miRNA Card

miRNA General Information
miRNA ID hsa-miR-5580-3p
Description Homo sapiens miR-5580 stem-loop
Comment None
Experiment
Sequence CACAUAUGAAGUGAGCCAGCAC
miRNA Expression in different cancers


circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr6:85547112|85572374 hsa-miR-5580-3p 1 1 1

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr10:1054030|1054168 hsa-miR-5580-3p 1 0 0
chr13:26214279|26214536 hsa-miR-5580-3p 1 0 0
chr8:38838506|38840267 hsa-miR-5580-3p 1 0 0
chr22:42912021|42912157 hsa-miR-5580-3p 1 0 0
chr22:41694359|41694472 hsa-miR-5580-3p 0 1 0
chr14:100143796|100144053 hsa-miR-5580-3p 0 1 0
chr17:57109419|57109545 hsa-miR-5580-3p 0 1 0
chr13:27432672|27432857 hsa-miR-5580-3p 0 1 0
chr3:37075024|37075101 hsa-miR-5580-3p 0 1 0
chr11:33672136|33672297 hsa-miR-5580-3p 0 1 0
chr11:67586410|67586547 hsa-miR-5580-3p 0 1 0
chr19:38291974|38292125 hsa-miR-5580-3p 0 1 0
chr19:38291977|38292108 hsa-miR-5580-3p 0 1 0
chr5:138555559|138555701 hsa-miR-5580-3p 0 1 0
chr11:65650155|65650601 hsa-miR-5580-3p 0 1 0
chr16:28495289|28495393 hsa-miR-5580-3p 1 0 0
chr18:36109665|36111152 hsa-miR-5580-3p 1 0 0
chr12:56242405|56242506 hsa-miR-5580-3p 1 0 0
chr10:73793379|73793534 hsa-miR-5580-3p 1 0 0
chr15:50242027|50242119 hsa-miR-5580-3p 1 0 0
chr1:226146136|226146308 hsa-miR-5580-3p 0 1 0
chr3:37327054|37327148 hsa-miR-5580-3p 0 1 0
chr12:47966094|47966212 hsa-miR-5580-3p 0 1 0
chr11:102398551|102398660 hsa-miR-5580-3p 0 1 0
chr17:40089734|40089874 hsa-miR-5580-3p 0 1 0
chr1:156093255|156093334 hsa-miR-5580-3p 0 1 0
chr11:117373751|117373815 hsa-miR-5580-3p 0 1 0
chr19:41286210|41286320 hsa-miR-5580-3p 0 1 0
chr3:42659712|42659828 hsa-miR-5580-3p 0 1 0
chrX:49174761|49174950 hsa-miR-5580-3p 0 1 0
chr22:41694352|41694472 hsa-miR-5580-3p 0 1 0
chr5:44304439|44304678 hsa-miR-5580-3p 0 1 0
chr20:20389940|20390044 hsa-miR-5580-3p 0 1 0
chrX:49174734|49174895 hsa-miR-5580-3p 0 1 0
chr2:60929690|60929930 hsa-miR-5580-3p 0 1 0
chr6:42692898|42693077 hsa-miR-5580-3p 0 1 0
chr11:65188422|65188746 hsa-miR-5580-3p 0 1 0
chr12:57613050~57613359 hsa-miR-5580-3p 0 1 0
chr4:87981616~87981736 hsa-miR-5580-3p 0 1 0
chr4:87981559~87981736 hsa-miR-5580-3p 0 1 0
chr20:1938459~1938560 hsa-miR-5580-3p 0 1 0
chr1:226992155~226992284 hsa-miR-5580-3p 0 1 0
chr1:40070213~40070467 hsa-miR-5580-3p 0 1 0
chr19:38291974~38292125 hsa-miR-5580-3p 0 1 0
chr19:38291966~38292125 hsa-miR-5580-3p 0 1 0
chr19:38291977~38292125 hsa-miR-5580-3p 0 1 0
chr11:67586410~67586547 hsa-miR-5580-3p 0 1 0
chr9:132679536|132679689 hsa-miR-5580-3p 0 1 0
chr5:151662398~151662545 hsa-miR-5580-3p 0 1 0
chr11:34480687~34480819 hsa-miR-5580-3p 0 1 0
chr14:24116105~24116256 hsa-miR-5580-3p 0 1 0
chr19:38291932~38292125 hsa-miR-5580-3p 0 1 0
chr10:51679679~51679844 hsa-miR-5580-3p 0 1 0
chr19:34386338~34386486 hsa-miR-5580-3p 0 1 0
chr4:87981559|87981736 hsa-miR-5580-3p 0 1 0
chr4:87981625|87981736 hsa-miR-5580-3p 0 1 0
chr12:111910989|111911084 hsa-miR-5580-3p 1 0 0
chr8:38838470|38838546 hsa-miR-5580-3p 1 0 0
chr18:63204053|63204224 hsa-miR-5580-3p 0 1 0
chr19:51643567|51643837 hsa-miR-5580-3p 0 1 0
chr9:2222857|2223036 hsa-miR-5580-3p 0 1 0
chr11:67586410|67586511 hsa-miR-5580-3p 0 1 0
chr1:40070213|40070512 hsa-miR-5580-3p 0 1 0
chr1:33009553|33009802 hsa-miR-5580-3p 0 1 0
chr14:68673502|68673717 hsa-miR-5580-3p 0 1 0
chr1:40070213|40070464 hsa-miR-5580-3p 0 1 0
chr19:16090912|16091048 hsa-miR-5580-3p 0 1 0
chr19:19534478|19534647 hsa-miR-5580-3p 1 0 0
chr8:143542106|143542298 hsa-miR-5580-3p 1 0 0
chr14:20457041|20457208 hsa-miR-5580-3p 0 1 0
chr20:19861879|19862049 hsa-miR-5580-3p 0 1 0
chr5:145637199|145637406 hsa-miR-5580-3p 0 1 0
chr1:40070168|40070512 hsa-miR-5580-3p 0 1 0
chr19:905741|905971 hsa-miR-5580-3p 0 1 0
chr15:65877782|65877955 hsa-miR-5580-3p 0 1 0
chr11:67586179|67586547 hsa-miR-5580-3p 0 1 0
chr2:178653238|178663902 hsa-miR-5580-3p 0 1 0
chr12:56242387|56242506 hsa-miR-5580-3p 1 0 0
chr11:35206455|35206593 hsa-miR-5580-3p 1 0 0
chr16:84173597|84173727 hsa-miR-5580-3p 1 0 0
chr1:150547811|150547898 hsa-miR-5580-3p 1 0 0
chr8:144411046|144411215 hsa-miR-5580-3p 1 0 0
chr1:228101339|228101464 hsa-miR-5580-3p 1 0 0
chr1:228101168|228101424 hsa-miR-5580-3p 1 0 0
chr14:24137372|24137743 hsa-miR-5580-3p 1 0 0
chr13:26214231|26214427 hsa-miR-5580-3p 1 0 0
chr7:93614899|93615146 hsa-miR-5580-3p 1 0 0
chr11:26559854|26559948 hsa-miR-5580-3p 1 0 0
chr19:38291932|38292125 hsa-miR-5580-3p 0 1 0
chr10:79613883|79614034 hsa-miR-5580-3p 0 1 0
chrX:100670972|100671125 hsa-miR-5580-3p 0 1 0
chr10:79613883|79614018 hsa-miR-5580-3p 0 1 0
chr10:79613872|79614036 hsa-miR-5580-3p 0 1 0
chr10:79613842|79614046 hsa-miR-5580-3p 0 1 0
chr4:87981555|87981747 hsa-miR-5580-3p 0 1 0
chr20:482677|482840 hsa-miR-5580-3p 0 1 0
chr19:38291977|38292125 hsa-miR-5580-3p 0 1 0
chr2:134458354|134458439 hsa-miR-5580-3p 0 1 0
chr1:150111192|150111309 hsa-miR-5580-3p 0 1 0
chr10:79613883|79614036 hsa-miR-5580-3p 0 1 0
chr10:79613874|79614034 hsa-miR-5580-3p 0 1 0
chr15:89197549|89197707 hsa-miR-5580-3p 0 1 0
chr1:16133481|16133881 hsa-miR-5580-3p 0 1 0
chr20:1937320|1937672 hsa-miR-5580-3p 0 1 0
chr4:71569101|71569194 hsa-miR-5580-3p 0 1 0
chr11:67586407|67586547 hsa-miR-5580-3p 0 1 0
chr10:79613751|79614034 hsa-miR-5580-3p 0 1 0
chr5:43174774|43175070 hsa-miR-5580-3p 0 1 0
chr4:87981625|87981761 hsa-miR-5580-3p 0 1 0
chr6:2665384|2665736 hsa-miR-5580-3p 0 1 0
chr10:62095293|62095409 hsa-miR-5580-3p 0 1 0
chr10:79613864|79614036 hsa-miR-5580-3p 0 1 0
chr10:79613826|79614034 hsa-miR-5580-3p 0 1 0
chr10:79613770|79614034 hsa-miR-5580-3p 0 1 0
chr2:70296147|70296422 hsa-miR-5580-3p 0 1 0
chr1:224371301|224371423 hsa-miR-5580-3p 0 1 0
chr19:38291935|38292125 hsa-miR-5580-3p 0 1 0
chr11:67586410|67586589 hsa-miR-5580-3p 0 1 0
chr10:79613837|79614034 hsa-miR-5580-3p 0 1 0
chr11:101450296|101450421 hsa-miR-5580-3p 0 1 0
chr2:170950271|170951458 hsa-miR-5580-3p 0 1 0
chr10:79613775|79614038 hsa-miR-5580-3p 0 1 0
chr4:128992167|129003876 hsa-miR-5580-3p 0 1 0
chr19:38291966|38292125 hsa-miR-5580-3p 0 1 0
chr20:32438546|32438666 hsa-miR-5580-3p 0 1 0
chr17:57109425|57109623 hsa-miR-5580-3p 0 1 0
chr10:79613864|79614034 hsa-miR-5580-3p 0 1 0
chr10:79613770|79613998 hsa-miR-5580-3p 0 1 0
chr19:35945539|35945685 hsa-miR-5580-3p 0 1 0
chr10:79613839|79614036 hsa-miR-5580-3p 0 1 0
chr2:203428043|203428176 hsa-miR-5580-3p 0 1 0
chr5:151662398|151662628 hsa-miR-5580-3p 0 1 0
chr11:65650162|65650601 hsa-miR-5580-3p 0 1 0
chr19:46312662|46312866 hsa-miR-5580-3p 0 1 0
chr1:156787017|156787174 hsa-miR-5580-3p 0 1 0
chr10:79613837|79614036 hsa-miR-5580-3p 0 1 0
chr5:128151267|128151365 hsa-miR-5580-3p 0 1 0
chr1:226145949|226146308 hsa-miR-5580-3p 0 1 0
chr19:38291891|38292125 hsa-miR-5580-3p 0 1 0
chr2:60929705|60929930 hsa-miR-5580-3p 0 1 0
chr4:87981533|87981761 hsa-miR-5580-3p 0 1 0
chr20:1938380|1938622 hsa-miR-5580-3p 0 1 0
chr1:40070213|40070492 hsa-miR-5580-3p 0 1 0
chr10:79557288|79557439 hsa-miR-5580-3p 0 1 0
chr4:146702455|146702574 hsa-miR-5580-3p 0 1 0
chr4:87981593|87981761 hsa-miR-5580-3p 0 1 0
chr19:38291974|38292159 hsa-miR-5580-3p 0 1 0
chr4:87981555|87981744 hsa-miR-5580-3p 0 1 0
chr15:78266318|78266496 hsa-miR-5580-3p 0 1 0
chr4:87981593|87981736 hsa-miR-5580-3p 0 1 0
chr13:113810497|113810624 hsa-miR-5580-3p 0 1 0
chr4:87981555|87981736 hsa-miR-5580-3p 0 1 0
chr9:96320909|96321129 hsa-miR-5580-3p 0 1 0
chr4:87981616|87981736 hsa-miR-5580-3p 0 1 0
chr4:87981533|87981736 hsa-miR-5580-3p 0 1 0
chr10:79613864|79614038 hsa-miR-5580-3p -4 1 0
chr16:3301244|3301423 hsa-miR-5580-3p -9 1 0
chr14:67292576|67292719 hsa-miR-5580-3p -10 1 0
chr12:15596462|15596649 hsa-miR-5580-3p 1 0 0
chr20:21162314|21162450 hsa-miR-5580-3p 1 0 0
chr12:6731161|6731266 hsa-miR-5580-3p 1 0 0
chr12:15596507|15596669 hsa-miR-5580-3p 1 0 0
chr3:149375453|149375732 hsa-miR-5580-3p 1 0 0
chr4:99061191|99061395 hsa-miR-5580-3p 1 0 0
chr19:38291840|38292013 hsa-miR-5580-3p 0 1 0
chr3:37075024|37083655 hsa-miR-5580-3p 0 1 0
chrX:66172396|66172514 hsa-miR-5580-3p 0 1 0
chr20:37404551|37404792 hsa-miR-5580-3p 0 1 0
chr7:101043397|101043606 hsa-miR-5580-3p 0 1 0
chr5:151662217|151662446 hsa-miR-5580-3p 0 1 0
chr2:46360918|46361025 hsa-miR-5580-3p 0 1 0
chr3:149840788|149841042 hsa-miR-5580-3p 0 1 0
chr6:15615267|15615373 hsa-miR-5580-3p 0 1 0
chr1:153644463|153644590 hsa-miR-5580-3p 0 1 0
chr11:72001483|72001827 hsa-miR-5580-3p 0 1 0
chr15:65877497|65877868 hsa-miR-5580-3p 0 1 0
chr19:35945561|35945688 hsa-miR-5580-3p 0 1 0
chr7:100099683|100100058 hsa-miR-5580-3p 0 1 0
chr20:482636|482793 hsa-miR-5580-3p 0 1 0
chr11:67586410|67586533 hsa-miR-5580-3p 0 1 0
chr19:7117026|7117143 hsa-miR-5580-3p 0 1 0
chr1:40070195|40070500 hsa-miR-5580-3p 0 1 0
chr2:172504350|172504544 hsa-miR-5580-3p 0 1 0
chr2:127637270|127637413 hsa-miR-5580-3p 0 1 0
chr1:168696146|168696498 hsa-miR-5580-3p 0 1 0
chr4:38761188|38761346 hsa-miR-5580-3p 0 1 0
chr13:80336652|80336798 hsa-miR-5580-3p 0 1 0
chr15:89197546|89197712 hsa-miR-5580-3p 0 1 0
chr17:81704244|81704370 hsa-miR-5580-3p 0 1 0
chr21:44313642|44314012 hsa-miR-5580-3p 0 1 0
chr1:150111181|150111318 hsa-miR-5580-3p 0 1 0
chr5:43174511|43174818 hsa-miR-5580-3p 0 1 0
chr8:119789592|119789701 hsa-miR-5580-3p 0 1 0
chr11:131792587|131792911 hsa-miR-5580-3p 0 1 0
chr20:25297261|25297444 hsa-miR-5580-3p 0 1 0
chr9:132679531|132679689 hsa-miR-5580-3p 0 1 0
chr20:31547961|31548099 hsa-miR-5580-3p 0 1 0
chr2:170951345|170951458 hsa-miR-5580-3p 0 1 0
chr9:132679543|132679781 hsa-miR-5580-3p 1 0 0
chr17:19384241|19384361 hsa-miR-5580-3p 1 0 0
chr19:51331889|51332064 hsa-miR-5580-3p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-5580-3p UBR2 ubiquitin protein ligase E3 component n-recognin 2 HGNC:21289 details
hsa-miR-5580-3p TMEM215 transmembrane protein 215 HGNC:33816 details
hsa-miR-5580-3p IDS iduronate 2-sulfatase HGNC:5389 details
hsa-miR-5580-3p DDX4 DEAD-box helicase 4 HGNC:18700 details
hsa-miR-5580-3p RAB6C RAB6C, member RAS oncogene family HGNC:16525 details
hsa-miR-5580-3p DNAJC15 DnaJ heat shock protein family (Hsp40) member C15 HGNC:20325 details
hsa-miR-5580-3p MFF mitochondrial fission factor HGNC:24858 details
hsa-miR-5580-3p TRPV2 transient receptor potential cation channel subfamily V member 2 HGNC:18082 details
hsa-miR-5580-3p SRI sorcin HGNC:11292 details
hsa-miR-5580-3p ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 HGNC:697 details
hsa-miR-5580-3p MDM2 MDM2 proto-oncogene HGNC:6973 details
hsa-miR-5580-3p MSI2 musashi RNA binding protein 2 HGNC:18585 details
hsa-miR-5580-3p XRCC3 X-ray repair cross complementing 3 HGNC:12830 details
hsa-miR-5580-3p BTBD19 BTB domain containing 19 HGNC:27145 details
hsa-miR-5580-3p GPATCH11 G-patch domain containing 11 HGNC:26768 details
hsa-miR-5580-3p SENP1 SUMO specific peptidase 1 HGNC:17927 details
hsa-miR-5580-3p NRF1 nuclear respiratory factor 1 HGNC:7996 details
hsa-miR-5580-3p MON1B MON1 homolog B, secretory trafficking associated HGNC:25020 details
hsa-miR-5580-3p CALM2 calmodulin 2 HGNC:1445 details
hsa-miR-5580-3p SOX5 SRY-box transcription factor 5 HGNC:11201 details
hsa-miR-5580-3p PCNA proliferating cell nuclear antigen HGNC:8729 details
hsa-miR-5580-3p KCNK1 potassium two pore domain channel subfamily K member 1 HGNC:6272 details
hsa-miR-5580-3p SRP72 signal recognition particle 72 HGNC:11303 details
hsa-miR-5580-3p GNL3L G protein nucleolar 3 like HGNC:25553 details
hsa-miR-5580-3p BTLA B and T lymphocyte associated HGNC:21087 details
hsa-miR-5580-3p FOXL1 forkhead box L1 HGNC:3817 details
hsa-miR-5580-3p SERTM1 serine rich and transmembrane domain containing 1 HGNC:33792 details
hsa-miR-5580-3p GTPBP2 GTP binding protein 2 HGNC:4670 details
hsa-miR-5580-3p CASD1 CAS1 domain containing 1 HGNC:16014 details
hsa-miR-5580-3p HHIP hedgehog interacting protein HGNC:14866 details
hsa-miR-5580-3p GTF2H1 general transcription factor IIH subunit 1 HGNC:4655 details
hsa-miR-5580-3p AGPS alkylglycerone phosphate synthase HGNC:327 details
hsa-miR-5580-3p DDX55 DEAD-box helicase 55 HGNC:20085 details
hsa-miR-5580-3p SPPL2A signal peptide peptidase like 2A HGNC:30227 details
hsa-miR-5580-3p PURA purine rich element binding protein A HGNC:9701 details
hsa-miR-5580-3p PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 HGNC:9108 details
hsa-miR-5580-3p PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 HGNC:8979 details
hsa-miR-5580-3p PCBP2 poly(rC) binding protein 2 HGNC:8648 details
hsa-miR-5580-3p HMGB2 high mobility group box 2 HGNC:5000 details
hsa-miR-5580-3p CSRNP3 cysteine and serine rich nuclear protein 3 HGNC:30729 details
hsa-miR-5580-3p CFL2 cofilin 2 HGNC:1875 details
hsa-miR-5580-3p ZNF85 zinc finger protein 85 HGNC:13160 details
hsa-miR-5580-3p KCNJ6 potassium inwardly rectifying channel subfamily J member 6 HGNC:6267 details
hsa-miR-5580-3p EPOR erythropoietin receptor HGNC:3416 details
hsa-miR-5580-3p NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 HGNC:23987 details
hsa-miR-5580-3p PHEX phosphate regulating endopeptidase homolog X-linked HGNC:8918 details
hsa-miR-5580-3p TRMO tRNA methyltransferase O HGNC:30967 details
hsa-miR-5580-3p NLGN3 neuroligin 3 HGNC:14289 details
hsa-miR-5580-3p EFHC1 EF-hand domain containing 1 HGNC:16406 details
hsa-miR-5580-3p RAI1 retinoic acid induced 1 HGNC:9834 details
hsa-miR-5580-3p ANG angiogenin HGNC:483 details
hsa-miR-5580-3p KCNK12 potassium two pore domain channel subfamily K member 12 HGNC:6274 details
hsa-miR-5580-3p ABCF1 ATP binding cassette subfamily F member 1 HGNC:70 details
hsa-miR-5580-3p VENTX VENT homeobox HGNC:13639 details
hsa-miR-5580-3p EFCAB11 EF-hand calcium binding domain 11 HGNC:20357 details
hsa-miR-5580-3p SULT1B1 sulfotransferase family 1B member 1 HGNC:17845 details
hsa-miR-5580-3p ADH1B alcohol dehydrogenase 1B (class I), beta polypeptide HGNC:250 details
hsa-miR-5580-3p ZNF551 zinc finger protein 551 HGNC:25108 details
hsa-miR-5580-3p C2orf49 chromosome 2 open reading frame 49 HGNC:28772 details
hsa-miR-5580-3p CYP4F11 cytochrome P450 family 4 subfamily F member 11 HGNC:13265 details
hsa-miR-5580-3p ZBTB16 zinc finger and BTB domain containing 16 HGNC:12930 details
hsa-miR-5580-3p ZBED3 zinc finger BED-type containing 3 HGNC:20711 details
hsa-miR-5580-3p YAF2 YY1 associated factor 2 HGNC:17363 details
hsa-miR-5580-3p UCHL3 ubiquitin C-terminal hydrolase L3 HGNC:12515 details
hsa-miR-5580-3p SUCNR1 succinate receptor 1 HGNC:4542 details
hsa-miR-5580-3p SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 HGNC:19751 details
hsa-miR-5580-3p RC3H1 ring finger and CCCH-type domains 1 HGNC:29434 details
hsa-miR-5580-3p PHACTR2 phosphatase and actin regulator 2 HGNC:20956 details
hsa-miR-5580-3p PCGF2 polycomb group ring finger 2 HGNC:12929 details
hsa-miR-5580-3p NRIP1 nuclear receptor interacting protein 1 HGNC:8001 details
hsa-miR-5580-3p KLHL9 kelch like family member 9 HGNC:18732 details
hsa-miR-5580-3p KLHL23 kelch like family member 23 HGNC:27506 details
hsa-miR-5580-3p NEXMIF neurite extension and migration factor HGNC:29433 details
hsa-miR-5580-3p ITPRIPL2 ITPRIP like 2 HGNC:27257 details
hsa-miR-5580-3p INTU inturned planar cell polarity protein HGNC:29239 details
hsa-miR-5580-3p GPBP1L1 GC-rich promoter binding protein 1 like 1 HGNC:28843 details
hsa-miR-5580-3p details
hsa-miR-5580-3p EVI5 ecotropic viral integration site 5 HGNC:3501 details
hsa-miR-5580-3p DCUN1D3 defective in cullin neddylation 1 domain containing 3 HGNC:28734 details
hsa-miR-5580-3p BRI3BP BRI3 binding protein HGNC:14251 details
hsa-miR-5580-3p AKAP10 A-kinase anchoring protein 10 HGNC:368 details
hsa-miR-5580-3p CERCAM cerebral endothelial cell adhesion molecule HGNC:23723 details
hsa-miR-5580-3p HTR7 5-hydroxytryptamine receptor 7 HGNC:5302 details
hsa-miR-5580-3p ZNF532 zinc finger protein 532 HGNC:30940 details
hsa-miR-5580-3p SFT2D2 SFT2 domain containing 2 HGNC:25140 details
hsa-miR-5580-3p SETD7 SET domain containing 7, histone lysine methyltransferase HGNC:30412 details
hsa-miR-5580-3p RORA RAR related orphan receptor A HGNC:10258 details
hsa-miR-5580-3p HMBOX1 homeobox containing 1 HGNC:26137 details
hsa-miR-5580-3p details
hsa-miR-5580-3p BTG1 BTG anti-proliferation factor 1 HGNC:1130 details
hsa-miR-5580-3p ABHD18 abhydrolase domain containing 18 HGNC:26111 details
hsa-miR-5580-3p ZC3H6 zinc finger CCCH-type containing 6 HGNC:24762 details
hsa-miR-5580-3p TBRG4 transforming growth factor beta regulator 4 HGNC:17443 details
hsa-miR-5580-3p PELP1 proline, glutamate and leucine rich protein 1 HGNC:30134 details
hsa-miR-5580-3p ZMYM2 zinc finger MYM-type containing 2 HGNC:12989 details
hsa-miR-5580-3p SEC23IP SEC23 interacting protein HGNC:17018 details
hsa-miR-5580-3p PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma HGNC:8978 details
hsa-miR-5580-3p IRS1 insulin receptor substrate 1 HGNC:6125 details
hsa-miR-5580-3p CYLD CYLD lysine 63 deubiquitinase HGNC:2584 details
hsa-miR-5580-3p COCH cochlin HGNC:2180 details
hsa-miR-5580-3p PRR23A proline rich 23A HGNC:37172 details
hsa-miR-5580-3p TAGLN2 transgelin 2 HGNC:11554 details
hsa-miR-5580-3p TSEN34 tRNA splicing endonuclease subunit 34 HGNC:15506 details
hsa-miR-5580-3p GABRG1 gamma-aminobutyric acid type A receptor subunit gamma1 HGNC:4086 details
hsa-miR-5580-3p SLC12A2 solute carrier family 12 member 2 HGNC:10911 details
hsa-miR-5580-3p TSPAN13 tetraspanin 13 HGNC:21643 details
hsa-miR-5580-3p NDUFS1 NADH:ubiquinone oxidoreductase core subunit S1 HGNC:7707 details
hsa-miR-5580-3p NDFIP2 Nedd4 family interacting protein 2 HGNC:18537 details
hsa-miR-5580-3p TRPM7 transient receptor potential cation channel subfamily M member 7 HGNC:17994 details
hsa-miR-5580-3p PIAS1 protein inhibitor of activated STAT 1 HGNC:2752 details
hsa-miR-5580-3p LHFPL2 LHFPL tetraspan subfamily member 2 HGNC:6588 details
hsa-miR-5580-3p DAPK1 death associated protein kinase 1 HGNC:2674 details
hsa-miR-5580-3p ATXN3 ataxin 3 HGNC:7106 details
hsa-miR-5580-3p ARL8A ADP ribosylation factor like GTPase 8A HGNC:25192 details
hsa-miR-5580-3p ABI2 abl interactor 2 HGNC:24011 details
hsa-miR-5580-3p ZNF273 zinc finger protein 273 HGNC:13067 details
hsa-miR-5580-3p EIF2B1 eukaryotic translation initiation factor 2B subunit alpha HGNC:3257 details
hsa-miR-5580-3p GNL3 G protein nucleolar 3 HGNC:29931 details
hsa-miR-5580-3p MYLK3 myosin light chain kinase 3 HGNC:29826 details
hsa-miR-5580-3p ATP7A ATPase copper transporting alpha HGNC:869 details
hsa-miR-5580-3p RASSF6 Ras association domain family member 6 HGNC:20796 details
hsa-miR-5580-3p TRIM42 tripartite motif containing 42 HGNC:19014 details
hsa-miR-5580-3p RAB11FIP3 RAB11 family interacting protein 3 HGNC:17224 details
hsa-miR-5580-3p ZNF562 zinc finger protein 562 HGNC:25950 details
hsa-miR-5580-3p ZFP30 ZFP30 zinc finger protein HGNC:29555 details
hsa-miR-5580-3p ZBTB20 zinc finger and BTB domain containing 20 HGNC:13503 details
hsa-miR-5580-3p VGLL2 vestigial like family member 2 HGNC:20232 details
hsa-miR-5580-3p RCAN2 regulator of calcineurin 2 HGNC:3041 details
hsa-miR-5580-3p IREB2 iron responsive element binding protein 2 HGNC:6115 details
hsa-miR-5580-3p HMGN3 high mobility group nucleosomal binding domain 3 HGNC:12312 details
hsa-miR-5580-3p FREM2 FRAS1 related extracellular matrix 2 HGNC:25396 details
hsa-miR-5580-3p CHORDC1 cysteine and histidine rich domain containing 1 HGNC:14525 details
hsa-miR-5580-3p MIDN midnolin HGNC:16298 details
hsa-miR-5580-3p KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-5580-3p AOC3 amine oxidase copper containing 3 HGNC:550 details
hsa-miR-5580-3p RPS14 ribosomal protein S14 HGNC:10387 details
hsa-miR-5580-3p APOOL apolipoprotein O like HGNC:24009 details
hsa-miR-5580-3p FAM229B family with sequence similarity 229 member B HGNC:33858 details
hsa-miR-5580-3p SEPHS1 selenophosphate synthetase 1 HGNC:19685 details
hsa-miR-5580-3p RNF44 ring finger protein 44 HGNC:19180 details
hsa-miR-5580-3p PTPN14 protein tyrosine phosphatase non-receptor type 14 HGNC:9647 details
hsa-miR-5580-3p PANK3 pantothenate kinase 3 HGNC:19365 details
hsa-miR-5580-3p MRPL35 mitochondrial ribosomal protein L35 HGNC:14489 details
hsa-miR-5580-3p MRPL19 mitochondrial ribosomal protein L19 HGNC:14052 details
hsa-miR-5580-3p RIF1 replication timing regulatory factor 1 HGNC:23207 details
hsa-miR-5580-3p PNRC2 proline rich nuclear receptor coactivator 2 HGNC:23158 details
hsa-miR-5580-3p KLHL28 kelch like family member 28 HGNC:19741 details
hsa-miR-5580-3p ZNF350 zinc finger protein 350 HGNC:16656 details
hsa-miR-5580-3p details
hsa-miR-5580-3p TNIP3 TNFAIP3 interacting protein 3 HGNC:19315 details
hsa-miR-5580-3p ZNF878 zinc finger protein 878 HGNC:37246 details
hsa-miR-5580-3p PLRG1 pleiotropic regulator 1 HGNC:9089 details
hsa-miR-5580-3p DHX36 DEAH-box helicase 36 HGNC:14410 details
hsa-miR-5580-3p MED13 mediator complex subunit 13 HGNC:22474 details
hsa-miR-5580-3p CD180 CD180 molecule HGNC:6726 details
hsa-miR-5580-3p GLCCI1 glucocorticoid induced 1 HGNC:18713 details
hsa-miR-5580-3p GTDC1 glycosyltransferase like domain containing 1 HGNC:20887 details
hsa-miR-5580-3p IKBKG inhibitor of nuclear factor kappa B kinase regulatory subunit gamma HGNC:5961 details
hsa-miR-5580-3p PPP4R2 protein phosphatase 4 regulatory subunit 2 HGNC:18296 details
hsa-miR-5580-3p C1orf216 chromosome 1 open reading frame 216 HGNC:26800 details
hsa-miR-5580-3p HID1 HID1 domain containing HGNC:15736 details
hsa-miR-5580-3p AP1S2 adaptor related protein complex 1 subunit sigma 2 HGNC:560 details
hsa-miR-5580-3p ABHD13 abhydrolase domain containing 13 HGNC:20293 details
hsa-miR-5580-3p BLOC1S4 biogenesis of lysosomal organelles complex 1 subunit 4 HGNC:24206 details
hsa-miR-5580-3p ZNF652 zinc finger protein 652 HGNC:29147 details
hsa-miR-5580-3p SH3TC2 SH3 domain and tetratricopeptide repeats 2 HGNC:29427 details
hsa-miR-5580-3p IL21R interleukin 21 receptor HGNC:6006 details
hsa-miR-5580-3p BEX4 brain expressed X-linked 4 HGNC:25475 details
hsa-miR-5580-3p details
hsa-miR-5580-3p PER2 period circadian regulator 2 HGNC:8846 details
hsa-miR-5580-3p OIP5 Opa interacting protein 5 HGNC:20300 details
hsa-miR-5580-3p AEBP2 AE binding protein 2 HGNC:24051 details
hsa-miR-5580-3p GCK glucokinase HGNC:4195 details
hsa-miR-5580-3p PTPDC1 protein tyrosine phosphatase domain containing 1 HGNC:30184 details
hsa-miR-5580-3p NR3C1 nuclear receptor subfamily 3 group C member 1 HGNC:7978 details
hsa-miR-5580-3p FYN FYN proto-oncogene, Src family tyrosine kinase HGNC:4037 details
hsa-miR-5580-3p SLC16A6 solute carrier family 16 member 6 HGNC:10927 details
hsa-miR-5580-3p NHLRC2 NHL repeat containing 2 HGNC:24731 details
hsa-miR-5580-3p L1CAM L1 cell adhesion molecule HGNC:6470 details
hsa-miR-5580-3p IGFBP3 insulin like growth factor binding protein 3 HGNC:5472 details
hsa-miR-5580-3p FAM20B FAM20B glycosaminoglycan xylosylkinase HGNC:23017 details
hsa-miR-5580-3p CNTNAP5 contactin associated protein family member 5 HGNC:18748 details
hsa-miR-5580-3p WDR17 WD repeat domain 17 HGNC:16661 details
hsa-miR-5580-3p SLITRK4 SLIT and NTRK like family member 4 HGNC:23502 details
hsa-miR-5580-3p TRIM13 tripartite motif containing 13 HGNC:9976 details
hsa-miR-5580-3p KCNB1 potassium voltage-gated channel subfamily B member 1 HGNC:6231 details
hsa-miR-5580-3p DCAF4L1 DDB1 and CUL4 associated factor 4 like 1 HGNC:27723 details
hsa-miR-5580-3p WNT11 Wnt family member 11 HGNC:12776 details
hsa-miR-5580-3p LRRC31 leucine rich repeat containing 31 HGNC:26261 details
hsa-miR-5580-3p MMADHC metabolism of cobalamin associated D HGNC:25221 details
hsa-miR-5580-3p IGFBP1 insulin like growth factor binding protein 1 HGNC:5469 details
hsa-miR-5580-3p details
hsa-miR-5580-3p TIGD5 tigger transposable element derived 5 HGNC:18336 details
hsa-miR-5580-3p SLC25A12 solute carrier family 25 member 12 HGNC:10982 details
hsa-miR-5580-3p RSBN1L round spermatid basic protein 1 like HGNC:24765 details
hsa-miR-5580-3p MCAM melanoma cell adhesion molecule HGNC:6934 details
hsa-miR-5580-3p details
hsa-miR-5580-3p CREBRF CREB3 regulatory factor HGNC:24050 details
hsa-miR-5580-3p PACRGL parkin coregulated like HGNC:28442 details
hsa-miR-5580-3p DCAF17 DDB1 and CUL4 associated factor 17 HGNC:25784 details
hsa-miR-5580-3p RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 HGNC:14436 details
hsa-miR-5580-3p FMNL2 formin like 2 HGNC:18267 details
hsa-miR-5580-3p DMRTB1 DMRT like family B with proline rich C-terminal 1 HGNC:13913 details
hsa-miR-5580-3p PTPRB protein tyrosine phosphatase receptor type B HGNC:9665 details
hsa-miR-5580-3p RGP1 RGP1 homolog, RAB6A GEF complex partner 1 HGNC:21965 details
hsa-miR-5580-3p SIAH2 siah E3 ubiquitin protein ligase 2 HGNC:10858 details
hsa-miR-5580-3p HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 HGNC:17011 details
hsa-miR-5580-3p ZNF669 zinc finger protein 669 HGNC:25736 details
hsa-miR-5580-3p CBX3 chromobox 3 HGNC:1553 details
hsa-miR-5580-3p CNKSR2 connector enhancer of kinase suppressor of Ras 2 HGNC:19701 details
hsa-miR-5580-3p FAM126B family with sequence similarity 126 member B HGNC:28593 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab