476	details
hsa-miR-548x-5p	QKI	QKI, KH domain containing RNA binding	HGNC:21100	details
hsa-miR-548x-5p	MTHFD2	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase	HGNC:7434	details
hsa-miR-548x-5p	MOB1B	MOB kinase activator 1B	HGNC:29801	details
hsa-miR-548x-5p	MED12L	mediator complex subunit 12L	HGNC:16050	details
hsa-miR-548x-5p	DEK	DEK proto-oncogene	HGNC:2768	details
hsa-miR-548x-5p	CEP350	centrosomal protein 350	HGNC:24238	details
hsa-miR-548x-5p	SMAD4	SMAD family member 4	HGNC:6770	details
hsa-miR-548x-5p	ZNF691	zinc finger protein 691	HGNC:28028	details
hsa-miR-548x-5p	MCM7	minichromosome maintenance complex component 7	HGNC:6950	details
hsa-miR-548x-5p	MCRIP2	MAPK regulated corepressor interacting protein 2	HGNC:14142	details
hsa-miR-548x-5p	SPART	spartin	HGNC:18514	details
hsa-miR-548x-5p	RAN	RAN, member RAS oncogene family	HGNC:9846	details
hsa-miR-548x-5p	PSMA2	proteasome 20S subunit alpha 2	HGNC:9531	details
hsa-miR-548x-5p	PPTC7	protein phosphatase targeting COQ7	HGNC:30695	details
hsa-miR-548x-5p	NIPA1	NIPA magnesium transporter 1	HGNC:17043	details
hsa-miR-548x-5p	LNPEP	leucyl and cystinyl aminopeptidase	HGNC:6656	details
hsa-miR-548x-5p	ELOVL5	ELOVL fatty acid elongase 5	HGNC:21308	details
hsa-miR-548x-5p	CREBL2	cAMP responsive element binding protein like 2	HGNC:2350	details
hsa-miR-548x-5p	SF3B3	splicing factor 3b subunit 3	HGNC:10770	details
hsa-miR-548x-5p	RNF111	ring finger protein 111	HGNC:17384	details
hsa-miR-548x-5p	GRB10	growth factor receptor bound protein 10	HGNC:4564	details
hsa-miR-548x-5p	LAPTM4B	lysosomal protein transmembrane 4 beta	HGNC:13646	details
hsa-miR-548x-5p	F8A2	coagulation factor VIII associated 2	HGNC:31849	details
hsa-miR-548x-5p	F8A3	coagulation factor VIII associated 3	HGNC:31850	details
hsa-miR-548x-5p	ITM2C	integral membrane protein 2C	HGNC:6175	details
hsa-miR-548x-5p	IMPA1	inositol monophosphatase 1	HGNC:6050	details
hsa-miR-548x-5p	TBRG1	transforming growth factor beta regulator 1	HGNC:29551	details
hsa-miR-548x-5p	RNF11	ring finger protein 11	HGNC:10056	details
hsa-miR-548x-5p	LDLR	low density lipoprotein receptor	HGNC:6547	details
hsa-miR-548x-5p	KPNA6	karyopherin subunit alpha 6	HGNC:6399	details
hsa-miR-548x-5p	AGFG1	ArfGAP with FG repeats 1	HGNC:5175	details
hsa-miR-548x-5p	ZNF93	zinc finger protein 93	HGNC:13169	details
hsa-miR-548x-5p	CCNL2	cyclin L2	HGNC:20570	details
hsa-miR-548x-5p	NUP58	nucleoporin 58	HGNC:20261	details
hsa-miR-548x-5p	MALT1	MALT1 paracaspase	HGNC:6819	details
hsa-miR-548x-5p				details
hsa-miR-548x-5p	FAM241A	family with sequence similarity 241 member A	HGNC:26813	details
hsa-miR-548x-5p	LINC00598	long intergenic non-protein coding RNA 598	HGNC:42770	details
hsa-miR-548x-5p	TEAD1	TEA domain transcription factor 1	HGNC:11714	details
hsa-miR-548x-5p	RAVER2	ribonucleoprotein, PTB binding 2	HGNC:25577	details
hsa-miR-548x-5p	RAB8B	RAB8B, member RAS oncogene family	HGNC:30273	details
hsa-miR-548x-5p	GRAMD4	GRAM domain containing 4	HGNC:29113	details
hsa-miR-548x-5p	CDK19	cyclin dependent kinase 19	HGNC:19338	details
hsa-miR-548x-5p	ANKRD50	ankyrin repeat domain 50	HGNC:29223	details
hsa-miR-548x-5p				details
hsa-miR-548x-5p	ADARB2	adenosine deaminase RNA specific B2 (inactive)	HGNC:227	details
hsa-miR-548x-5p	ZNF367	zinc finger protein 367	HGNC:18320	details
hsa-miR-548x-5p	TNFRSF11A	TNF receptor superfamily member 11a	HGNC:11908	details
hsa-miR-548x-5p	ESYT1	extended synaptotagmin 1	HGNC:29534	details
hsa-miR-548x-5p	NDRG1	N-myc downstream regulated 1	HGNC:7679	details
hsa-miR-548x-5p	MFF	mitochondrial fission factor	HGNC:24858	details
hsa-miR-548x-5p	PAICS	phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase	HGNC:8587	details
hsa-miR-548x-5p	ZNF772	zinc finger protein 772	HGNC:33106	details
hsa-miR-548x-5p	WDR26	WD repeat domain 26	HGNC:21208	details
hsa-miR-548x-5p	WBP4	WW domain binding protein 4	HGNC:12739	details
hsa-miR-548x-5p	USP13	ubiquitin specific peptidase 13	HGNC:12611	details
hsa-miR-548x-5p	STOX2	storkhead box 2	HGNC:25450	details
hsa-miR-548x-5p	SLC6A8	solute carrier family 6 member 8	HGNC:11055	details
hsa-miR-548x-5p	RORA	RAR related orphan receptor A	HGNC:10258	details
hsa-miR-548x-5p	SFTPA1	surfactant protein A1	HGNC:10798	details
hsa-miR-548x-5p	POGZ	pogo transposable element derived with ZNF domain	HGNC:18801	details
hsa-miR-548x-5p	MKX	mohawk homeobox	HGNC:23729	details
hsa-miR-548x-5p	MBNL3	muscleblind like splicing regulator 3	HGNC:20564	details
hsa-miR-548x-5p	MBNL1	muscleblind like splicing regulator 1	HGNC:6923	details
hsa-miR-548x-5p	LCLAT1	lysocardiolipin acyltransferase 1	HGNC:26756	details
hsa-miR-548x-5p	GIGYF1	GRB10 interacting GYF protein 1	HGNC:9126	details
hsa-miR-548x-5p	ELMOD2	ELMO domain containing 2	HGNC:28111	details
hsa-miR-548x-5p	E2F8	E2F transcription factor 8	HGNC:24727	details
hsa-miR-548x-5p	CEP55	centrosomal protein 55	HGNC:1161	details
hsa-miR-548x-5p	CHEK2	checkpoint kinase 2	HGNC:16627	details
hsa-miR-548x-5p	CALM1	calmodulin 1	HGNC:1442	details
hsa-miR-548x-5p				details
hsa-miR-548x-5p	BMP3	bone morphogenetic protein 3	HGNC:1070	details
hsa-miR-548x-5p	ARHGAP12	Rho GTPase activating protein 12	HGNC:16348	details
hsa-miR-548x-5p	ARC	activity regulated cytoskeleton associated protein	HGNC:648	details
hsa-miR-548x-5p	ACBD5	acyl-CoA binding domain containing 5	HGNC:23338	details
hsa-miR-548x-5p	ZNF598	zinc finger protein 598, E3 ubiquitin ligase	HGNC:28079	details
hsa-miR-548x-5p	MAVS	mitochondrial antiviral signaling protein	HGNC:29233	details
hsa-miR-548x-5p	INCENP	inner centromere protein	HGNC:6058	details
hsa-miR-548x-5p	MYZAP	myocardial zonula adherens protein	HGNC:43444	details
hsa-miR-548x-5p	ZNF678	zinc finger protein 678	HGNC:28652	details
hsa-miR-548x-5p	ZXDA	zinc finger X-linked duplicated A	HGNC:13198	details
hsa-miR-548x-5p	ZBTB18	zinc finger and BTB domain containing 18	HGNC:13030	details
hsa-miR-548x-5p	WASL	WASP like actin nucleation promoting factor	HGNC:12735	details
hsa-miR-548x-5p	TRIM33	tripartite motif containing 33	HGNC:16290	details
hsa-miR-548x-5p	SAMD8	sterile alpha motif domain containing 8	HGNC:26320	details
hsa-miR-548x-5p	RCAN2	regulator of calcineurin 2	HGNC:3041	details
hsa-miR-548x-5p	PRKACB	protein kinase cAMP-activated catalytic subunit beta	HGNC:9381	details
hsa-miR-548x-5p				details
hsa-miR-548x-5p	MYBL1	MYB proto-oncogene like 1	HGNC:7547	details
hsa-miR-548x-5p	MLEC	malectin	HGNC:28973	details
hsa-miR-548x-5p	MCC	MCC regulator of WNT signaling pathway	HGNC:6935	details
hsa-miR-548x-5p	MARCKS	myristoylated alanine rich protein kinase C substrate	HGNC:6759	details
hsa-miR-548x-5p	ITGA2	integrin subunit alpha 2	HGNC:6137	details
hsa-miR-548x-5p	HNRNPF	heterogeneous nuclear ribonucleoprotein F	HGNC:5039	details
hsa-miR-548x-5p	HBP1	HMG-box transcription factor 1	HGNC:23200	details
hsa-miR-548x-5p	GNPTAB	N-acetylglucosamine-1-phosphate transferase subunits alpha and beta	HGNC:29670	details
hsa-miR-548x-5p	GATA6	GATA binding protein 6	HGNC:4174	details
hsa-miR-548x-5p	FBXO8	F-box protein 8	HGNC:13587	details
hsa-miR-548x-5p	EVI5L	ecotropic viral integration site 5 like	HGNC:30464	details
hsa-miR-548x-5p	ETS2	ETS proto-oncogene 2, transcription factor	HGNC:3489	details
hsa-miR-548x-5p	ENPP4	ectonucleotide pyrophosphatase/phosphodiesterase 4	HGNC:3359	details
hsa-miR-548x-5p	EDEM1	ER degradation enhancing alpha-mannosidase like protein 1	HGNC:18967	details
hsa-miR-548x-5p	DBN1	drebrin 1	HGNC:2695	details
hsa-miR-548x-5p	CYP2U1	cytochrome P450 family 2 subfamily U member 1	HGNC:20582	details
hsa-miR-548x-5p	CHIC1	cysteine rich hydrophobic domain 1	HGNC:1934	details
hsa-miR-548x-5p	CFL2	cofilin 2	HGNC:1875	details
hsa-miR-548x-5p				details
hsa-miR-548x-5p	GDNF	glial cell derived neurotrophic factor	HGNC:4232	details
hsa-miR-548x-5p	ARL8A	ADP ribosylation factor like GTPase 8A	HGNC:25192	details
hsa-miR-548x-5p	AGO3	argonaute RISC catalytic component 3	HGNC:18421	details
hsa-miR-548x-5p	ZNF680	zinc finger protein 680	HGNC:26897	details
hsa-miR-548x-5p	PRNP	prion protein	HGNC:9449	details
hsa-miR-548x-5p	ZNF107	zinc finger protein 107	HGNC:12887	details
hsa-miR-548x-5p	ZMYND11	zinc finger MYND-type containing 11	HGNC:16966	details
hsa-miR-548x-5p	ZDHHC18	zinc finger DHHC-type palmitoyltransferase 18	HGNC:20712	details
hsa-miR-548x-5p	CBX3	chromobox 3	HGNC:1553	details
hsa-miR-548x-5p	CLVS2	clavesin 2	HGNC:23046	details
hsa-miR-548x-5p	SNRPD3	small nuclear ribonucleoprotein D3 polypeptide	HGNC:11160	details
hsa-miR-548x-5p	CCDC80	coiled-coil domain containing 80	HGNC:30649	details
hsa-miR-548x-5p	TMPPE	transmembrane protein with metallophosphoesterase domain	HGNC:33865	details
hsa-miR-548x-5p	TMEM41A	transmembrane protein 41A	HGNC:30544	details
hsa-miR-548x-5p	RRAGD	Ras related GTP binding D	HGNC:19903	details
hsa-miR-548x-5p	NFYA	nuclear transcription factor Y subunit alpha	HGNC:7804	details
hsa-miR-548x-5p	MAPK8	mitogen-activated protein kinase 8	HGNC:6881	details
hsa-miR-548x-5p	KCNJ2	potassium inwardly rectifying channel subfamily J member 2	HGNC:6263	details
hsa-miR-548x-5p				details
hsa-miR-548x-5p	ACVR2A	activin A receptor type 2A	HGNC:173	details
hsa-miR-548x-5p	HCFC2	host cell factor C2	HGNC:24972	details
hsa-miR-548x-5p	DESI1	desumoylating isopeptidase 1	HGNC:24577	details
hsa-miR-548x-5p	TMTC1	transmembrane O-mannosyltransferase targeting cadherins 1	HGNC:24099	details
hsa-miR-548x-5p	ODF4	outer dense fiber of sperm tails 4	HGNC:19056	details
hsa-miR-548x-5p	AVPR1A	arginine vasopressin receptor 1A	HGNC:895	details
hsa-miR-548x-5p	TAOK3	TAO kinase 3	HGNC:18133	details
hsa-miR-548x-5p	MLLT6	MLLT6, PHD finger containing	HGNC:7138	details
hsa-miR-548x-5p	FAM104A	family with sequence similarity 104 member A	HGNC:25918	details
hsa-miR-548x-5p	COL12A1	collagen type XII alpha 1 chain	HGNC:2188	details
hsa-miR-548x-5p	PEX26	peroxisomal biogenesis factor 26	HGNC:22965	details
hsa-miR-548x-5p	RAB30	RAB30, member RAS oncogene family	HGNC:9770	details
hsa-miR-548x-5p	ZBTB33	zinc finger and BTB domain containing 33	HGNC:16682	details
hsa-miR-548x-5p	SPOP	speckle type BTB/POZ protein	HGNC:11254	details
hsa-miR-548x-5p	DNAJC21	DnaJ heat shock protein family (Hsp40) member C21	HGNC:27030	details
hsa-miR-548x-5p	NHLRC2	NHL repeat containing 2	HGNC:24731	details
hsa-miR-548x-5p	PTPN14	protein tyrosine phosphatase non-receptor type 14	HGNC:9647	details
hsa-miR-548x-5p	ZNF429	zinc finger protein 429	HGNC:20817	details
hsa-miR-548x-5p	RAB23	RAB23, member RAS oncogene family	HGNC:14263	details
hsa-miR-548x-5p	CCDC127	coiled-coil domain containing 127	HGNC:30520	details
hsa-miR-548x-5p	HRK	harakiri, BCL2 interacting protein	HGNC:5185	details
hsa-miR-548x-5p	ENAH	ENAH actin regulator	HGNC:18271	details
hsa-miR-548x-5p	EMP2	epithelial membrane protein 2	HGNC:3334	details
hsa-miR-548x-5p	ZZZ3	zinc finger ZZ-type containing 3	HGNC:24523	details
hsa-miR-548x-5p	C19orf44	chromosome 19 open reading frame 44	HGNC:26141	details
hsa-miR-548x-5p				details
hsa-miR-548x-5p	DIP2A	disco interacting protein 2 homolog A	HGNC:17217	details
hsa-miR-548x-5p	UBXN2A	UBX domain protein 2A	HGNC:27265	details
hsa-miR-548x-5p	MTHFD1	methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1	HGNC:7432	details
hsa-miR-548x-5p	DCAF7	DDB1 and CUL4 associated factor 7	HGNC:30915	details
hsa-miR-548x-5p	CYB561	cytochrome b561	HGNC:2571	details
hsa-miR-548x-5p	KIAA0513	KIAA0513	HGNC:29058	details
hsa-miR-548x-5p	SOD2	superoxide dismutase 2	HGNC:11180	details
hsa-miR-548x-5p	SNX19	sorting nexin 19	HGNC:21532	details
hsa-miR-548x-5p	UBXN7	UBX domain protein 7	HGNC:29119	details
hsa-miR-548x-5p	CRAMP1	cramped chromatin regulator homolog 1	HGNC:14122	details
hsa-miR-548x-5p	GPR137C	G protein-coupled receptor 137C	HGNC:25445	details
hsa-miR-548x-5p	FKBP15	FKBP prolyl isomerase family member 15	HGNC:23397	details
hsa-miR-548x-5p	CNEP1R1	CTD nuclear envelope phosphatase 1 regulatory subunit 1	HGNC:26759	details
hsa-miR-548x-5p	CAMSAP1	calmodulin regulated spectrin associated protein 1	HGNC:19946	details
hsa-miR-548x-5p	AMMECR1L	AMMECR1 like	HGNC:28658	details
hsa-miR-548x-5p	NWD1	NACHT and WD repeat domain containing 1	HGNC:27619	details
hsa-miR-548x-5p	PPFIBP1	PPFIA binding protein 1	HGNC:9249	details
hsa-miR-548x-5p	WNK3	WNK lysine deficient protein kinase 3	HGNC:14543	details
hsa-miR-548x-5p	SLC30A7	solute carrier family 30 member 7	HGNC:19306	details
hsa-miR-548x-5p	GRAMD2B	GRAM domain containing 2B	HGNC:24911	details
hsa-miR-548x-5p	CHERP	calcium homeostasis endoplasmic reticulum protein	HGNC:16930	details
hsa-miR-548x-5p	CD209	CD209 molecule	HGNC:1641	details
hsa-miR-548x-5p	MUC21	mucin 21, cell surface associated	HGNC:21661	details
hsa-miR-548x-5p	CALM3	calmodulin 3	HGNC:1449	details
hsa-miR-548x-5p	CNNM2	cyclin and CBS domain divalent metal cation transport mediator 2	HGNC:103	details
hsa-miR-548x-5p	EREG	epiregulin	HGNC:3443	details
hsa-miR-548x-5p	FXR1	FMR1 autosomal homolog 1	HGNC:4023	details
hsa-miR-548x-5p	SECISBP2L	SECIS binding protein 2 like	HGNC:28997	details
hsa-miR-548x-5p	TMEM68	transmembrane protein 68	HGNC:26510	details
hsa-miR-548x-5p	ZBTB7B	zinc finger and BTB domain containing 7B	HGNC:18668	details
hsa-miR-548x-5p	ATP6V0E1	ATPase H+ transporting V0 subunit e1	HGNC:863	details
hsa-miR-548x-5p	EVC	EvC ciliary complex subunit 1	HGNC:3497	details
hsa-miR-548x-5p	SLC45A4	solute carrier family 45 member 4	HGNC:29196	details
hsa-miR-548x-5p	SP140L	SP140 nuclear body protein like	HGNC:25105	details
hsa-miR-548x-5p	LAMP2	lysosomal associated membrane protein 2	HGNC:6501	details
hsa-miR-548x-5p	LRTM1	leucine rich repeats and transmembrane domains 1	HGNC:25023	details
hsa-miR-548x-5p	RPRD2	regulation of nuclear pre-mRNA domain containing 2	HGNC:29039	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)