CircNet

miRNA General Information

Basic
Network

miRNA ID	hsa-miR-5571-5p
Description	Homo sapiens miR-5571 stem-loop
Comment	None
Experiment	SOLiD [1]
Sequence	CAAUUCUCAAAGGAGCCUCCC

miRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr1:220063989\|220064105	hsa-miR-5571-5p	1	1
chr1:23787332\|23787483	hsa-miR-5571-5p	1	1
chr2:86504534\|86504660	hsa-miR-5571-5p	1	1

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr14:94110762\|94111733	hsa-miR-5571-5p	1	0
chr12:57512678\|57512800	hsa-miR-5571-5p	1	0
chr6:31659740\|31659856	hsa-miR-5571-5p	0	1
chr13:41570435\|41570657	hsa-miR-5571-5p	0	1
chr17:58363279\|58363383	hsa-miR-5571-5p	0	1
chr22:32859562\|32859751	hsa-miR-5571-5p	0	1
chr8:116943333\|116943494	hsa-miR-5571-5p	0	1
chr13:42322589\|42322753	hsa-miR-5571-5p	0	1
chr16:15703200\|15703353	hsa-miR-5571-5p	0	1
chr17:47923010\|47923237	hsa-miR-5571-5p	0	1
chr1:55216264\|55216402	hsa-miR-5571-5p	0	1
chr1:154251179\|154251568	hsa-miR-5571-5p	0	1
chr4:13604661\|13604783	hsa-miR-5571-5p	0	1
chr5:83541254\|83541385	hsa-miR-5571-5p	0	1
chr9:123381442\|123381577	hsa-miR-5571-5p	0	1
chr3:148840702\|148840901	hsa-miR-5571-5p	0	1
chr3:148840749\|148840958	hsa-miR-5571-5p	0	1
chr11:119081187\|119081290	hsa-miR-5571-5p	0	1
chr1:20941491\|20941775	hsa-miR-5571-5p	1	0
chr19:46775353\|46775495	hsa-miR-5571-5p	1	0
chr6:30740509\|30740794	hsa-miR-5571-5p	1	0
chr12:56137898\|56138272	hsa-miR-5571-5p	1	0
chr18:31839312\|31846738	hsa-miR-5571-5p	1	0
chr22:24541745\|24541995	hsa-miR-5571-5p	1	0
chr11:46542165\|46542300	hsa-miR-5571-5p	1	0
chr11:83094895\|83095012	hsa-miR-5571-5p	1	0
chr1:156700611\|156700958	hsa-miR-5571-5p	1	0
chr12:55993504\|55993642	hsa-miR-5571-5p	1	0
chr2:236131095\|236131244	hsa-miR-5571-5p	0	1
chr6:105611828\|105612018	hsa-miR-5571-5p	0	1
chr12:117143442\|117143637	hsa-miR-5571-5p	0	1
chr4:56460024\|56460157	hsa-miR-5571-5p	0	1
chr10:24543948\|24544079	hsa-miR-5571-5p	0	1
chr14:95203458\|95203592	hsa-miR-5571-5p	0	1
chr1:147620032\|147620412	hsa-miR-5571-5p	0	1
chr20:2658109\|2658234	hsa-miR-5571-5p	0	1
chr10:102139990\|102140227	hsa-miR-5571-5p	0	1
chr2:218265040\|218265436	hsa-miR-5571-5p	0	1
chr17:34255296\|34255425	hsa-miR-5571-5p	0	1
chr12:31326496\|31326669	hsa-miR-5571-5p	0	1
chr22:32859641\|32859771	hsa-miR-5571-5p	0	1
chr1:209428915\|209429043	hsa-miR-5571-5p	0	1
chr20:2658080\|2658234	hsa-miR-5571-5p	0	1
chr5:80157021\|80157135	hsa-miR-5571-5p	0	1
chr20:2658111\|2658234	hsa-miR-5571-5p	0	1
chr12:82849892\|82850019	hsa-miR-5571-5p	0	1
chr10:48465600\|48465792	hsa-miR-5571-5p	0	1
chr1:32334845\|32334968	hsa-miR-5571-5p	0	1
chr16:69695136\|69695379	hsa-miR-5571-5p	0	1
chr5:177371358\|177371543	hsa-miR-5571-5p	0	1
chr9:123381442~123381749	hsa-miR-5571-5p	0	1
chr2:236131105~236131257	hsa-miR-5571-5p	0	1
chr16:15703227~15703353	hsa-miR-5571-5p	0	1
chr16:1362672~1362906	hsa-miR-5571-5p	0	1
chr1:214620748~214620834	hsa-miR-5571-5p	0	1
chr17:34255306~34255425	hsa-miR-5571-5p	0	1
chr17:48926962~48927122	hsa-miR-5571-5p	0	1
chr10:86500220~86500349	hsa-miR-5571-5p	0	1
chr3:148840702~148840901	hsa-miR-5571-5p	0	1
chr8:58450918~58451012	hsa-miR-5571-5p	0	1
chr17:39404701~39404817	hsa-miR-5571-5p	0	1
chr14:105855915~105856198	hsa-miR-5571-5p	0	1
chr3:37984140~37984309	hsa-miR-5571-5p	0	1
chr20:45897723~45898066	hsa-miR-5571-5p	0	1
chr4:40100060\|40100228	hsa-miR-5571-5p	0	1
chr16:57135080\|57135205	hsa-miR-5571-5p	0	1
chr7:133661177\|133661376	hsa-miR-5571-5p	0	1
chr6:17810761\|17810996	hsa-miR-5571-5p	0	1
chr18:57015754\|57015852	hsa-miR-5571-5p	0	1
chr5:169840939\|169841186	hsa-miR-5571-5p	0	1
chr11:72233441\|72233654	hsa-miR-5571-5p	1	0
chr11:118898042\|118898183	hsa-miR-5571-5p	1	0
chr15:65776541\|65776644	hsa-miR-5571-5p	0	1
chr17:15505282\|15505423	hsa-miR-5571-5p	0	1
chr1:6094906\|6095073	hsa-miR-5571-5p	0	1
chr17:75832255\|75832439	hsa-miR-5571-5p	0	1
chr15:42988663\|42988853	hsa-miR-5571-5p	0	1
chr1:155268564\|155268744	hsa-miR-5571-5p	0	1
chr4:25676978\|25677124	hsa-miR-5571-5p	1	0
chr19:10643847\|10644083	hsa-miR-5571-5p	1	0
chr12:13215254\|13215366	hsa-miR-5571-5p	1	0
chr12:56137886\|56138272	hsa-miR-5571-5p	1	0
chr17:78174624\|78174753	hsa-miR-5571-5p	1	0
chr1:153643897\|153644114	hsa-miR-5571-5p	1	0
chr6:30740285\|30740781	hsa-miR-5571-5p	1	0
chr19:39413015\|39413378	hsa-miR-5571-5p	1	0
chr6:30740287\|30740781	hsa-miR-5571-5p	1	0
chr12:56138026\|56138272	hsa-miR-5571-5p	1	0
chr1:32334845\|32334953	hsa-miR-5571-5p	0	1
chr20:2658130\|2658234	hsa-miR-5571-5p	0	1
chr12:116713729\|116713910	hsa-miR-5571-5p	0	1
chr1:202727823\|202728082	hsa-miR-5571-5p	0	1
chr22:32859602\|32859751	hsa-miR-5571-5p	0	1
chr2:75655957\|75656099	hsa-miR-5571-5p	0	1
chrX:19588662\|19588789	hsa-miR-5571-5p	0	1
chr17:34255306\|34255425	hsa-miR-5571-5p	0	1
chr3:127690070\|127690187	hsa-miR-5571-5p	0	1
chr22:17180920\|17181054	hsa-miR-5571-5p	0	1
chr12:12913311\|12913510	hsa-miR-5571-5p	0	1
chr2:236131055\|236131244	hsa-miR-5571-5p	0	1
chr1:32334845\|32334972	hsa-miR-5571-5p	0	1
chr1:40072949\|40073160	hsa-miR-5571-5p	0	1
chr9:98123590\|98123846	hsa-miR-5571-5p	0	1
chr14:103136319\|103136482	hsa-miR-5571-5p	0	1
chr22:32859641\|32859751	hsa-miR-5571-5p	0	1
chr17:4178857\|4178994	hsa-miR-5571-5p	0	1
chr1:147620311\|147620412	hsa-miR-5571-5p	0	1
chr2:201248876\|201249078	hsa-miR-5571-5p	0	1
chr2:86604123\|86604257	hsa-miR-5571-5p	0	1
chrX:19588643\|19588793	hsa-miR-5571-5p	0	1
chr12:12960344\|12960501	hsa-miR-5571-5p	0	1
chr16:1362825\|1363112	hsa-miR-5571-5p	0	1
chr1:41070595\|41075451	hsa-miR-5571-5p	0	1
chrX:41348532\|41348699	hsa-miR-5571-5p	0	1
chr2:236131105\|236131257	hsa-miR-5571-5p	0	1
chr20:2658069\|2658234	hsa-miR-5571-5p	0	1
chr19:54173871\|54173995	hsa-miR-5571-5p	0	1
chr1:32334845\|32334935	hsa-miR-5571-5p	0	1
chr1:32334845\|32334959	hsa-miR-5571-5p	0	1
chr11:769416\|769510	hsa-miR-5571-5p	0	1
chr15:65888196\|65888454	hsa-miR-5571-5p	0	1
chr8:26656339\|26656715	hsa-miR-5571-5p	0	1
chr2:119481339\|119481521	hsa-miR-5571-5p	0	1
chr5:138286497\|138286626	hsa-miR-5571-5p	0	1
chr7:103102495\|103102664	hsa-miR-5571-5p	0	1
chr21:45513630\|45513787	hsa-miR-5571-5p	0	1
chr2:86604123\|86604234	hsa-miR-5571-5p	0	1
chr14:22812986\|22813111	hsa-miR-5571-5p	0	1
chr2:236131111\|236131257	hsa-miR-5571-5p	0	1
chr1:15429596\|15429716	hsa-miR-5571-5p	0	1
chr3:37984140\|37984303	hsa-miR-5571-5p	0	1
chr1:15429591\|15429795	hsa-miR-5571-5p	0	1
chr2:236131055\|236131257	hsa-miR-5571-5p	-1	1
chr16:15703286\|15703397	hsa-miR-5571-5p	-11	1
chr6:30900066\|30900257	hsa-miR-5571-5p	-2	1
chr7:4770422\|4770682	hsa-miR-5571-5p	1	0
chr12:55993492\|55993676	hsa-miR-5571-5p	1	0
chr19:19515905\|19516015	hsa-miR-5571-5p	1	0
chr1:19814247\|19814357	hsa-miR-5571-5p	1	0
chr16:15703227\|15703353	hsa-miR-5571-5p	0	1
chr15:41280886\|41281021	hsa-miR-5571-5p	0	1
chr12:56159682\|56160075	hsa-miR-5571-5p	0	1
chr20:2658093\|2658234	hsa-miR-5571-5p	0	1
chr12:12913326\|12913490	hsa-miR-5571-5p	0	1
chrX:19588643\|19588791	hsa-miR-5571-5p	0	1
chr12:12913326\|12913604	hsa-miR-5571-5p	0	1
chr11:48139626\|48139756	hsa-miR-5571-5p	0	1
chr12:56159691\|56160075	hsa-miR-5571-5p	0	1
chr11:10854160\|10854382	hsa-miR-5571-5p	0	1
chr2:236131076\|236131257	hsa-miR-5571-5p	0	1
chrX:19588643\|19588789	hsa-miR-5571-5p	0	1
chr16:15703286\|15703598	hsa-miR-5571-5p	0	1
chrX:53420132\|53420238	hsa-miR-5571-5p	0	1
chr1:32334845\|32335016	hsa-miR-5571-5p	0	1
chr20:45381035\|45381160	hsa-miR-5571-5p	0	1
chr7:27154214\|27154487	hsa-miR-5571-5p	0	1
chr17:16350296\|16350470	hsa-miR-5571-5p	0	1
chr2:218265125\|218265436	hsa-miR-5571-5p	0	1
chr9:123381442\|123381556	hsa-miR-5571-5p	0	1
chr2:196134299\|196134483	hsa-miR-5571-5p	0	1
chr19:47271520\|47271649	hsa-miR-5571-5p	0	1
chr2:86604123\|86604250	hsa-miR-5571-5p	0	1
chr16:15703286\|15703441	hsa-miR-5571-5p	0	1
chr2:218265035\|218265425	hsa-miR-5571-5p	0	1
chr20:57170861\|57171021	hsa-miR-5571-5p	0	1
chr17:42189198\|42189325	hsa-miR-5571-5p	0	1
chr14:75084121\|75084258	hsa-miR-5571-5p	0	1
chr20:57170861\|57171093	hsa-miR-5571-5p	0	1
chr12:121969735\|121970027	hsa-miR-5571-5p	0	1
chrX:19588643\|19588802	hsa-miR-5571-5p	0	1
chr16:15703286\|15703455	hsa-miR-5571-5p	0	1
chr1:15429599\|15429862	hsa-miR-5571-5p	0	1
chr3:37984142\|37984303	hsa-miR-5571-5p	0	1
chr1:204551018\|204551169	hsa-miR-5571-5p	1	0
chrX:130051923\|130055881	hsa-miR-5571-5p	0	1
chr22:37691459\|37691687	hsa-miR-5571-5p	0	1
chr4:56460024\|56460204	hsa-miR-5571-5p	1	0
chr12:56138026\|56138246	hsa-miR-5571-5p	1	0
chr19:55089376\|55089521	hsa-miR-5571-5p	1	0
chr2:30259466\|30259698	hsa-miR-5571-5p	1	0
chr12:56138026\|56138262	hsa-miR-5571-5p	1	0
chr11:118898037\|118898183	hsa-miR-5571-5p	1	0
chr12:1646671\|1646859	hsa-miR-5571-5p	1	0

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-miR-5571-5p	ZFP3	ZFP3 zinc finger protein	HGNC:12861	details
hsa-miR-5571-5p	CFHR3	complement factor H related 3	HGNC:16980	details
hsa-miR-5571-5p	CDH7	cadherin 7	HGNC:1766	details
hsa-miR-5571-5p	ESD	esterase D	HGNC:3465	details
hsa-miR-5571-5p	NFATC2	nuclear factor of activated T cells 2	HGNC:7776	details
hsa-miR-5571-5p	ASTN2	astrotactin 2	HGNC:17021	details
hsa-miR-5571-5p	CLOCK	clock circadian regulator	HGNC:2082	details
hsa-miR-5571-5p	AGK	acylglycerol kinase	HGNC:21869	details
hsa-miR-5571-5p	UQCR11	ubiquinol-cytochrome c reductase, complex III subunit XI	HGNC:30862	details
hsa-miR-5571-5p	CES2	carboxylesterase 2	HGNC:1864	details
hsa-miR-5571-5p	SLC26A2	solute carrier family 26 member 2	HGNC:10994	details
hsa-miR-5571-5p	SGK1	serum/glucocorticoid regulated kinase 1	HGNC:10810	details
hsa-miR-5571-5p	NAA25	N-alpha-acetyltransferase 25, NatB auxiliary subunit	HGNC:25783	details
hsa-miR-5571-5p	HNRNPF	heterogeneous nuclear ribonucleoprotein F	HGNC:5039	details
hsa-miR-5571-5p	GPAM	glycerol-3-phosphate acyltransferase, mitochondrial	HGNC:24865	details
hsa-miR-5571-5p	CTNS	cystinosin, lysosomal cystine transporter	HGNC:2518	details
hsa-miR-5571-5p	CERS2	ceramide synthase 2	HGNC:14076	details
hsa-miR-5571-5p	SPATA6	spermatogenesis associated 6	HGNC:18309	details
hsa-miR-5571-5p	ZKSCAN1	zinc finger with KRAB and SCAN domains 1	HGNC:13101	details
hsa-miR-5571-5p	SLC30A1	solute carrier family 30 member 1	HGNC:11012	details
hsa-miR-5571-5p	TMEM233	transmembrane protein 233	HGNC:37219	details
hsa-miR-5571-5p	SOS1	SOS Ras/Rac guanine nucleotide exchange factor 1	HGNC:11187	details
hsa-miR-5571-5p	EIF3H	eukaryotic translation initiation factor 3 subunit H	HGNC:3273	details
hsa-miR-5571-5p	ZNF169	zinc finger protein 169	HGNC:12957	details
hsa-miR-5571-5p	HSF5	heat shock transcription factor 5	HGNC:26862	details
hsa-miR-5571-5p	SMARCE1	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1	HGNC:11109	details
hsa-miR-5571-5p	PANK3	pantothenate kinase 3	HGNC:19365	details
hsa-miR-5571-5p	OTUD4	OTU deubiquitinase 4	HGNC:24949	details
hsa-miR-5571-5p	DSTN	destrin, actin depolymerizing factor	HGNC:15750	details
hsa-miR-5571-5p	ZNF850	zinc finger protein 850	HGNC:27994	details
hsa-miR-5571-5p	ZNF616	zinc finger protein 616	HGNC:28062	details
hsa-miR-5571-5p	MED28	mediator complex subunit 28	HGNC:24628	details
hsa-miR-5571-5p	MRGBP	MRG domain binding protein	HGNC:15866	details
hsa-miR-5571-5p	LSM14A	LSM14A mRNA processing body assembly factor	HGNC:24489	details
hsa-miR-5571-5p	VAPB	VAMP associated protein B and C	HGNC:12649	details
hsa-miR-5571-5p	A1CF	APOBEC1 complementation factor	HGNC:24086	details
hsa-miR-5571-5p	DCTN6	dynactin subunit 6	HGNC:16964	details
hsa-miR-5571-5p	ZNF394	zinc finger protein 394	HGNC:18832	details
hsa-miR-5571-5p	ZFP69B	ZFP69 zinc finger protein B	HGNC:28053	details
hsa-miR-5571-5p	SENP1	SUMO specific peptidase 1	HGNC:17927	details
hsa-miR-5571-5p	ARL5B	ADP ribosylation factor like GTPase 5B	HGNC:23052	details
hsa-miR-5571-5p	AKAP11	A-kinase anchoring protein 11	HGNC:369	details
hsa-miR-5571-5p	ACTN4	actinin alpha 4	HGNC:166	details
hsa-miR-5571-5p	ZNF675	zinc finger protein 675	HGNC:30768	details
hsa-miR-5571-5p	LRP6	LDL receptor related protein 6	HGNC:6698	details
hsa-miR-5571-5p	KLHL15	kelch like family member 15	HGNC:29347	details
hsa-miR-5571-5p	DDX3X	DEAD-box helicase 3 X-linked	HGNC:2745	details
hsa-miR-5571-5p	COL19A1	collagen type XIX alpha 1 chain	HGNC:2196	details
hsa-miR-5571-5p	KDELR1	KDEL endoplasmic reticulum protein retention receptor 1	HGNC:6304	details
hsa-miR-5571-5p	TMEM117	transmembrane protein 117	HGNC:25308	details
hsa-miR-5571-5p	APIP	APAF1 interacting protein	HGNC:17581	details
hsa-miR-5571-5p	FYTTD1	forty-two-three domain containing 1	HGNC:25407	details
hsa-miR-5571-5p	ZNF805	zinc finger protein 805	HGNC:23272	details
hsa-miR-5571-5p	TFAP2C	transcription factor AP-2 gamma	HGNC:11744	details
hsa-miR-5571-5p	PHKA1	phosphorylase kinase regulatory subunit alpha 1	HGNC:8925	details
hsa-miR-5571-5p	DR1	down-regulator of transcription 1	HGNC:3017	details
hsa-miR-5571-5p	MLEC	malectin	HGNC:28973	details
hsa-miR-5571-5p	FUT4	fucosyltransferase 4	HGNC:4015	details
hsa-miR-5571-5p	FAM217B	family with sequence similarity 217 member B	HGNC:16170	details
hsa-miR-5571-5p	C18orf25	chromosome 18 open reading frame 25	HGNC:28172	details
hsa-miR-5571-5p	AKAP10	A-kinase anchoring protein 10	HGNC:368	details
hsa-miR-5571-5p	ZNF525	zinc finger protein 525	HGNC:29423	details
hsa-miR-5571-5p	ZNF195	zinc finger protein 195	HGNC:12986	details
hsa-miR-5571-5p	ZCCHC3	zinc finger CCHC-type containing 3	HGNC:16230	details
hsa-miR-5571-5p	ZNF415	zinc finger protein 415	HGNC:20636	details
hsa-miR-5571-5p	ZNF468	zinc finger protein 468	HGNC:33105	details
hsa-miR-5571-5p	SDE2	SDE2 telomere maintenance homolog	HGNC:26643	details
hsa-miR-5571-5p	ZNF487	zinc finger protein 487	HGNC:23488	details
hsa-miR-5571-5p	ZNF286B	zinc finger protein 286B (pseudogene)	HGNC:33241	details
hsa-miR-5571-5p	ZCCHC14	zinc finger CCHC-type containing 14	HGNC:24134	details
hsa-miR-5571-5p	IGFBP5	insulin like growth factor binding protein 5	HGNC:5474	details
hsa-miR-5571-5p	ACVR2B	activin A receptor type 2B	HGNC:174	details
hsa-miR-5571-5p	ZFP1	ZFP1 zinc finger protein	HGNC:23328	details
hsa-miR-5571-5p	AFF1	AF4/FMR2 family member 1	HGNC:7135	details
hsa-miR-5571-5p	GNA13	G protein subunit alpha 13	HGNC:4381	details
hsa-miR-5571-5p	ZNF790	zinc finger protein 790	HGNC:33114	details
hsa-miR-5571-5p	SLC16A9	solute carrier family 16 member 9	HGNC:23520	details
hsa-miR-5571-5p	PLA2G7	phospholipase A2 group VII	HGNC:9040	details
hsa-miR-5571-5p	SH3PXD2A	SH3 and PX domains 2A	HGNC:23664	details
hsa-miR-5571-5p	FAM227A	family with sequence similarity 227 member A	HGNC:44197	details
hsa-miR-5571-5p	SIGLEC9	sialic acid binding Ig like lectin 9	HGNC:10878	details
hsa-miR-5571-5p	TET1	tet methylcytosine dioxygenase 1	HGNC:29484	details
hsa-miR-5571-5p	SYAP1	synapse associated protein 1	HGNC:16273	details
hsa-miR-5571-5p	SOX4	SRY-box transcription factor 4	HGNC:11200	details
hsa-miR-5571-5p	PABPN1	poly(A) binding protein nuclear 1	HGNC:8565	details
hsa-miR-5571-5p	NME6	NME/NM23 nucleoside diphosphate kinase 6	HGNC:20567	details
hsa-miR-5571-5p	C3orf62	chromosome 3 open reading frame 62	HGNC:24771	details
hsa-miR-5571-5p	BCL2L2-PABPN1	BCL2L2-PABPN1 readthrough	HGNC:42959	details
hsa-miR-5571-5p	ACO1	aconitase 1	HGNC:117	details
hsa-miR-5571-5p	ZNF716	zinc finger protein 716	HGNC:32458	details
hsa-miR-5571-5p	PGBD4	piggyBac transposable element derived 4	HGNC:19401	details
hsa-miR-5571-5p	AP3M1	adaptor related protein complex 3 subunit mu 1	HGNC:569	details
hsa-miR-5571-5p	ANTXR2	ANTXR cell adhesion molecule 2	HGNC:21732	details
hsa-miR-5571-5p	MSANTD3	Myb/SANT DNA binding domain containing 3	HGNC:23370	details
hsa-miR-5571-5p	ACBD7	acyl-CoA binding domain containing 7	HGNC:17715	details
hsa-miR-5571-5p	IL17RA	interleukin 17 receptor A	HGNC:5985	details
hsa-miR-5571-5p				details
hsa-miR-5571-5p	TCEANC2	transcription elongation factor A N-terminal and central domain containing 2	HGNC:26494	details
hsa-miR-5571-5p	SKAP2	src kinase associated phosphoprotein 2	HGNC:15687	details
hsa-miR-5571-5p				details
hsa-miR-5571-5p	PHLDA3	pleckstrin homology like domain family A member 3	HGNC:8934	details
hsa-miR-5571-5p	KIAA1614	KIAA1614	HGNC:29327	details
hsa-miR-5571-5p	ELOC	elongin C	HGNC:11617	details
hsa-miR-5571-5p	PSMB5	proteasome 20S subunit beta 5	HGNC:9542	details
hsa-miR-5571-5p	PCDHA6	protocadherin alpha 6	HGNC:8672	details
hsa-miR-5571-5p	FBXO47	F-box protein 47	HGNC:31969	details
hsa-miR-5571-5p	SEC23IP	SEC23 interacting protein	HGNC:17018	details
hsa-miR-5571-5p	MYOCD	myocardin	HGNC:16067	details
hsa-miR-5571-5p	KCNK2	potassium two pore domain channel subfamily K member 2	HGNC:6277	details
hsa-miR-5571-5p	ZNF99	zinc finger protein 99	HGNC:13175	details
hsa-miR-5571-5p	ACSM2A	acyl-CoA synthetase medium chain family member 2A	HGNC:32017	details
hsa-miR-5571-5p	TYW3	tRNA-yW synthesizing protein 3 homolog	HGNC:24757	details
hsa-miR-5571-5p	PRSS21	serine protease 21	HGNC:9485	details
hsa-miR-5571-5p	PARG	poly(ADP-ribose) glycohydrolase	HGNC:8605	details
hsa-miR-5571-5p	NPR1	natriuretic peptide receptor 1	HGNC:7943	details
hsa-miR-5571-5p	NT5C2	5'-nucleotidase, cytosolic II	HGNC:8022	details
hsa-miR-5571-5p	ZDHHC24	zinc finger DHHC-type containing 24	HGNC:27387	details
hsa-miR-5571-5p	RPL37	ribosomal protein L37	HGNC:10347	details
hsa-miR-5571-5p	CD68	CD68 molecule	HGNC:1693	details
hsa-miR-5571-5p	ZDHHC21	zinc finger DHHC-type palmitoyltransferase 21	HGNC:20750	details
hsa-miR-5571-5p	RABIF	RAB interacting factor	HGNC:9797	details
hsa-miR-5571-5p	MEX3A	mex-3 RNA binding family member A	HGNC:33482	details
hsa-miR-5571-5p	KLF8	Kruppel like factor 8	HGNC:6351	details
hsa-miR-5571-5p	HNRNPK	heterogeneous nuclear ribonucleoprotein K	HGNC:5044	details
hsa-miR-5571-5p	GK5	glycerol kinase 5	HGNC:28635	details
hsa-miR-5571-5p	FOXR2	forkhead box R2	HGNC:30469	details
hsa-miR-5571-5p	FKBP14	FKBP prolyl isomerase 14	HGNC:18625	details
hsa-miR-5571-5p	DDHD1	DDHD domain containing 1	HGNC:19714	details
hsa-miR-5571-5p	CEP135	centrosomal protein 135	HGNC:29086	details
hsa-miR-5571-5p	CAPN6	calpain 6	HGNC:1483	details
hsa-miR-5571-5p	CAMK2G	calcium/calmodulin dependent protein kinase II gamma	HGNC:1463	details
hsa-miR-5571-5p	ABHD2	abhydrolase domain containing 2, acylglycerol lipase	HGNC:18717	details
hsa-miR-5571-5p	ALDH7A1	aldehyde dehydrogenase 7 family member A1	HGNC:877	details
hsa-miR-5571-5p	RNF128	ring finger protein 128	HGNC:21153	details
hsa-miR-5571-5p	PRRG4	proline rich and Gla domain 4	HGNC:30799	details
hsa-miR-5571-5p	TGOLN2	trans-golgi network protein 2	HGNC:15450	details
hsa-miR-5571-5p	POC1A	POC1 centriolar protein A	HGNC:24488	details
hsa-miR-5571-5p	KDM7A	lysine demethylase 7A	HGNC:22224	details
hsa-miR-5571-5p	FOSL2	FOS like 2, AP-1 transcription factor subunit	HGNC:3798	details
hsa-miR-5571-5p	DTWD2	DTW domain containing 2	HGNC:19334	details
hsa-miR-5571-5p	ALDOA	aldolase, fructose-bisphosphate A	HGNC:414	details
hsa-miR-5571-5p	ASB16	ankyrin repeat and SOCS box containing 16	HGNC:19768	details
hsa-miR-5571-5p	ADK	adenosine kinase	HGNC:257	details
hsa-miR-5571-5p	CAV2	caveolin 2	HGNC:1528	details
hsa-miR-5571-5p	RSL1D1	ribosomal L1 domain containing 1	HGNC:24534	details
hsa-miR-5571-5p	OGFOD1	2-oxoglutarate and iron dependent oxygenase domain containing 1	HGNC:25585	details
hsa-miR-5571-5p	SLC25A37	solute carrier family 25 member 37	HGNC:29786	details
hsa-miR-5571-5p	ZNF844	zinc finger protein 844	HGNC:25932	details
hsa-miR-5571-5p	PLEKHM3	pleckstrin homology domain containing M3	HGNC:34006	details
hsa-miR-5571-5p	DSN1	DSN1 component of MIS12 kinetochore complex	HGNC:16165	details
hsa-miR-5571-5p	GJD3	gap junction protein delta 3	HGNC:19147	details
hsa-miR-5571-5p	METTL14	methyltransferase 14, N6-adenosine-methyltransferase subunit	HGNC:29330	details
hsa-miR-5571-5p	HINFP	histone H4 transcription factor	HGNC:17850	details
hsa-miR-5571-5p	SMIM15	small integral membrane protein 15	HGNC:33861	details
hsa-miR-5571-5p	CAVIN4	caveolae associated protein 4	HGNC:33742	details
hsa-miR-5571-5p	SNRPD1	small nuclear ribonucleoprotein D1 polypeptide	HGNC:11158	details
hsa-miR-5571-5p	SLC7A11	solute carrier family 7 member 11	HGNC:11059	details
hsa-miR-5571-5p	PDCD4	programmed cell death 4	HGNC:8763	details
hsa-miR-5571-5p	ZNF329	zinc finger protein 329	HGNC:14209	details
hsa-miR-5571-5p	RBM3	RNA binding motif protein 3	HGNC:9900	details
hsa-miR-5571-5p	LRP10	LDL receptor related protein 10	HGNC:14553	details
hsa-miR-5571-5p	AS3MT	arsenite methyltransferase	HGNC:17452	details
hsa-miR-5571-5p	TOP3A	DNA topoisomerase III alpha	HGNC:11992	details
hsa-miR-5571-5p	HPSE	heparanase	HGNC:5164	details
hsa-miR-5571-5p	WFDC6	WAP four-disulfide core domain 6	HGNC:16164	details
hsa-miR-5571-5p	ZNF578	zinc finger protein 578	HGNC:26449	details
hsa-miR-5571-5p	LYRM7	LYR motif containing 7	HGNC:28072	details
hsa-miR-5571-5p	HASPIN	histone H3 associated protein kinase	HGNC:19682	details
hsa-miR-5571-5p	ZNF544	zinc finger protein 544	HGNC:16759	details
hsa-miR-5571-5p	TMED10	transmembrane p24 trafficking protein 10	HGNC:16998	details
hsa-miR-5571-5p	L1CAM	L1 cell adhesion molecule	HGNC:6470	details
hsa-miR-5571-5p	ATP1B3	ATPase Na+/K+ transporting subunit beta 3	HGNC:806	details
hsa-miR-5571-5p	KPNA5	karyopherin subunit alpha 5	HGNC:6398	details
hsa-miR-5571-5p	SERINC1	serine incorporator 1	HGNC:13464	details
hsa-miR-5571-5p	FAM216A	family with sequence similarity 216 member A	HGNC:30180	details
hsa-miR-5571-5p	ZNF486	zinc finger protein 486	HGNC:20807	details
hsa-miR-5571-5p	SETBP1	SET binding protein 1	HGNC:15573	details
hsa-miR-5571-5p	PPM1K	protein phosphatase, Mg2+/Mn2+ dependent 1K	HGNC:25415	details
hsa-miR-5571-5p	TRABD2A	TraB domain containing 2A	HGNC:27013	details
hsa-miR-5571-5p	DSTYK	dual serine/threonine and tyrosine protein kinase	HGNC:29043	details
hsa-miR-5571-5p	AP5M1	adaptor related protein complex 5 subunit mu 1	HGNC:20192	details
hsa-miR-5571-5p	BTBD19	BTB domain containing 19	HGNC:27145	details
hsa-miR-5571-5p	TRMT13	tRNA methyltransferase 13 homolog	HGNC:25502	details
hsa-miR-5571-5p	NLRP10	NLR family pyrin domain containing 10	HGNC:21464	details
hsa-miR-5571-5p	MIPOL1	mirror-image polydactyly 1	HGNC:21460	details
hsa-miR-5571-5p	CDKN1A	cyclin dependent kinase inhibitor 1A	HGNC:1784	details
hsa-miR-5571-5p	PRR14L	proline rich 14 like	HGNC:28738	details
hsa-miR-5571-5p	PTMA	prothymosin alpha	HGNC:9623	details
hsa-miR-5571-5p	AGO4	argonaute RISC component 4	HGNC:18424	details
hsa-miR-5571-5p	ARFGEF3	ARFGEF family member 3	HGNC:21213	details
hsa-miR-5571-5p	C11orf1	chromosome 11 open reading frame 1	HGNC:1163	details
hsa-miR-5571-5p	CRCP	CGRP receptor component	HGNC:17888	details
hsa-miR-5571-5p	ETFDH	electron transfer flavoprotein dehydrogenase	HGNC:3483	details
hsa-miR-5571-5p	GJC1	gap junction protein gamma 1	HGNC:4280	details
hsa-miR-5571-5p	GMEB1	glucocorticoid modulatory element binding protein 1	HGNC:4370	details
hsa-miR-5571-5p	GMNN	geminin DNA replication inhibitor	HGNC:17493	details
hsa-miR-5571-5p	GPBP1	GC-rich promoter binding protein 1	HGNC:29520	details
hsa-miR-5571-5p	GTF3C6	general transcription factor IIIC subunit 6	HGNC:20872	details
hsa-miR-5571-5p	METTL2B	methyltransferase 2B, methylcytidine	HGNC:18272	details
hsa-miR-5571-5p	MRNIP	MRN complex interacting protein	HGNC:30817	details
hsa-miR-5571-5p	MSRB2	methionine sulfoxide reductase B2	HGNC:17061	details
hsa-miR-5571-5p	NCOA7	nuclear receptor coactivator 7	HGNC:21081	details
hsa-miR-5571-5p	PEX26	peroxisomal biogenesis factor 26	HGNC:22965	details
hsa-miR-5571-5p	RFC2	replication factor C subunit 2	HGNC:9970	details
hsa-miR-5571-5p	SDHAF1	succinate dehydrogenase complex assembly factor 1	HGNC:33867	details
hsa-miR-5571-5p	THAP6	THAP domain containing 6	HGNC:23189	details
hsa-miR-5571-5p	TIRAP	TIR domain containing adaptor protein	HGNC:17192	details
hsa-miR-5571-5p	TMEM154	transmembrane protein 154	HGNC:26489	details
hsa-miR-5571-5p	TOR1AIP1	torsin 1A interacting protein 1	HGNC:29456	details
hsa-miR-5571-5p	TXK	TXK tyrosine kinase	HGNC:12434	details
hsa-miR-5571-5p	UGGT2	UDP-glucose glycoprotein glucosyltransferase 2	HGNC:15664	details
hsa-miR-5571-5p	ZBTB3	zinc finger and BTB domain containing 3	HGNC:22918	details
hsa-miR-5571-5p	ZFP14	ZFP14 zinc finger protein	HGNC:29312	details
hsa-miR-5571-5p	ZNF623	zinc finger protein 623	HGNC:29084	details
hsa-miR-5571-5p	GNPTAB	N-acetylglucosamine-1-phosphate transferase subunits alpha and beta	HGNC:29670	details
hsa-miR-5571-5p	LCAT	lecithin-cholesterol acyltransferase	HGNC:6522	details
hsa-miR-5571-5p	REEP1	receptor accessory protein 1	HGNC:25786	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)