miRNA Card

miRNA General Information
miRNA ID hsa-miR-5582-3p
Description Homo sapiens miR-5582 stem-loop
Comment None
Experiment
Sequence UAAAACUUUAAGUGUGCCUAGG
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr5:80146090|80175047 hsa-miR-5582-3p 1 1 1
chr17:50974771|50993935 hsa-miR-5582-3p 1 1 1

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr3:122540594|122540754 hsa-miR-5582-3p 1 1 0
chr3:122540594|122540670 hsa-miR-5582-3p 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr6:163455279|163455421 hsa-miR-5582-3p 0 1 0
chr7:12644237|12644315 hsa-miR-5582-3p 0 1 0
chr1:13782560|13782702 hsa-miR-5582-3p 0 1 0
chr7:95414292|95414517 hsa-miR-5582-3p 0 1 0
chr14:100291590|100291809 hsa-miR-5582-3p 0 1 0
chr6:169964735|169964839 hsa-miR-5582-3p 0 1 0
chr11:9203815|9203974 hsa-miR-5582-3p 0 1 0
chr15:24963057|24963202 hsa-miR-5582-3p 0 1 0
chr5:111127543|111127688 hsa-miR-5582-3p 1 0 0
chr8:53771989|53772104 hsa-miR-5582-3p 0 1 0
chr11:34995048|34995145 hsa-miR-5582-3p 0 1 0
chr11:9203815|9203976 hsa-miR-5582-3p 0 1 0
chr11:82859977|82860117 hsa-miR-5582-3p 0 1 0
chr1:153607241|153607356 hsa-miR-5582-3p 0 1 0
chr17:78992856|78992942 hsa-miR-5582-3p 0 1 0
chr16:15838142|15838269 hsa-miR-5582-3p 0 1 0
chr1:153607241|153607414 hsa-miR-5582-3p 0 1 0
chr7:40132944|40133071 hsa-miR-5582-3p 0 1 0
chr7:40132916|40133022 hsa-miR-5582-3p 0 1 0
chr10:116058114|116058301 hsa-miR-5582-3p 0 1 0
chr1:182879273|182879410 hsa-miR-5582-3p 0 1 0
chr1:20807171|20807327 hsa-miR-5582-3p 0 1 0
chr12:26337462~26337633 hsa-miR-5582-3p 0 1 0
chr10:92353278~92353331 hsa-miR-5582-3p 0 1 0
chr1:153607265|153607356 hsa-miR-5582-3p 0 1 0
chr1:153607241~153607356 hsa-miR-5582-3p 0 1 0
chr7:12644237~12644315 hsa-miR-5582-3p 0 1 0
chr1:44640068~44640140 hsa-miR-5582-3p 0 1 0
chr1:170726665~170726952 hsa-miR-5582-3p 0 1 0
chr5:111127543~111127688 hsa-miR-5582-3p 0 1 0
chr3:186788027~186788225 hsa-miR-5582-3p 0 1 0
chr10:669165~669283 hsa-miR-5582-3p 0 1 0
chr5:127548349|127548446 hsa-miR-5582-3p 0 1 0
chr15:42216845|42216924 hsa-miR-5582-3p 0 1 0
chr3:63833986|63834114 hsa-miR-5582-3p 0 1 0
chr15:93025697|93025861 hsa-miR-5582-3p 0 1 0
chr7:129948315|129948553 hsa-miR-5582-3p 0 1 0
chr17:8578468|8578685 hsa-miR-5582-3p 0 1 0
chr20:58389332|58389424 hsa-miR-5582-3p 0 1 0
chr1:153607091|153607356 hsa-miR-5582-3p 0 1 0
chrX:101883322|101883436 hsa-miR-5582-3p 0 1 0
chr10:116058114|116058298 hsa-miR-5582-3p 0 1 0
chr6:154832238|154832347 hsa-miR-5582-3p 0 1 0
chr4:15832849|15833027 hsa-miR-5582-3p 0 1 0
chr10:121790169|121790278 hsa-miR-5582-3p 0 1 0
chr12:107659060|107659167 hsa-miR-5582-3p 0 1 0
chrX:150990163|150990542 hsa-miR-5582-3p 0 1 0
chr15:93025697|93025888 hsa-miR-5582-3p 0 1 0
chr14:80895718|80906081 hsa-miR-5582-3p 0 1 0
chr1:147648713|147648874 hsa-miR-5582-3p 0 1 0
chr10:121790169|121790253 hsa-miR-5582-3p 0 1 0
chr3:53886510|53886620 hsa-miR-5582-3p 0 1 0
chr16:87694919|87695053 hsa-miR-5582-3p 0 1 0
chr3:12835185|12835319 hsa-miR-5582-3p 0 1 0
chr22:32767158|32767255 hsa-miR-5582-3p 0 1 0
chr14:100291590|100291803 hsa-miR-5582-3p -10 1 0
chr9:92252088|92252281 hsa-miR-5582-3p 0 1 0
chr2:189666965|189667143 hsa-miR-5582-3p 0 1 0
chr16:15838082|15838219 hsa-miR-5582-3p 0 1 0
chr10:71288642|71288990 hsa-miR-5582-3p 0 1 0
chr12:6935821|6936036 hsa-miR-5582-3p 0 1 0
chr11:77616325|77616499 hsa-miR-5582-3p 0 1 0
chr9:101561910|101562290 hsa-miR-5582-3p 0 1 0
chr12:29333651|29333836 hsa-miR-5582-3p 0 1 0
chr12:29333662|29333810 hsa-miR-5582-3p 0 1 0
chr18:63364729|63364936 hsa-miR-5582-3p 0 1 0
chr15:41280800|41281017 hsa-miR-5582-3p 0 1 0
chr10:3777413|3777632 hsa-miR-5582-3p 0 1 0
chr1:121184780|121184900 hsa-miR-5582-3p 0 1 0
chr5:168553658|168553797 hsa-miR-5582-3p 0 1 0
chr17:40400917|40401055 hsa-miR-5582-3p 0 1 0
chr7:118188276|118188373 hsa-miR-5582-3p 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-5582-3p HAUS6 HAUS augmin like complex subunit 6 HGNC:25948 details
hsa-miR-5582-3p KCNH5 potassium voltage-gated channel subfamily H member 5 HGNC:6254 details
hsa-miR-5582-3p TLX3 T cell leukemia homeobox 3 HGNC:13532 details
hsa-miR-5582-3p GJD3 gap junction protein delta 3 HGNC:19147 details
hsa-miR-5582-3p details
hsa-miR-5582-3p CHMP1B charged multivesicular body protein 1B HGNC:24287 details
hsa-miR-5582-3p INTS8 integrator complex subunit 8 HGNC:26048 details
hsa-miR-5582-3p CLCN3 chloride voltage-gated channel 3 HGNC:2021 details
hsa-miR-5582-3p FRMD5 FERM domain containing 5 HGNC:28214 details
hsa-miR-5582-3p PTPRG protein tyrosine phosphatase receptor type G HGNC:9671 details
hsa-miR-5582-3p HSBP1 heat shock factor binding protein 1 HGNC:5203 details
hsa-miR-5582-3p details
hsa-miR-5582-3p TMEM106B transmembrane protein 106B HGNC:22407 details
hsa-miR-5582-3p ZNF207 zinc finger protein 207 HGNC:12998 details
hsa-miR-5582-3p CMTM4 CKLF like MARVEL transmembrane domain containing 4 HGNC:19175 details
hsa-miR-5582-3p SMOC1 SPARC related modular calcium binding 1 HGNC:20318 details
hsa-miR-5582-3p PTCHD1 patched domain containing 1 HGNC:26392 details
hsa-miR-5582-3p HSPA14 heat shock protein family A (Hsp70) member 14 HGNC:29526 details
hsa-miR-5582-3p HMGN4 high mobility group nucleosomal binding domain 4 HGNC:4989 details
hsa-miR-5582-3p CRNKL1 crooked neck pre-mRNA splicing factor 1 HGNC:15762 details
hsa-miR-5582-3p RCC2 regulator of chromosome condensation 2 HGNC:30297 details
hsa-miR-5582-3p TNFSF15 TNF superfamily member 15 HGNC:11931 details
hsa-miR-5582-3p details
hsa-miR-5582-3p PGK1 phosphoglycerate kinase 1 HGNC:8896 details
hsa-miR-5582-3p DNAAF3 dynein axonemal assembly factor 3 HGNC:30492 details
hsa-miR-5582-3p SCML4 Scm polycomb group protein like 4 HGNC:21397 details
hsa-miR-5582-3p CD1D CD1d molecule HGNC:1637 details
hsa-miR-5582-3p GRAMD1C GRAM domain containing 1C HGNC:25252 details
hsa-miR-5582-3p ACSL3 acyl-CoA synthetase long chain family member 3 HGNC:3570 details
hsa-miR-5582-3p EML6 EMAP like 6 HGNC:35412 details
hsa-miR-5582-3p HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 HGNC:5033 details
hsa-miR-5582-3p SNX1 sorting nexin 1 HGNC:11172 details
hsa-miR-5582-3p STK17A serine/threonine kinase 17a HGNC:11395 details
hsa-miR-5582-3p ABI2 abl interactor 2 HGNC:24011 details
hsa-miR-5582-3p details
hsa-miR-5582-3p QTRT2 queuine tRNA-ribosyltransferase accessory subunit 2 HGNC:25771 details
hsa-miR-5582-3p LLPH LLP homolog, long-term synaptic facilitation factor HGNC:28229 details
hsa-miR-5582-3p MTPAP mitochondrial poly(A) polymerase HGNC:25532 details
hsa-miR-5582-3p ERP44 endoplasmic reticulum protein 44 HGNC:18311 details
hsa-miR-5582-3p TMCC3 transmembrane and coiled-coil domain family 3 HGNC:29199 details
hsa-miR-5582-3p LMAN1 lectin, mannose binding 1 HGNC:6631 details
hsa-miR-5582-3p GSR glutathione-disulfide reductase HGNC:4623 details
hsa-miR-5582-3p P2RY10 P2Y receptor family member 10 HGNC:19906 details
hsa-miR-5582-3p SNAI2 snail family transcriptional repressor 2 HGNC:11094 details
hsa-miR-5582-3p ZNF774 zinc finger protein 774 HGNC:33108 details
hsa-miR-5582-3p TNFAIP3 TNF alpha induced protein 3 HGNC:11896 details
hsa-miR-5582-3p GABRB1 gamma-aminobutyric acid type A receptor subunit beta1 HGNC:4081 details
hsa-miR-5582-3p FOXN2 forkhead box N2 HGNC:5281 details
hsa-miR-5582-3p FKBP1A FKBP prolyl isomerase 1A HGNC:3711 details
hsa-miR-5582-3p DENND4C DENN domain containing 4C HGNC:26079 details
hsa-miR-5582-3p ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 HGNC:221 details
hsa-miR-5582-3p ZNF558 zinc finger protein 558 HGNC:26422 details
hsa-miR-5582-3p details
hsa-miR-5582-3p PALM2 paralemmin 2 HGNC:15845 details
hsa-miR-5582-3p GPC5 glypican 5 HGNC:4453 details
hsa-miR-5582-3p ZNF451 zinc finger protein 451 HGNC:21091 details
hsa-miR-5582-3p ZNF555 zinc finger protein 555 HGNC:28382 details
hsa-miR-5582-3p IMP3 IMP U3 small nucleolar ribonucleoprotein 3 HGNC:14497 details
hsa-miR-5582-3p GABRB3 gamma-aminobutyric acid type A receptor subunit beta3 HGNC:4083 details
hsa-miR-5582-3p PAIP1 poly(A) binding protein interacting protein 1 HGNC:16945 details
hsa-miR-5582-3p TMEM47 transmembrane protein 47 HGNC:18515 details
hsa-miR-5582-3p CPOX coproporphyrinogen oxidase HGNC:2321 details
hsa-miR-5582-3p TRMT5 tRNA methyltransferase 5 HGNC:23141 details
hsa-miR-5582-3p ACTR2 actin related protein 2 HGNC:169 details
hsa-miR-5582-3p EXOC2 exocyst complex component 2 HGNC:24968 details
hsa-miR-5582-3p PDE3A phosphodiesterase 3A HGNC:8778 details
hsa-miR-5582-3p OTUD7A OTU deubiquitinase 7A HGNC:20718 details
hsa-miR-5582-3p HMGN2 high mobility group nucleosomal binding domain 2 HGNC:4986 details
hsa-miR-5582-3p YOD1 YOD1 deubiquitinase HGNC:25035 details
hsa-miR-5582-3p POFUT1 protein O-fucosyltransferase 1 HGNC:14988 details
hsa-miR-5582-3p MLLT10 MLLT10 histone lysine methyltransferase DOT1L cofactor HGNC:16063 details
hsa-miR-5582-3p IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 HGNC:28868 details
hsa-miR-5582-3p MFSD14B major facilitator superfamily domain containing 14B HGNC:23376 details
hsa-miR-5582-3p FZD6 frizzled class receptor 6 HGNC:4044 details
hsa-miR-5582-3p IER2 immediate early response 2 HGNC:28871 details
hsa-miR-5582-3p YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta HGNC:12855 details
hsa-miR-5582-3p MKNK2 MAPK interacting serine/threonine kinase 2 HGNC:7111 details
hsa-miR-5582-3p HSPA5 heat shock protein family A (Hsp70) member 5 HGNC:5238 details
hsa-miR-5582-3p details
hsa-miR-5582-3p DIRAS2 DIRAS family GTPase 2 HGNC:19323 details
hsa-miR-5582-3p TMEM245 transmembrane protein 245 HGNC:1363 details
hsa-miR-5582-3p PRLR prolactin receptor HGNC:9446 details
hsa-miR-5582-3p ABCB7 ATP binding cassette subfamily B member 7 HGNC:48 details
hsa-miR-5582-3p ZBTB20 zinc finger and BTB domain containing 20 HGNC:13503 details
hsa-miR-5582-3p ACVR2B activin A receptor type 2B HGNC:174 details
hsa-miR-5582-3p KRAS KRAS proto-oncogene, GTPase HGNC:6407 details
hsa-miR-5582-3p DDX3X DEAD-box helicase 3 X-linked HGNC:2745 details
hsa-miR-5582-3p SLC16A1 solute carrier family 16 member 1 HGNC:10922 details
hsa-miR-5582-3p PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 HGNC:8574 details
hsa-miR-5582-3p MOB1B MOB kinase activator 1B HGNC:29801 details
hsa-miR-5582-3p LMLN leishmanolysin like peptidase HGNC:15991 details
hsa-miR-5582-3p SCIN scinderin HGNC:21695 details
hsa-miR-5582-3p TRIM13 tripartite motif containing 13 HGNC:9976 details
hsa-miR-5582-3p LARP1 La ribonucleoprotein 1, translational regulator HGNC:29531 details
hsa-miR-5582-3p KLHL42 kelch like family member 42 HGNC:29252 details
hsa-miR-5582-3p ABHD13 abhydrolase domain containing 13 HGNC:20293 details
hsa-miR-5582-3p CD226 CD226 molecule HGNC:16961 details
hsa-miR-5582-3p ZNF585B zinc finger protein 585B HGNC:30948 details
hsa-miR-5582-3p CCNL2 cyclin L2 HGNC:20570 details
hsa-miR-5582-3p TMLHE trimethyllysine hydroxylase, epsilon HGNC:18308 details
hsa-miR-5582-3p TNFRSF10D TNF receptor superfamily member 10d HGNC:11907 details
hsa-miR-5582-3p TRUB1 TruB pseudouridine synthase family member 1 HGNC:16060 details
hsa-miR-5582-3p WNK1 WNK lysine deficient protein kinase 1 HGNC:14540 details
hsa-miR-5582-3p TBL1XR1 TBL1X receptor 1 HGNC:29529 details
hsa-miR-5582-3p RASGEF1A RasGEF domain family member 1A HGNC:24246 details
hsa-miR-5582-3p NLN neurolysin HGNC:16058 details
hsa-miR-5582-3p HAS3 hyaluronan synthase 3 HGNC:4820 details
hsa-miR-5582-3p BMP2K BMP2 inducible kinase HGNC:18041 details
hsa-miR-5582-3p ARNTL aryl hydrocarbon receptor nuclear translocator like HGNC:701 details
hsa-miR-5582-3p DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 HGNC:24013 details
hsa-miR-5582-3p HES7 hes family bHLH transcription factor 7 HGNC:15977 details
hsa-miR-5582-3p ZFP36L1 ZFP36 ring finger protein like 1 HGNC:1107 details
hsa-miR-5582-3p CYB5B cytochrome b5 type B HGNC:24374 details
hsa-miR-5582-3p PARP15 poly(ADP-ribose) polymerase family member 15 HGNC:26876 details
hsa-miR-5582-3p KLRC3 killer cell lectin like receptor C3 HGNC:6376 details
hsa-miR-5582-3p TTLL11 tubulin tyrosine ligase like 11 HGNC:18113 details
hsa-miR-5582-3p ZSCAN12 zinc finger and SCAN domain containing 12 HGNC:13172 details
hsa-miR-5582-3p SPC25 SPC25 component of NDC80 kinetochore complex HGNC:24031 details
hsa-miR-5582-3p LIN7C lin-7 homolog C, crumbs cell polarity complex component HGNC:17789 details
hsa-miR-5582-3p HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 HGNC:5194 details
hsa-miR-5582-3p ZNF772 zinc finger protein 772 HGNC:33106 details
hsa-miR-5582-3p XKR4 XK related 4 HGNC:29394 details
hsa-miR-5582-3p RNPS1 RNA binding protein with serine rich domain 1 HGNC:10080 details
hsa-miR-5582-3p PURB purine rich element binding protein B HGNC:9702 details
hsa-miR-5582-3p FJX1 four-jointed box kinase 1 HGNC:17166 details
hsa-miR-5582-3p LLGL2 LLGL scribble cell polarity complex component 2 HGNC:6629 details
hsa-miR-5582-3p MED10 mediator complex subunit 10 HGNC:28760 details
hsa-miR-5582-3p YTHDF1 YTH N6-methyladenosine RNA binding protein 1 HGNC:15867 details
hsa-miR-5582-3p TVP23C trans-golgi network vesicle protein 23 homolog C HGNC:30453 details
hsa-miR-5582-3p TVP23B trans-golgi network vesicle protein 23 homolog B HGNC:20399 details
hsa-miR-5582-3p SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein HGNC:16918 details
hsa-miR-5582-3p STARD3NL STARD3 N-terminal like HGNC:19169 details
hsa-miR-5582-3p SLX4 SLX4 structure-specific endonuclease subunit HGNC:23845 details
hsa-miR-5582-3p RAB33B RAB33B, member RAS oncogene family HGNC:16075 details
hsa-miR-5582-3p PNRC2 proline rich nuclear receptor coactivator 2 HGNC:23158 details
hsa-miR-5582-3p PHF12 PHD finger protein 12 HGNC:20816 details
hsa-miR-5582-3p PDZD8 PDZ domain containing 8 HGNC:26974 details
hsa-miR-5582-3p JMY junction mediating and regulatory protein, p53 cofactor HGNC:28916 details
hsa-miR-5582-3p ISOC1 isochorismatase domain containing 1 HGNC:24254 details
hsa-miR-5582-3p GNPTAB N-acetylglucosamine-1-phosphate transferase subunits alpha and beta HGNC:29670 details
hsa-miR-5582-3p ELK4 ETS transcription factor ELK4 HGNC:3326 details
hsa-miR-5582-3p CDCA4 cell division cycle associated 4 HGNC:14625 details
hsa-miR-5582-3p CBFB core-binding factor subunit beta HGNC:1539 details
hsa-miR-5582-3p CALM1 calmodulin 1 HGNC:1442 details
hsa-miR-5582-3p details
hsa-miR-5582-3p RPLP0 ribosomal protein lateral stalk subunit P0 HGNC:10371 details
hsa-miR-5582-3p RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 HGNC:14436 details
hsa-miR-5582-3p SOX4 SRY-box transcription factor 4 HGNC:11200 details
hsa-miR-5582-3p OTUD4 OTU deubiquitinase 4 HGNC:24949 details
hsa-miR-5582-3p IGFBP5 insulin like growth factor binding protein 5 HGNC:5474 details
hsa-miR-5582-3p ARPP19 cAMP regulated phosphoprotein 19 HGNC:16967 details
hsa-miR-5582-3p NUP37 nucleoporin 37 HGNC:29929 details
hsa-miR-5582-3p ABT1 activator of basal transcription 1 HGNC:17369 details
hsa-miR-5582-3p ZBTB46 zinc finger and BTB domain containing 46 HGNC:16094 details
hsa-miR-5582-3p details
hsa-miR-5582-3p ZNF581 zinc finger protein 581 HGNC:25017 details
hsa-miR-5582-3p NUDCD3 NudC domain containing 3 HGNC:22208 details
hsa-miR-5582-3p ZYG11B zyg-11 family member B, cell cycle regulator HGNC:25820 details
hsa-miR-5582-3p PDCD4 programmed cell death 4 HGNC:8763 details
hsa-miR-5582-3p ZNF106 zinc finger protein 106 HGNC:12886 details
hsa-miR-5582-3p PDGFRA platelet derived growth factor receptor alpha HGNC:8803 details
hsa-miR-5582-3p SLC25A11 solute carrier family 25 member 11 HGNC:10981 details
hsa-miR-5582-3p RSF1 remodeling and spacing factor 1 HGNC:18118 details
hsa-miR-5582-3p PSPC1 paraspeckle component 1 HGNC:20320 details
hsa-miR-5582-3p GGCX gamma-glutamyl carboxylase HGNC:4247 details
hsa-miR-5582-3p ESR1 estrogen receptor 1 HGNC:3467 details
hsa-miR-5582-3p CLOCK clock circadian regulator HGNC:2082 details
hsa-miR-5582-3p XRCC2 X-ray repair cross complementing 2 HGNC:12829 details
hsa-miR-5582-3p SUB1 SUB1 regulator of transcription HGNC:19985 details
hsa-miR-5582-3p ZNF608 zinc finger protein 608 HGNC:29238 details
hsa-miR-5582-3p ZBTB10 zinc finger and BTB domain containing 10 HGNC:30953 details
hsa-miR-5582-3p CCDC158 coiled-coil domain containing 158 HGNC:26374 details
hsa-miR-5582-3p GRK4 G protein-coupled receptor kinase 4 HGNC:4543 details
hsa-miR-5582-3p details
hsa-miR-5582-3p ZIC2 Zic family member 2 HGNC:12873 details
hsa-miR-5582-3p FUNDC2 FUN14 domain containing 2 HGNC:24925 details
hsa-miR-5582-3p PCK1 phosphoenolpyruvate carboxykinase 1 HGNC:8724 details
hsa-miR-5582-3p SLCO3A1 solute carrier organic anion transporter family member 3A1 HGNC:10952 details
hsa-miR-5582-3p XKR6 XK related 6 HGNC:27806 details
hsa-miR-5582-3p ANKIB1 ankyrin repeat and IBR domain containing 1 HGNC:22215 details
hsa-miR-5582-3p TNPO2 transportin 2 HGNC:19998 details
hsa-miR-5582-3p SORCS1 sortilin related VPS10 domain containing receptor 1 HGNC:16697 details
hsa-miR-5582-3p GRIK4 glutamate ionotropic receptor kainate type subunit 4 HGNC:4582 details
hsa-miR-5582-3p DFFA DNA fragmentation factor subunit alpha HGNC:2772 details
hsa-miR-5582-3p CLN8 CLN8 transmembrane ER and ERGIC protein HGNC:2079 details
hsa-miR-5582-3p LIMD1 LIM domain containing 1 HGNC:6612 details
hsa-miR-5582-3p CCDC117 coiled-coil domain containing 117 HGNC:26599 details
hsa-miR-5582-3p CD59 CD59 molecule (CD59 blood group) HGNC:1689 details
hsa-miR-5582-3p PNRC1 proline rich nuclear receptor coactivator 1 HGNC:17278 details
hsa-miR-5582-3p YY1 YY1 transcription factor HGNC:12856 details
hsa-miR-5582-3p CHRDL1 chordin like 1 HGNC:29861 details
hsa-miR-5582-3p PTPRB protein tyrosine phosphatase receptor type B HGNC:9665 details
hsa-miR-5582-3p ZNF99 zinc finger protein 99 HGNC:13175 details
hsa-miR-5582-3p CLUAP1 clusterin associated protein 1 HGNC:19009 details
hsa-miR-5582-3p NCK1 NCK adaptor protein 1 HGNC:7664 details
hsa-miR-5582-3p details
hsa-miR-5582-3p PGM2 phosphoglucomutase 2 HGNC:8906 details
hsa-miR-5582-3p ATF6B activating transcription factor 6 beta HGNC:2349 details
hsa-miR-5582-3p ZNF583 zinc finger protein 583 HGNC:26427 details
hsa-miR-5582-3p OR51G1 olfactory receptor family 51 subfamily G member 1 HGNC:14738 details
hsa-miR-5582-3p CDC14B cell division cycle 14B HGNC:1719 details
hsa-miR-5582-3p BBS9 Bardet-Biedl syndrome 9 HGNC:30000 details
hsa-miR-5582-3p UFM1 ubiquitin fold modifier 1 HGNC:20597 details
hsa-miR-5582-3p SMAD4 SMAD family member 4 HGNC:6770 details
hsa-miR-5582-3p SKIL SKI like proto-oncogene HGNC:10897 details
hsa-miR-5582-3p PTAR1 protein prenyltransferase alpha subunit repeat containing 1 HGNC:30449 details
hsa-miR-5582-3p PKN2 protein kinase N2 HGNC:9406 details
hsa-miR-5582-3p NUDT21 nudix hydrolase 21 HGNC:13870 details
hsa-miR-5582-3p LRRC15 leucine rich repeat containing 15 HGNC:20818 details
hsa-miR-5582-3p ENAH ENAH actin regulator HGNC:18271 details
hsa-miR-5582-3p CXCR5 C-X-C motif chemokine receptor 5 HGNC:1060 details
hsa-miR-5582-3p APP amyloid beta precursor protein HGNC:620 details
hsa-miR-5582-3p AFAP1 actin filament associated protein 1 HGNC:24017 details
hsa-miR-5582-3p FBXO2 F-box protein 2 HGNC:13581 details
hsa-miR-5582-3p NT5DC3 5'-nucleotidase domain containing 3 HGNC:30826 details
hsa-miR-5582-3p CSTF1 cleavage stimulation factor subunit 1 HGNC:2483 details
hsa-miR-5582-3p TMC7 transmembrane channel like 7 HGNC:23000 details
hsa-miR-5582-3p IREB2 iron responsive element binding protein 2 HGNC:6115 details
hsa-miR-5582-3p PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma HGNC:8978 details
hsa-miR-5582-3p KCNK6 potassium two pore domain channel subfamily K member 6 HGNC:6281 details
hsa-miR-5582-3p CERK ceramide kinase HGNC:19256 details
hsa-miR-5582-3p UBL3 ubiquitin like 3 HGNC:12504 details
hsa-miR-5582-3p TJP1 tight junction protein 1 HGNC:11827 details
hsa-miR-5582-3p STK38 serine/threonine kinase 38 HGNC:17847 details
hsa-miR-5582-3p NOA1 nitric oxide associated 1 HGNC:28473 details
hsa-miR-5582-3p ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 HGNC:812 details
hsa-miR-5582-3p ABCC1 ATP binding cassette subfamily C member 1 HGNC:51 details
hsa-miR-5582-3p MLLT1 MLLT1 super elongation complex subunit HGNC:7134 details
hsa-miR-5582-3p SUCO SUN domain containing ossification factor HGNC:1240 details
hsa-miR-5582-3p ZNF749 zinc finger protein 749 HGNC:32783 details
hsa-miR-5582-3p KCNS2 potassium voltage-gated channel modifier subfamily S member 2 HGNC:6301 details
hsa-miR-5582-3p PECR peroxisomal trans-2-enoyl-CoA reductase HGNC:18281 details
hsa-miR-5582-3p PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 HGNC:29035 details
hsa-miR-5582-3p DGKE diacylglycerol kinase epsilon HGNC:2852 details
hsa-miR-5582-3p WTIP WT1 interacting protein HGNC:20964 details
hsa-miR-5582-3p CXCL5 C-X-C motif chemokine ligand 5 HGNC:10642 details
hsa-miR-5582-3p DDR2 discoidin domain receptor tyrosine kinase 2 HGNC:2731 details
hsa-miR-5582-3p DNAJB14 DnaJ heat shock protein family (Hsp40) member B14 HGNC:25881 details
hsa-miR-5582-3p GOT1 glutamic-oxaloacetic transaminase 1 HGNC:4432 details
hsa-miR-5582-3p SURF4 surfeit 4 HGNC:11476 details
hsa-miR-5582-3p IL6R interleukin 6 receptor HGNC:6019 details
hsa-miR-5582-3p NEK3 NIMA related kinase 3 HGNC:7746 details
hsa-miR-5582-3p POU4F1 POU class 4 homeobox 1 HGNC:9218 details
hsa-miR-5582-3p RIMS4 regulating synaptic membrane exocytosis 4 HGNC:16183 details
hsa-miR-5582-3p SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone HGNC:16987 details
hsa-miR-5582-3p TPRG1L tumor protein p63 regulated 1 like HGNC:27007 details
hsa-miR-5582-3p IGSF9 immunoglobulin superfamily member 9 HGNC:18132 details
hsa-miR-5582-3p LSM5 LSM5 homolog, U6 small nuclear RNA and mRNA degradation associated HGNC:17162 details
hsa-miR-5582-3p MTMR9 myotubularin related protein 9 HGNC:14596 details
hsa-miR-5582-3p SETD5 SET domain containing 5 HGNC:25566 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab